Combined application of prebiotics and probiotics

Abstract

The invention relates to the technical field of livestock and poultry breeding, and particularly discloses combined application of prebiotics and probiotics, the prebiotics are propyl inulin nano prebiotics, and the probiotics are plant lactobacillus. 0.1 g / kg of propyl inulin nano prebiotics and 109 CFU / kg of plant lactobacillus are added into the broiler feed, so that the weight gain ratio of the broiler feed is reduced to 1.67, the pectoral muscle rate is increased to 30.4%, the anti-oxidation defense and immune regulation capabilities are improved, the intestinal microbial metabolic pathway is remarkably changed, and the growth of the broiler feed is promoted. The combined application of prebiotics and probiotics realizes triple improvement of broiler chicken production performance, immunocompetence and intestinal health, and provides a new way for promoting green and safe development of broiler chicken breeding industry.

Description

Technical Field

[0001] This invention relates to the field of livestock and poultry breeding technology, specifically to the combined application of prebiotics and probiotics. Background Technology

[0002] In recent years, the overuse of antibiotics has raised increasing public concern about its potential risks. To mitigate these risks, some countries and regions have attempted to ban the use of growth-promoting antibiotics in livestock and poultry farming. However, since the implementation of these bans, bacterial infection rates in young animals have increased year by year, while the use of therapeutic antibiotics has also increased, leading to decreased productivity, increased farming costs, and ultimately hindering the sustainable development of the livestock industry. To address the complex challenges posed by antibiotic overuse, there is an urgent need to develop new pathways to promote the green and safe development of the livestock industry. Summary of the Invention

[0003] To develop a new approach to promote the green and safe development of the aquaculture industry, this invention provides a combined application of prebiotics and probiotics. The prebiotic in this invention is propyl inulin nano-prebiotic, and the probiotic is *Lactobacillus plantarum*, administered at concentrations of 0.1 g / kg and 10 g / kg, respectively. 9 Adding CFU / kg to broiler feed reduced the feed gain ratio to 1.67, increased the breast muscle rate to 30.4%, enhanced antioxidant defense and immune regulation capabilities, and significantly altered intestinal microbial metabolic pathways. This indicates that the combined application of prebiotics and probiotics achieved a triple improvement in broiler production performance, immunity, and intestinal health, providing a new approach to promote the green and safe development of the broiler farming industry.

[0004] This invention provides a combined application of prebiotics and probiotics, characterized in that the application is to improve the growth performance, muscle yield, and immunity of broilers or to regulate the intestinal microbiota of broilers. The prebiotic is propyl inulin nanoprebiotic, and the probiotic is Lactobacillus plantarum.

[0005] The combined application of prebiotics and probiotics provided by this invention reduces the feed gain ratio of broilers to 1.67, increases the breast muscle rate to 30.4%, enhances antioxidant defense and immune regulation capabilities, and significantly alters the intestinal microbial metabolic pathway.

[0006] Furthermore, the application is as follows: the propyl inulin nano-prebiotic and *Lactobacillus plantarum* are added to feed as feed additives; the *Lactobacillus plantarum* is added in the form of freeze-dried *Lactobacillus plantarum* powder.

[0007] Furthermore, the amount of propyl inulin nano-prebiotic added is 0.1 g / kg feed to 0.2 g / kg feed, and the amount of *Lactobacillus plantarum* freeze-dried powder added is 10 g / kg feed. 6 CFU / kg feed ~109 CFU / kg feed.

[0008] Furthermore, the propyl inulin nano-prebiotic is obtained by freeze-drying after mixing and reacting inulin, N,N-dimethylformamide and propionic anhydride; the plant lactobacillus freeze-dried powder is obtained by culturing plant lactobacillus in MRS medium, followed by centrifugation, resuspension and freeze-drying.

[0009] Further, the preparation steps of the propyl inulin nano-prebiotic are as follows: inulin is dissolved in N,N-dimethylformamide to prepare a 5%~20% inulin solution, propionic anhydride is added to the inulin solution, and the reaction is carried out by stirring at 35℃~45℃. The reaction product is dialyzed through a dialysis membrane with a molecular weight of 14000. After the dialyzed product is freeze-dried, it is redissolved in N,N-dimethylformamide, dialyzed twice, and then freeze-dried again to obtain the propyl inulin nano-prebiotic.

