Molecular marker GmChr1635879788 related to soybean crude oil content and application of molecular marker GmChr1635879788
By developing the molecular marker Gm_Chr16_35879788 by locating SNP sites on soybean chromosome 16, and combining it with KASP technology and quantitative real-time PCR, the problem of difficult identification of crude oil content in soybeans in traditional breeding methods has been solved. This has enabled efficient and low-cost marker-assisted selection, thereby improving the efficiency of soybean breeding.
Patent Information
- Application Number
- CN202511383545.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-26
- Publication Date
- 2025-11-18
AI Technical Summary
Traditional breeding methods for increasing crude oil content in soybeans are time-consuming and inefficient, making it difficult to screen for high-oil-content materials in the early stages. Furthermore, existing molecular marker technologies are costly and complex to operate, making it difficult to efficiently identify oil content.
We developed a molecular marker, Gm_Chr16_35879788, related to crude oil content in soybeans. We located the SNP locus on soybean chromosome 16 using QTL mapping analysis and rapidly identified the oil content of soybean materials using KASP technology and quantitative real-time PCR.
This enables rapid, accurate, and low-cost molecular marker-assisted selection, improving soybean breeding efficiency and simplifying the screening process for high-oil-content materials.
Smart Images
Figure CN120967053A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biotechnology, and particularly relates to a molecular marker Gm_Chr16_35879788 closely related to soybean crude oil content and application thereof. BACKGROUND
[0002] Soybean (Glycine max (L.) Merr.) is one of the most important oil and protein crops in the world, playing a vital role in global agricultural and food security systems. As the main source of edible oil, soybean oil is widely used in human diet, while soybean meal is a high-quality plant protein feed, so soybean is not only related to human daily dietary nutrition supply, but also directly affects the development of animal husbandry and food industry. With the continuous improvement of people's living standards, the demand for vegetable oil is increasing year by year, and increasing the crude oil content of soybean has become one of the important goals to achieve high yield and efficiency and meet market demand.
[0003] In the process of soybean genetic improvement, crude oil content, as a typical quantitative trait, is controlled by multiple genes and is greatly affected by the environment, and its genetic mechanism is complex. Traditional breeding methods often rely on phenotypic selection, but this method is time-consuming, low-efficiency, and difficult to accurately screen high oil content materials in early generations. In order to improve breeding efficiency, molecular marker-assisted selection (MAS) is widely introduced into soybean breeding research, providing an important tool for analyzing and utilizing complex quantitative traits.
[0004] Among various types of molecular markers, KASP (Kompetitive Allele Specific PCR) markers have attracted widespread attention due to their high throughput, low cost, simple operation and accurate results. KASP technology is based on competitive allele-specific primers and fluorescence signal detection, which can efficiently genotype target single nucleotide polymorphism (SNP) sites, so it is very suitable for genetic research and material screening of large-scale populations. In soybean, the development of KASP markers around crude oil content-related gene sites can provide convenience for rapid identification of different varieties or materials, enabling breeders to screen excellent genotypes in early generations, thereby shortening the breeding cycle.
[0005] Meanwhile, quantitative trait locus (QTL) mapping studies provide important theoretical support for resolving the genetic basis of soybean oil content. By constructing different genetic populations, such as recombinant inbred lines (RIL), double haploid (DH) populations, or hybrid offspring populations, and combining molecular marker genotyping data with phenotypic determination results, QTL intervals controlling oil content can be effectively located. The identification of these QTLs not only provides a deep understanding of the genetic mechanisms of oil content, but also lays the foundation for the subsequent development of closely linked molecular markers. With the aid of QTL mapping and marker verification, researchers can gradually achieve the transition from phenotype selection to genotype selection, greatly improving the precision of oil improvement.
[0006] Overall, increasing soybean crude oil content is an important way to achieve high-oil variety cultivation and meet oil supply needs. With the continuous improvement of KASP marker development and QTL mapping technology, soybean oil content improvement is moving towards a more efficient and precise direction. This not only has important academic research value, but also has far-reaching significance for promoting agricultural production and food industry development and ensuring national grain and oil safety. SUMMARY
[0007] One of the purposes of the present application is to provide a molecular marker related to soybean crude oil content.
[0008] The second purpose of the present application is to provide the application of the above-mentioned molecular marker related to soybean crude oil content.
[0009] To achieve the above-mentioned purposes, the present application adopts the following technical solutions: The molecular marker related to soybean crude oil content disclosed by the present application, the inventors measure the crude oil content of soybean grains, and through QTL mapping analysis, a linkage region is located in soybean, which contains a SNP site named Gm_Chr16_35879788. The site is located at position 35879788 on chromosome 16 of the soybean reference genome Glycine max Wm82.a4.v1. There is a T / G base mutation at this site. The nucleotide sequence where the SNP site is located is shown in SEQ ID NO. 1. When the base of the site is T (TT genotype, also referred to as 0 / 0 genotype hereinafter), the crude oil content of the soybean material is high. When the base of the site is G (GG genotype, also referred to as 1 / 1 genotype hereinafter), the crude oil content of the soybean material is low. The population verification results show that the crude oil content of the soybean material with genotype 1 / 1 is significantly lower than that of the soybean material with genotype 0 / 0, and there is a significant difference between the two.
[0010] Specifically, the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein a T / G base mutation exists at the 25th position of the sequence shown in SEQ ID NO. 1, and the sequence is as follows: GAGTTCTCATCTCCAGAGAACCTT T / G CTATTCCACCAGAACATGCTGGTGATGCCAAAACTGATTTAAAGGCCAAGAATGAGAATGCAGGACCATCTTCTGAAAAGACACTTGACATGTCATCATGGATGGATCCATGCATTGAATTTGCTATAAAAACTCTCACTGGCACCATCC (shown as SEQ ID NO. 1, the SNP site Chr16_35879788 (T / G) is bolded and underlined).
[0011] The primer set for amplifying the molecular marker Gm_Chr16_35879788 related to the crude oil content of soybean is as follows: Gm_Chr16_35879788-F1: GAAGGTGACCAAGTTCATGCTGAGTTCTCATCTCCAGAGAACCTTT (shown as SEQ ID NO. 2); Gm_Chr16_35879788-F2: GAAGGTCGGAGTCAACGGATTGAGTTCTCATCTCCAGAGAACCTTG (shown as SEQ ID NO. 3); Gm_Chr16_35879788-R: AGTTTTGGCATCACCAGCATGTTCTGGTG (shown as SEQ ID NO. 4).
[0012] Two forward primers are respectively connected with different fluorescent linker sequences; the 5' end of the forward primer Gm_Chr16_35879788-F1 is connected with a FAM fluorescent linker sequence, and the 5' end of the forward primer Gm_Chr16_35879788-F2 is connected with a VIC fluorescent linker sequence; the FAM and VIC fluorescent linker sequences are respectively as follows: FAM: GAAGGTGACCAAGTTCATGCT (shown as SEQ ID NO. 5); VIC: GAAGGTCGGAGTCAACGGATT (shown as SEQ ID NO. 6).
[0013] The application also discloses application of the primer set of the molecular marker in soybean crude oil content related molecular marker assisted breeding. That is, the primer set of the molecular marker can be used in future molecular marker assisted breeding, and whether the molecular marker exists is detected by extracting DNA of a leaf at a seedling stage, so as to identify the crude oil content of the soybean material. The detection can be performed by using a fluorescent quantitative PCR detection method, and the primer set of the molecular marker can be used.
[0014] The application also discloses application of the primer set of the molecular marker in identification of the crude oil content of the soybean. Specifically, the specific steps for identifying the crude oil content of the soybean are as follows: (1) taking DNA of a test soybean germplasm as a template for fluorescent quantitative PCR amplification, and performing fluorescent quantitative PCR amplification on the primer set corresponding to the molecular marker Gm_Chr16_35879788, and a reaction system for the fluorescent quantitative PCR amplification is shown in Table 1. Table 1 Reaction system for PCR amplification
[0015] 30℃ pre-read fluorescence 1min, 94℃ initial denaturation 15min; 94℃ denaturation 20s, 61℃ annealing and extension 1min, 10 cycles; 94℃ denaturation 20s, 55℃ annealing and extension 1min, 26 cycles; 30℃ final read fluorescence 1min.