[0010] Further, the lyophilized Lactobacillus plantarum powder is prepared by the following steps: Lactobacillus plantarum strain is cultured three times using MRS agar / broth medium to obtain third-generation single colonies, which are then inoculated into MRS broth medium for a second culture. The cultured bacterial suspension is centrifuged and the supernatant is discarded. The bacterial precipitate is resuspended using PBS buffer, and the resuspended solution is freeze-dried to obtain the lyophilized Lactobacillus plantarum powder.

[0011] Furthermore, the molar ratio of propionic anhydride to inulin is 3:1 to 9:1.

[0012] Furthermore, the preservation number of the *Lactobacillus plantarum* is CGMCC NO. 34430.

[0013] Compared with the prior art, the beneficial effects of the present invention are as follows: The combined application of prebiotics and probiotics provided by this invention achieves a triple improvement in broiler production performance, immunity, and gut health through synergistic effects, providing a new approach to promote the green and safe development of the broiler farming industry.

[0014] In this invention, the T2 group, which combined prebiotics and probiotics, showed a decrease in feed gain ratio (F / G) to 1.67 (compared to 1.75 in the control group, P<0.05) and an increase in breast muscle percentage to 30.4% (compared to 28.7% in the control group, P<0.05), indicating that the combined application of prebiotics and probiotics significantly improved broiler production performance. Increased levels of the anti-inflammatory factor IL-10, serum total antioxidant capacity (T-AOC), and superoxide dismutase (SOD) activity further enhanced the immune regulation and antioxidant defense capabilities of broilers. Tightly linked protein genes were also observed. Occludin , MUC2Upregulation of expression, increased jejunal villus height / crypt depth ratio (V / C) and secretory IgA levels indicate that the combined application of prebiotics and probiotics enhances intestinal health and barrier function in broilers; the most extensive changes were observed in intestinal microbial metabolic pathways, indicating that the combined application of prebiotics and probiotics has a significant impact on the intestinal flora and metabolism of broilers. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 Contour plots and three-dimensional response surface plots showing the effects of various factors on the degree of PIN prebiotic substitution; In the figure, A is the contour plot and three-dimensional response surface plot of the molar ratio of propionic anhydride to inulin and the inulin concentration; B represents the contour plot and three-dimensional response surface plot of the molar ratio of propionic anhydride to inulin and temperature; C represents the contour plot and three-dimensional response surface plot of inulin concentration and temperature.

[0017] Figure 2 Spectral analysis of inulin and PIN prebiotics; In the figure, A represents the FTIR spectra of inulin and PIN prebiotics; B is the 1H-NMR spectrum of inulin; C is the 1H-NMR spectrum of PIN.

[0018] Figure 3 Characterization analysis of PIN prebiotics; In the figure, A is a scanning electron microscope image of PIN prebiotics, where the left image is a scanning electron microscope image at 10 μm and the right image is a scanning electron microscope image at 5 μm. B represents the pin size measured by dynamic light scattering (DLS); C represents the ζ-potential of the PIN as measured by an electrophoretic light scattering spectrometer (ELS).

[0019] Figure 4 The study included immune-related cytokines and antioxidant properties of each group of broilers. In the figure, A represents the concentration of IL-4; B represents the IL-10 concentration; C represents the concentration of IL-6; D represents the TNF-α concentration; E represents the MDA concentration; F represents the activity of superoxide dismutase (SOD); G represents the activity of glutathione peroxidase (GSH-Px); H represents total antioxidant capacity (T-AOC) activity.

[0020] Figure 5 Organ coefficients and liver function-related enzyme concentrations for each group of broilers; In the figure, A represents the bursa of Fabricius coefficient at 28 days; B represents the liver coefficient at 42 days; C represents the kidney coefficient at 42 days; D represents the concentration of alkaline phosphatase (ALP); E represents the concentration of alanine aminotransferase (ALT); F represents the concentration of aspartate aminotransferase (AST).

[0021] Figure 6 For the intestinal immunity and morphology analysis of each group of broilers; In the figure, A represents the ratio of jejunal villus height to crypt depth; B represents the concentration of sIgA; C represents a sausage slice taken at 28 days of age; D is a section of intestine taken at 42 days.

[0022] Figure 7 The expression levels of tight junction proteins, mucins, and immune cells in the small intestine of broiler chickens in each group; In the diagram, A is... ZO-1 Level of expression; B is Claudin1 Level of expression; C is Occludin1 Level of expression; D is MUC2 Level of expression; E is RORγt Level of expression; F is FoxP3 Level of expression; G represents the ratio of Th17 to Treg.