[0016] If the sample PCR product only detects the FAM fluorescence signal corresponding to the primer Gm_Chr16_35879788-F1 connected with the fluorescent linker sequence, the detection site is 0 / 0 genotype, and it is determined that the sample is a homozygous type with a high crude oil content phenotype; if the sample PCR product only detects the VIC fluorescence signal corresponding to the primer Gm_Chr16_35879788-F2 connected with the fluorescent linker sequence, the detection site is 1 / 1 genotype, and it is determined that the sample is a homozygous type with a low crude oil content phenotype; if the two kinds of FAM and VIC fluorescence signals corresponding to the primers Gm_Chr16_35879788-F1 and Gm_Chr16_35879788-F2 connected with the fluorescent linker sequence are detected at the same time, the detection site is 0 / 1 genotype (corresponding to a TG genotype), and it is determined that the sample is a heterozygous type with a medium crude oil content phenotype.
[0017] In addition, the application also protects a kit for identifying the crude oil content of soybean, which comprises the primer set Gm_Chr16_35879788-F1, Gm_Chr16_35879788-F2 and Gm_Chr16_35879788-R. Other components of the kit are all conventional reagents. Specifically, it also comprises 2x PCR Mix and ROX supplement. The application has special restrictions on the concentration of the primer pair, and 10 μM concentration can be used. The application has no special restrictions on the source of the 2x PCR Mix and ROX supplement, and the reagents for fluorescence quantitative PCR amplification known in the art can be used.
[0018] The kit of the application can quickly identify the crude oil content of soybean and also can quickly identify the crude oil content genotype of soybean. The specific method is referred to the specific steps for identifying the crude oil content of soybean. Through analysis of the fluorescence quantitative PCR amplification results, if the sample PCR product only detects the FAM fluorescence signal corresponding to the primer Gm_Chr16_35879788-F1 connected with the fluorescent linker sequence, the detection site is 0 / 0 genotype, and it is determined as a homozygous type with high crude oil content phenotype; if the sample PCR product only detects the VIC fluorescence signal corresponding to the primer Gm_Chr16_35879788-F2 connected with the fluorescent linker sequence, the detection site is 1 / 1 genotype, and it is determined as a homozygous type with low crude oil content phenotype; if the two kinds of FAM and VIC fluorescence signals corresponding to the primers Gm_Chr16_35879788-F1 and Gm_Chr16_35879788-F2 connected with the fluorescent linker sequence are detected at the same time, the detection site is 0 / 1 genotype, and it is determined as a heterozygous type with medium crude oil content phenotype.
[0019] The application has the following advantages: (1) The inventors of the application measure the crude oil content of soybean seeds, and through QTL positioning analysis, a linkage region is located in soybean, which contains a SNP site. A molecular marker Gm_Chr16_35879788 related to the crude oil content of soybean is screened out, which is located on chromosome 16 of the soybean reference genome. The molecular marker Gm_Chr16_35879788 of the application can quickly identify the high and low of the crude oil content of soybean.
[0020] (2) The use of the marker related to the crude oil content of soybean for screening high oil content soybean is beneficial to molecular marker assisted selection breeding of soybean, which is simple and feasible, and is beneficial to improving efficiency and saving cost.
[0021] (3) The molecular marker Gm_Chr16_35879788 of the present application has the characteristics of convenient detection, stable amplification product and high specificity, and can be simply, rapidly and high-throughput applied to soybean crude oil content related molecular marker assisted breeding practice and material identification. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 QTL positioning analysis results of crude oil content of soybean.
[0023] Figure 2 The genotype of the Gm_Chr16_35879788 site of the soybean population in Example 1 of the present application corresponds to the crude oil content distribution box plot. 0 / 0 means that the genotype of the Gm_Chr16_35879788 site is a homozygous high crude oil content genotype, 1 / 1 means that the genotype of the Gm_Chr16_35879788 site is a homozygous low crude oil content genotype, the round dot shows the data distribution, and **** represents P <0.0001.
[0024] Figure 3 The result analysis diagram of the amplification molecular marker of the Gm_Chr16_35879788 site of the soybean population in Example 1 of the present application.
[0025] Figure 4 The genotype of the Gm_Chr16_35879788 site of the soybean germplasm resource in Example 2 of the present application corresponds to the crude oil content distribution box plot. 0 / 0 means that the genotype of the Gm_Chr16_35879788 site is a homozygous high crude oil content genotype, 0 / 1 means that the genotype of the Gm_Chr16_35879788 site is a heterozygous medium crude oil content genotype, and 1 / 1 means that the genotype of the Gm_Chr16_35879788 site is a homozygous low crude oil content genotype, the round dot shows the data distribution, and ** represents P <0.01. DETAILED DESCRIPTION
[0027] The advantages and characteristics of the present application will become more apparent as the description proceeds. However, the specific experimental methods involved in the following examples are all conventional methods or are implemented according to the suggested conditions of the manufacturer's instructions, unless otherwise specified.
[0028] Unless specifically indicated, the technical means used in the examples is the conventional means familiar to those skilled in the art. The test methods in the following examples are all conventional methods, unless otherwise specified. Unless otherwise specified, the reagents and materials used can be obtained from the market.
[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Methods and materials similar or equivalent to those described herein can be used in the practice of the present application. The exemplary methods and materials described herein are intended for illustration and not limitation.
[0030] Development of molecular marker related to soybean crude oil content in Example 1 The present application analyzes 135 soybean population materials, and the soybean crude oil content is measured by the crude oil content of the soybean material (unit: %). The higher the value, the higher the crude oil content of the soybean material; the lower the value, the lower the crude oil content of the soybean material. The crude oil content of soybean seeds is determined, and a linkage region is located in soybean by QTL positioning analysis, which contains a SNP site named Gm_Chr16_35879788 in the linkage region. The site is located at position 35879788 on chromosome 16 of soybean reference genome Glycine max Wm82.a4.v1 (download address: https: / / phytozome-next.jgi.doe.gov / ). The site has a T / G base mutation, and the nucleotide sequence of the SNP site is shown in SEQ ID NO. 1, which is at position 25 (counting from the first base at the 5' end as position 1) of the sequence shown in SEQ ID NO. 1). When the base of the site is T (TT genotype, 0 / 0 genotype), the crude oil content of the soybean material is high, and when the base of the site is G (GG genotype, 1 / 1 genotype), the crude oil content of the soybean material is low. The distribution box plot of the crude oil content corresponding to the genotype of the population Gm_Chr16_35879788 site is shown in FIG. 1. Figure 2 As can be seen, the crude oil content of the soybean material with genotype 0 / 0 is high, the crude oil content of the soybean material with genotype 1 / 1 is low, and the crude oil content of the soybean material with genotype 1 / 1 is significantly lower than that of the soybean material with genotype 0 / 0, that is, the difference in crude oil content between the two is extremely significant.
[0031] According to the SNP site and its upstream and downstream sequences, a marker for KASP detection is developed, and the following primer set is designed by SnapGene: Gm_Chr16_35879788-F1: GAAGGTGACCAAGTTCATGCTGAGTTCTCATCTCCAGAGAACCTTT (shown in SEQ ID NO. 2); Gm_Chr16_35879788-F2: GAAGGTCGGAGTCAACGGATTGAGTTCTCATCTCCAGAGAACCTTG (shown in SEQ ID NO. 3); Gm_Chr16_35879788-R: AGTTTTGGCATCACCAGCATGTTCTGGTG (SEQ ID NO. 4).
[0032] Two forward primers are respectively connected with different fluorescent linker sequences; the 5' end of forward primer Gm_Chr16_35879788-F1 is connected with FAM fluorescent linker sequence, and the 5' end of forward primer Gm_Chr16_35879788-F2 is connected with VIC fluorescent linker sequence; the FAM and VIC fluorescent linker sequences are respectively: FAM: GAAGGTGACCAAGTTCATGCT (SEQ ID NO. 5). VIC: GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 6).