[0023] Figure 8 Alpha diversity and principal coordinate analysis of the gut microbiota of each group of broilers; In the figure, A represents the α-diversity of the gut microbiota in each group of broilers at 28 days; B represents the α-diversity of the gut microbiota in each group of broilers at 42 days; C represents the principal coordinate analysis of the gut microbiota of each group of broilers at 28 days; Principal coordinate analysis of gut microbiota in each group of broilers at 42 days; Figure 9 To screen for differential metabolites in the gut microbiota of broiler chickens in each group.

[0024] Figure 10 A comparison of the functions of differentially metabolites in the gut microbiota of broiler chickens from different groups; In the figure, A represents a functional comparison of differentially metabolites in the gut microbiota of broilers in group C and group T1; B is a functional comparison of differentially metabolized gut microbiota in broiler chickens between group C and group T2; C represents a functional comparison of differentially metabolized gut microbiota in broiler chickens from group C to group T3. Detailed Implementation

[0025] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0026] Example 1: A combined application of prebiotics and probiotics I. Experimental Materials Propionic anhydride (Pa, ≥98%) and N,N-dimethylformamide (DMF, ≥99.5%) were purchased from Shanghai Aimeike Biotechnology Co., Ltd. (Shanghai, China), inulin (I, ≥90%, CAS No. 9005-80-5) was purchased from Shanghai Sangon Biotech Co., Ltd. (Shanghai, China), and other chemicals were purchased from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China). The bacterial culture medium was Demangossa Sassa (MRS) broth / agar medium.

[0027] The strain of *Lactobacillus plantarum* was obtained from the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC NO. 34430.

[0028] II. Test Methods 1. Synthesis of Propylin Inulin Nanoparticles (PIN) Prebiotics 0.5 g of inulin was weighed and placed in a three-necked flask. 10 mL of DMF was added, and the mixture was stirred at 44 °C and 100 rpm for 1 h using a digital thermostatic magnetic stirrer to completely dissolve the inulin, yielding a 5% (w / v) inulin solution. Propionic anhydride (Pa) and a catalyst (sodium acetate) were added to the inulin solution, and the mixture was stirred continuously at 44 °C for 24 h to allow the reaction to proceed. After the reaction was complete, the reaction mixture was dialyzed with purified water at room temperature for 12 h using a dialysis membrane with a molecular weight of 14000. The dialysate was then lyophilized. The lyophilized sample was weighed and reconstituted with DMF (lyophilized sample: DMF = 10 mg: 1 mL), and dialyzed a second time with purified water at 4 °C for 24 h. After the second dialysis, the sample was lyophilized again to obtain PIN prebiotics, which were stored at -20 °C.

[0029] 2. Response Surface Methodology (RSM) Optimization of PIN Prebiotic Synthesis The synthesis conditions of PIN prebiotics were optimized using response surface methodology (RSM). Three independent variables were selected: inulin concentration (5%, 10%, and 20%), molar ratio of propionic anhydride to inulin (3:1, 6:1, and 9:1), and reaction temperature (35°C, 40°C, and 45°C), with each variable tested at three levels.

[0030] 3. Characterization of PIN prebiotics The synthesized PIN prebiotic was characterized by Fourier transform infrared spectroscopy (FTIR), 1H nuclear magnetic resonance (1H NMR), and scanning electron microscopy (SEM). The size and zeta potential of the PIN prebiotic were determined using a Zetasizer Nano ZS90 spectrometer; Fourier transform infrared spectroscopy (FTIR) was performed using an FTIR 650 spectrometer (provided by Tianjin Gangdong SCI.&TECH Co., Ltd.), at 4000 cm⁻¹. -1 Up to 800 cm -1 Within the range, at 4.0 cm -1 The sample was scanned 64 times at a resolution. 10 mg of inulin and PIN prebiotic were weighed, placed into an NMR tube, and dissolved in dimethyl sulfoxide-d6 (DMSO-d6). 1H-NMR spectra were acquired using a 500 MHz NMR spectrometer. Based on NMR spectroscopy analysis, the degree of substitution (DS) of the PIN prebiotic was calculated.

[0031] DS=(A2 / 5) / (A3.5-5.5 / 7); In the formula, A2 / 5 represents the number of protons in acetylated ethyl groups; A3.5-5.5 / 7 represents the number of protons in the fructose backbone of inulin.