[0033] Using the primer set to perform fluorescence quantitative PCR amplification on the sample to be tested, it is found that if the sample PCR product only detects the FAM fluorescent signal corresponding to the primer Gm_Chr16_35879788-F1 connected with the fluorescent linker sequence, the detection site is 0 / 0 genotype, and it is determined as a homozygous type with high crude oil content phenotype; if the sample PCR product only detects the VIC fluorescent signal corresponding to the primer Gm_Chr16_35879788-F2 connected with the fluorescent linker sequence, the detection site is 1 / 1 genotype, and it is determined as a homozygous type with low crude oil content phenotype; if the two kinds of FAM and VIC fluorescent signals corresponding to the primers Gm_Chr16_35879788-F1 and Gm_Chr16_35879788-F2 connected with the fluorescent linker sequence are detected at the same time, the detection site is 0 / 1 genotype, and it is determined as a heterozygous type with medium crude oil content phenotype. Figure 3
[0034] In this study, 71 soybean materials have 0 / 0 genotype at Chr16_35879788 site, and 64 soybean materials have 1 / 1 genotype at Chr16_35879788 site. T test shows that the difference between 0 / 0 type and 1 / 1 type is extremely significant. P <0.0001). The detection results correspond to the genotype at Chr16_35879788 site and the actual crude oil content determination results. Figure 2
[0035] The 135 soybean materials used for marker development are the soybean materials disclosed in the article "Lei Lei, et al. Classification of Soybean Heterotic Groups Based on SSR Molecular Markers for Yield-Related Traits[J]. Crops, 2022(4): 54-61".
[0036] Example 2 Verification of accuracy of the molecular marker described in the application The 39 soybean germplasm resources in the germplasm resource library were identified using the above-mentioned molecular marker. The crude oil content of the soybean germplasm materials and the genotype corresponding to the Chr16_35879788 locus are shown in Table 2: Table 2 Crude oil content of 39 germplasm materials and genotype corresponding to Chr16_35879788 locus
[0037] The genomic DNA of the soybean to be identified was used as a template, and the primer pair was used for fluorescence quantitative PCR amplification to obtain the fluorescence quantitative PCR product.
[0038] The reaction system of fluorescence quantitative PCR amplification is as follows: genomic DNA 1 μL, 2x PCR Mix 5 μL, ROX supplement 0.16 μL, upstream primer F1 0.1 μL, upstream primer F2 0.1 μL, downstream primer R 0.3 μL, and sterile distilled water to 10 μL.
[0039] The reaction program of the fluorescence quantitative PCR amplification is preferably as follows: 30°C pre-read fluorescence 1 min, 94°C initial denaturation 15 min; 94°C denaturation 20 s, 61°C annealing and extension 1 min, 10 cycles; 94°C denaturation 20 s, 55°C annealing and extension 1 min, 26 cycles; 30°C final read fluorescence 1 min.
[0040] According to the fluorescence quantitative PCR product, the crude oil content of the soybean was determined: As can be seen from Table 2, among the 39 soybean germplasm resources identified in this study, 30 soybean germplasm resources had a genotype of 0 / 0 at the Chr16_35879788 locus; 1 soybean germplasm resource had a genotype of 0 / 1 at the Chr16_35879788 locus; and 8 soybean germplasm resources had a genotype of 1 / 1 at the Chr16_35879788 locus. T-test showed that the difference between 0 / 0 and 1 / 1 was very significant P<0.01). The detection result is consistent with the genotype at the Chr16_35879788 site and the actual crude oil content determination result (P < 0.01). Figure 4 Therefore, the KASP marker of the present application can effectively identify the high and low of the crude oil content of soybean, and can be used for prediction and screening of soybean materials with high crude oil content.
[0041] The above-described embodiments are only preferred embodiments of the present application, and are used to explain the present application, but not to limit the scope of the present application. For those skilled in the art, of course, other embodiments can be easily made by substitution or change according to the technical content disclosed in the present application, and therefore, any changes and improvements made on the principle of the present application shall be included in the scope of the patent application of the present application.
Claims
1. A molecular marker Gm_Chr16_35879788 associated with soybean crude oil content, characterized in that, The nucleotide sequence of the molecular marker Gm_Chr16_35879788 is shown as SEQ ID NO. 1, wherein a T / G base mutation exists at position 25 of the sequence shown in SEQ ID NO. 1, wherein when the base at the site is T, the soybean material has high crude oil content, and when the base at the site is G, the soybean material has low crude oil content.
2. The molecular marker Gm_Chr16_35879788 related to soybean high oil content according to claim 1, wherein, The molecular marker Gm_Chr16_35879788 is a KASP marker.
3. A primer set for amplifying the molecular marker Gm_Chr16_35879788 of claim 1, characterized in that The primer set comprises: Gm_Chr16_35879788-F1: GAAGGTGACCAAGTTCATGCTGAGTTCTCATCTCCAGAGAACCTTT; Gm_Chr16_35879788-F2: GAAGGTCGGAGTCAACGGATTGAGTTCTCATCTCCAGAGAACCTTG; Gm_Chr16_35879788-R: AGTTTTGGCATCACCAGCATGTTCTGGTG. 4.The primer set of molecular marker Gm_Chr16_35879788 according to claim 3, wherein Two forward primers are respectively connected with different fluorescent linker sequences; the 5' end of the forward primer Gm_Chr16_35879788-F1 is connected with a FAM fluorescent linker sequence, and the 5' end of the forward primer Gm_Chr16_35879788-F2 is connected with a VIC fluorescent linker sequence; the FAM and VIC fluorescent linker sequences are respectively: FAM: GAAGGTGACCAAGTTCATGCT; VIC: GAAGGTCGGAGTCAACGGATT.
5. Use of the primer set of the molecular marker Gm_Chr16_35879788 of claim 3 in identifying or assisting in identifying the crude oil content of soybean.
6. Use according to claim 4, characterized in that, A method for identifying the crude oil content of soybean, comprising the following steps: (1) extracting soybean genomic DNA to be tested; (2) using the primer set of the molecular marker Gm_Chr16_35879788 of claim 3 to perform fluorescent quantitative PCR amplification on the extracted genomic DNA in step (1) as a template, and analyzing the fluorescent quantitative PCR amplification results; (3) determining according to the results of step (2), and the specific standard is: If the sample PCR product only detects the FAM fluorescence signal corresponding to the primer Gm_Chr16_35879788-F1 with the fluorescent linker sequence connected, the locus is 0 / 0 genotype, and it is determined as the homozygous type with high crude oil content phenotype; if the sample PCR product only detects the VIC fluorescence signal corresponding to the primer Gm_Chr16_35879788-F2 with the fluorescent linker sequence connected, the locus is 1 / 1 genotype, and it is determined as the homozygous type with low crude oil content phenotype; if the two kinds of FAM and VIC fluorescence signals corresponding to the primers Gm_Chr16_35879788-F1 and Gm_Chr16_35879788-F2 with the fluorescent linker sequence connected are detected at the same time, the locus is 0 / 1 genotype, and it is determined as the heterozygous type with medium crude oil content phenotype.
7. A kit for identifying soybean oil content, characterized by, The primer set as described in claim 3.
8. The kit of claim 7 for identifying the crude oil content of soybean.
9. Use according to claim 8, characterized in that, The method for identifying the crude oil content of soybean by using the kit is as follows: (1) extracting the soybean genomic DNA to be tested; (2) using the primer set of the molecular marker Gm_Chr16_35879788 as described in claim 3 to perform fluorescent quantitative PCR amplification on the genomic DNA extracted in step (1) as the template, and analyzing the fluorescent quantitative PCR amplification results; (3) analyzing the fluorescent quantitative PCR amplification results, if the sample PCR product only detects the FAM fluorescence signal corresponding to the primer Gm_Chr16_35879788-F1 with the fluorescent linker sequence connected, the locus is 0 / 0 genotype, and it is determined as the homozygous type with high crude oil content phenotype; if the sample PCR product only detects the VIC fluorescence signal corresponding to the primer Gm_Chr16_35879788-F2 with the fluorescent linker sequence connected, the locus is 1 / 1 genotype, and it is determined as the homozygous type with low crude oil content phenotype; if the two kinds of FAM and VIC fluorescence signals corresponding to the primers Gm_Chr16_35879788-F1 and Gm_Chr16_35879788-F2 with the fluorescent linker sequence connected are detected at the same time, the locus is 0 / 1 genotype, and it is determined as the heterozygous type with medium crude oil content phenotype.