[0032] 4. Bacterial culture and preparation of freeze-dried powder The *Lactobacillus plantarum* strain was inoculated onto MRS agar plates by streaking. After incubation at 37°C for 24 h (referred to as first-generation activation), first-generation single colonies were obtained. Samples were taken from the first-generation single colonies and inoculated into MRS broth medium, and incubated at 37°C for another 24 h to obtain first-generation liquid cultures, which were then used to inoculate MRS agar plates for a second round of incubation. This process was repeated to obtain third-generation single colonies. The MRS agar plates with grown colonies were then sealed and stored at 4°C for later use.

[0033] During large-scale culture, third-generation single colonies of *Lactobacillus plantarum* were inoculated into MRS broth medium and cultured at 37°C for 12 h. A second culture was then performed at a 2% (v / v) inoculation rate, followed by another 24 h of culture at 37°C. The bacterial suspension was then centrifuged at 4500 r / min for 30 min at 4°C, the supernatant was discarded, and the bacterial precipitate was resuspended in PBS buffer at 10% of the original culture volume. The resuspended suspension was frozen at -80°C for 12 h and then freeze-dried to obtain *Lactobacillus plantarum* freeze-dried powder, denoted as LP, for subsequent experiments.

[0034] 5. Feeding trial of PIN prebiotics and probiotics in broilers A total of 120 Arbor Acres (AA) broiler chickens were selected and divided into four groups (labeled C, T1, T2, and T3, respectively), with five replicates in each group and six chickens in each replicate. Detailed grouping information is shown in Table 1.

[0035] The trial lasted 42 days and was divided into two phases: an early phase (days 1-28) and a late phase (days 29-42). Throughout the trial, groups T1 and T3 were supplemented daily with LP and PIN prebiotics, respectively; group T2 was supplemented daily with both LP and PIN prebiotics; and group C (control group) received only a basal diet. Fecal samples were collected from all four treatment groups on days 1, 7, 14, 21, 28, and 42 for 16S rRNA sequencing. For 12 hours prior to the end of each phase (i.e., before day 28 and day 42), the chickens were fasted but allowed free access to water.

[0036] Table 1 Experimental Arrangement and Grouping 5.1 Broiler Growth Performance Analysis At the start of the experiment (Day 1), the body weight of the four groups of broilers was measured, and the measurements were repeated weekly. The final body weight (FBW) for both the early and late stages was recorded. Feed intake was recorded daily throughout the experiment. Based on these data, the average daily feed intake (ADFI), average daily gain (ADG), and feed conversion ratio (F / G) of the four groups of broilers were calculated using the following formulas:

[0037] ADG (Average Daily Weight Gain) = (Final Weight - Initial Weight) / Number of Experimental Days; ADFI (Average Daily Feed Intake) = Total Feed Intake / Number of Experimental Days; Feed gain ratio (F / G) = ADFI / ADG.

[0038] 5.2 Slaughter Performance Testing At the end of the experiment, three broiler chickens were randomly selected from each of the five replicates in the four groups. After a 12-hour fast, the live weight of each chicken was recorded. Slaughter was performed by cervical bleeding, and slaughter performance parameters were measured, including dressing percentage, eviscerated portion percentage, semi-eviscerated portion percentage, breast muscle percentage, and leg muscle percentage. The following formula was used for calculation:

[0039] Dressing percentage (%) = (carcass weight / live body weight) × 100%; Evisceration rate (%) = (Weight of eviscerated animal / Body weight) × 100%; Semi-eviscerated yield (%) = (half eviscerated weight / live body weight) × 100%; Pectoral muscle percentage (%) = (chest muscle weight / weight excluding viscera) × 100%; Leg muscle percentage (%) = (leg muscle weight / weight excluding viscera) × 100%.

[0040] 5.3 Organ Index Measurement Organs (heart, liver, spleen, lungs, kidneys, and thymus) were collected from broiler chickens, weighed separately, and the organ index was calculated using the following formula: Organ index = (organ weight / body weight) × 100%.

[0041] 5.4 Liver function tests Whole blood from broilers was injected into centrifuge tubes, placed at an angle to form a slant, and allowed to stand at room temperature for 4 hours. The edges of the blood clots were then aseptically peeled off to promote serum exudation. The tubes were centrifuged at 3000 rpm for 30 minutes, and serum samples were collected. The levels of aspartate aminotransferase (AST), alanine aminotransferase (ALT), and alkaline phosphatase (ALP) in the four groups of serum samples were measured using a serum biochemical analyzer.

[0042] 5.5. Observation of intestinal morphology The jejunal segment fixed in the tissue fixative was cut into 5 μm thick sections and stained with hematoxylin and eosin (H&E). The stained sections were observed under a fluorescence microscope, and representative images of the jejunum were recorded. The height of the intestinal villi and the depth of the crypts were measured, and the ratio of villi height to crypt depth was calculated.

[0043] 5.6. qRT-PCR determination of mRNA expression levels After rinsing and homogenizing the collected jejunal samples, total RNA was extracted using an RNA extraction kit (Shanghai Sangon Biotech Co., Ltd., B511311). The extracted RNA was then converted into cDNA using a reverse transcription kit (Accurate Biotechnology Co., Ltd., AG11728). Using cDNA as a template, the target gene was amplified on a real-time quantitative PCR instrument (Hangzhou Bio-Rad Laboratories Co., Ltd., FDQ-96A) using a 2×SYBR Green PCR Mastermix (Shanghai Sangon Biotech Co., Ltd., B532955). The amplification system contained 10 μL of: 5 μL of 2×SGExcel FastSYBR mixture, 1 μL of forward primer, 1 μL of reverse primer, 1 μL of cDNA, and 2 μL of RNase-free ddH2O. The amplification program was: initial denaturation at 95℃ for 3 min, denaturation at 95℃ for 5 s, annealing at 60℃ for 20 s, and extension at 72℃ for 30 s, for a total of 40 cycles. ACTB As an internal control, the relative expression level of the target gene is measured via 2... -∆∆Ct The method has been determined. Primer information is as follows:

[0044] ACTB Forward primer: GAGAAATTGTGCGTGACATCA, SEQ ID NO: 1; ACTB Reverse primer: CCTGAACCTCTCATTGCCA, SEQ ID NO: 2; ZO-1 Forward primer: GTGACTCTTCACAGGGCTCC, SEQ ID NO: 3; ZO-1 Reverse primer: GTAGCAGTCCTTCTGCTGGG, SEQ ID NO: 4; Occludin1 Forward primer: ACGGCAGCACCTACCTCAA, SEQ ID NO: 5; Occludin1 Reverse primer: GGGCGAAGAAGCAGATGAG, SEQ ID NO: 6; Claudin1 Forward primer: ACCCACAGCCTAAGTGCTTC, SEQ ID NO: 7; Claudin1 Reverse primer: AGGTCTCATAAGGCCCCACT, SEQ ID NO: 8; MUC2 Forward primer: GGATGGGCGGATTGTCAAGA, SEQ ID NO: 9; MUC2 Reverse primer: CTGTCCAGCTCCACCATCAG, SEQ ID NO: 10; FoxP3 Forward primer: CCGTGTCGGTGGCTATGATG, SEQ ID NO: 11; FoxP3 Reverse primer: CTCTTGAAGCTGCTGCTGTTG, SEQ ID NO: 12; RORγt Forward primer: CGCATTGGAGATTGAGCTGC, SEQ ID NO: 13; RORγt Reverse primer: TTTCTGGAAGGCGCAGACC, SEQ ID NO: 14.

[0045] 6. Analysis of broiler gut microbiota Total bacterial genomic DNA was extracted from cecal samples of broiler chickens using a kit (Shanghai Paisenno Biotechnology Co., Ltd.). DNA samples were obtained, and their concentration was assessed using a micro-spectrophotometer. Agarose gel electrophoresis was used to evaluate the quality of the DNA samples. The V3 and V4 regions of the bacterial 16S rRNA gene were amplified using Ex-Taq polymerase (Takara Biotechnology (Beijing) Co., Ltd.) and universal primers (338F: ACTCCTACGGGAGGCAGCA; 806R: GGACTACHVGGGTWTCTAAT) to analyze the gut microbiota. The DNA samples were then used for library construction and sequencing using the Illumina NovaSeq / MiSeq platform. After obtaining the raw sequencing data and constructing the library, quality control, sequence merging, and taxonomic annotation were performed using the QIIME2 software package.

[0046] Alpha diversity of the microbial community refers to the species richness, diversity, and evenness in a locally homogeneous habitat, also known as habitat diversity. To more accurately assess the impact of different treatments on the alpha diversity of the broiler gut microbiome, the Chao1 index was used to assess species richness, the Shannon and Simpson indices were used to assess species diversity, and the Faith phylogenetic diversity index was used to assess phylogenetic diversity.

[0047] 7. Analysis of intestinal microbial metabolites in broilers 0.05 g of cecal sample was mixed with 0.5 mL of pre-cooled methanol and steel balls, homogenized using a high-throughput grinder at 55 Hz, followed by ultrasonic extraction for 10 min. The extract was then frozen at -20℃ for 30 min, centrifuged at 4℃ and 12000 r / min for 15 min, and the supernatant was collected and filtered through a 0.22 μm filter membrane into a 1.5 mL sample vial for LC-MS analysis. Chromatographic separation was performed using an ACQUITY UPLC HSS T3 column (100A, 1.8 μm, 2.1 mm × 100 mm) at a flow rate of 0.4 mL / min, a column temperature of 40℃, an autosampler temperature of 8℃, and an injection volume of 2 μL. Mass spectrometry analysis was performed using a HESI source in positive and negative DDA modes. MS1 resolution was set to 60,000, and the scan range was 100 m / z to 1000 m / z. The first four precursor ions were selected for MS / MS fragmentation using HCD (collision energy 30%, dynamic exclusion 8 s). MS2 resolution was set to 15,000.

[0048] Untargeted metabolomics analysis was performed by Shanghai Paiseno Biotechnology Co., Ltd. Raw data were processed using Thermo Fisher's Compound Discoverer™ 3.3 software, including peak extraction, alignment, and normalization. Features missing in more than 50% of the quality control samples were removed, and missing values ​​were imputed using the Fill Gaps algorithm. Metabolite identification was based on a self-built database and public MS / MS libraries, with an MS1 ​​quality tolerance of 15 ppm and an MS2 matching factor threshold of 50.

[0049] The screening criteria for differentially expressed metabolites included: VIP value (derived from PLS-DA analysis) > 1.0, fold change (FC) > 2 or < 0.5, and p-value (derived from t-test) < 0.05. Multivariate statistical analysis employed principal component analysis (PCA) and partial least squares discriminant analysis (PLS-DA), and pathway enrichment analysis was used to interpret the biological significance of metabolite variations.

[0050] III. Test Results 1. Optimization of experimental conditions using response surface methodology Response surface methodology (RSM) was used to optimize experimental conditions. Seventeen independent experiments were designed and repeated, and the DS values ​​of the PIN prebiotic were measured and recorded. The experimental results are summarized in Table 2. A regression model describing the relationship between the three independent variables and the product DS was established through multiple regression analysis. The obtained regression model is as follows:

[0051] Y=1.07+0.3026×A+0.0510×B+0.0552×C-0.0360×AB-0.0625×AC-0.0025×BC-0.2169×A 2 -0.1553×B 2 +0.0755×C 2 .

[0052] Table 2. DS values ​​of PIN prebiotics under different conditions Note: In the table, A represents the molar ratio of propionic anhydride to inulin, B represents the inulin concentration, and C represents the reaction temperature.

[0053] Analysis of variance (ANOVA) showed that the regression model was highly significant, with an F-value of 23.03 and a corresponding P-value of 0.0002 (P < 0.001), indicating that the regression model can effectively predict and analyze the degree of substitution (DS) of PIN prebiotics. The model exhibited extremely high goodness of fit, with a coefficient of determination (R²) of 0.9673 and an adjusted R² (R²_adj) of 0.9253, indicating that the model can explain 92.53% of the response variance.

[0054] 2. Response surface analysis of the interaction between two factors and determination of optimal conditions The interactions between variables and their impact on the DS of PIN prebiotics were visualized using contour plots and three-dimensional response surface plots. Figure 1 The curvature of A is greater than Figure 1 B and C are more significant, indicating that the interaction between the molar ratio of I to Pa and the inulin concentration has a greater impact on DS, while the interaction between the molar ratio and temperature, and the interaction between temperature and concentration have a smaller impact.

[0055] Response surface methodology (RSM) optimization was used to determine the optimal preparation conditions for PIN prebiotics: a molar ratio of Pa to inulin of 7.3:1, an inulin concentration of 9.7%, and a reaction temperature of 44.6℃. Under these conditions, the predicted DS value was 1.213, while the experimentally measured DS value was 1.32, indicating a high degree of consistency between the predicted and actual values.

[0056] 3. Analysis of PIN prebiotic characteristics 3.1 Fourier Transform Infrared Spectroscopy (FTIR) Analysis FTIR was used to analyze the structural characteristics of PIN prebiotics; the corresponding spectra are shown below. Figure 2 The FTIR spectrum of native inulin A at 3335.32 cm⁻¹ - ¹(OH stretching vibration), 2929.35 cm - ¹(CH stretching vibration of sugar ring) and 1017.58 cm⁻¹- ¹(ether bond COC stretching vibration) shows a characteristic absorption peak, consistent with the typical molecular structure of inulin. Compared to inulin, the FTIR spectrum of PIN prebiotics shows a peak at 1734.66 cm⁻¹. - ¹ and 1172.14 cm - New characteristic peaks appeared at ¹, corresponding to the stretching vibration of the ester carbonyl group and the bending vibration of CO, respectively. These peaks originated from the reaction between inulin and propionic anhydride, indicating that the propionyl group (-CH2CH3) was introduced into the inulin structure. The presence of these new absorption peaks confirms the successful esterification of inulin with propionic anhydride. Apart from these specific changes, the overall FTIR spectral profiles of inulin and PIN prebiotics were basically similar, indicating that no significant side reactions occurred during the modification process.

[0057] 3.2 1H Nuclear Magnetic Resonance Analysis PIN prebiotics are synthesized via an esterification reaction of propionic anhydride (Pa) and inulin (I), after which a propionyl group is introduced onto the sugar ring of the inulin backbone. The 1H-NMR spectrum (...) Figure 2 In samples B and C), a characteristic peak of propionyl alkyl protons appeared in the range of 1.0 ppm to 2.0 ppm, and the signal in the range of 3.5 ppm to 5.5 ppm corresponded to the fructose ring backbone protons in inulin and PIN prebiotic. DS calculations, based on the integral ratio of the newly emerging specific alkyl proton peak (unique to PIN prebiotic) to the fructose ring proton peak, confirmed the success of the modification and enabled accurate determination of the degree of substitution.

[0058] 3.3 Scanning Electron Microscopy Analysis The surface morphology of PIN prebiotics synthesized under optimal conditions was observed using scanning electron microscopy (SEM), and the results are as follows: Figure 3 As shown in Figure A, PIN prebiotics were observed to exhibit spherical nanostructures with smooth surfaces at different magnifications.

[0059] 3.4 Particle size and zeta potential analysis of PIN prebiotics The particle size and surface charge of PIN prebiotics were measured using dynamic light scattering (DLS) and electrophoretic light scattering, respectively. Figure 3 As shown in B and C, the average particle size of PIN prebiotics is 167.4 nm and the Zeta potential is -50.06 mV, indicating that PIN prebiotics have good dispersion stability and nanoscale characteristics.

[0060] 4. Effects of PIN prebiotics and probiotics on broiler growth performance and slaughter traits The experimental results are shown in Tables 3 and 4.

[0061] Table 3. Effects of PIN prebiotics and probiotics on broiler growth performance Note: Mean values ​​of identical letters or no letters in the same row indicate no significant difference (P>0.05); mean values ​​of different lowercase letters indicate significant difference (P<0.05); mean values ​​of different uppercase letters indicate highly significant difference (P<0.01).

[0062] In the early stages of the experiment, the average daily feed intake (ADFI) of the T2 treatment group was significantly lower than that of the T1 and T3 groups (P<0.01), but there was no significant difference in feed gain ratio (F / G). In the later stages of the experiment, the final body weight (FBW) and average daily gain (ADG) of the broilers in the T2 group were higher than those of the other three groups, while the feed gain ratio (F / G) was lower. Throughout the entire experiment, the feed gain ratio of the T2 group was significantly lower than that of the other treatment groups (P<0.05) (Table 3). Compared with the control group (Group C), the eviscerated yield, semi-eviscerated yield, and leg muscle percentage of all three treatment groups were improved, with the breast muscle percentage of the T2 group being significantly higher than that of the control group (P<0.05) (Table 4).

[0063] The results indicate that supplementing with LP and PIN prebiotics helps improve the growth performance and pectoral muscle production of broilers.

[0064] Table 4. Effects of PIN prebiotics and probiotics on broiler slaughter performance. Note: Mean values ​​of identical letters or no letters in the same row indicate no significant difference (P>0.05); mean values ​​of different lowercase letters indicate significant difference (P<0.05).

[0065] 5. Effects of PIN prebiotics-probiotics on immune-related cytokines and antioxidant properties in broilers The immune indicators of serum from each group of broilers are shown in the figure. Figure 4 The levels of pro-inflammatory cytokines IL-4, IL-6, and TNF-α in the serum of broilers did not differ significantly among the groups throughout the experiment. Figure 4 (A, C, and D); In the early stage of the experiment, the level of the anti-inflammatory cytokine IL-10 in the serum of broilers in groups T1 and T2 was significantly higher than that in the control group (A, C, and D); In the early stage of the experiment, the level of anti-inflammatory cytokine IL-10 in the serum of broilers in groups T1 and T2 was significantly higher than that in the control group (A, C, and D). Figure 4 B).

[0066] Antioxidant enzyme levels in serum from each group of broilers are shown below. Figure 4 E~H. In the early stage of the experiment, the total antioxidant capacity (T-AOC) level of broiler serum in the T1 and T2 groups was significantly higher than that in the control group ( Figure 4 In the later stages of the experiment, the levels of superoxide dismutase (SOD) in the serum of broilers in the T1 and T2 groups were also significantly higher than those in the control group. Figure 4 (F).

[0067] The above results indicate that supplementing with LP and PIN prebiotics can enhance the immune response and antioxidant capacity of broilers, and the combined use of LP and PIN prebiotics has a more significant effect.

[0068] 6. Effects of PIN prebiotics and probiotics on organ indices and liver function in broilers In the early stages of the experiment, the bursal index (reflecting immune function) of broilers in groups T1, T2, and T3 was significantly higher than that in the control group. Figure 5 (A); In the late stage of the experiment, the liver index of broilers in group T3 was significantly higher than that in the control group ( Figure 5 (B) The kidney index of broilers in group T2 was significantly higher than that in the control group and group T1. Figure 5 (C).

[0069] In the early stages of the experiment, the serum aspartate aminotransferase (AST) level in group T2 broilers was significantly lower than that in the other three groups, and the alkaline phosphatase (ALP) level was significantly lower than that in group T3. Figure 5 (D, F); there was no significant difference in alanine aminotransferase (ALT) levels in the serum of broilers among the groups. Figure 5 E).

[0070] The above results indicate that PIN prebiotics and probiotics have a potential protective effect on liver function in broilers.

[0071] 7. Effects of PIN prebiotics and probiotics on intestinal morphology and immunity in broilers The ratio of jejunal villus height to crypt depth (V / C ratio), intestinal morphology, and secretory immunoglobulin A (sIgA) levels in broilers of each group were assessed. The results showed that in the early stage of the experiment, the V / C ratio of the jejunum in broilers in groups T1 and T2 was significantly higher than that in the control group. Figure 6 (A), and the intestinal structure of the jejunum of broilers was significantly improved in both the early and late stages of the experiment (A). Figure 6 (C, D). Furthermore, in the early stages of the experiment, the concentration of sIgA in the jejunum of broilers in group T2 was significantly higher than that in group T1 and the control group (C, D). Figure 6 B) indicates that the intestinal mucosal immune function has been enhanced. Figure 6 B).

[0072] 8. Effects of PIN prebiotics and probiotics on intestinal barrier function and immune cells in broilers Potential intestinal toxicity was assessed by analyzing serum lipopolysaccharide (LPS) levels. LPS was undetectable in all broiler groups throughout the trial, indicating that PIN prebiotic-probiotic does not cause intestinal toxicity in broilers.

[0073] To further evaluate the effects of LP and PIN prebiotics on the intestinal barrier, tight junction proteins were detected by RT-qPCR. ZO-1 , Occludin , Claudin1 ) and mucin 2 ( MUC2 The relative mRNA expression level of ) was observed in the T3 group broilers at the beginning of the experiment. ZO-1 Significantly increased expression ( Figure 7 (A), T1 and T2 groups of broiler chickens Occludin Significantly increased expression ( Figure 7 (C), T2 and T3 group broiler chickens MUC2 Significantly increased expression ( Figure 7 (D), broiler chickens in groups T1, T2 and T3 RORγt Significantly increased expression ( Figure 7 (E). In the later stages of the experiment, the T1 group broilers... Claudin-1 Significantly increased expression ( Figure 7 (B), T2 group broiler chickens MUC2 Significantly increased expression ( Figure 7 (D). FoxP3 There was no significant difference in expression levels throughout the entire trial. Figure 7 (F).

[0074] 9. The effects of PIN prebiotics and probiotics on the gut microbiota of broilers Figure 8 Figures A and B illustrate the α-diversity of the gut microbiota in each broiler group. At the beginning of the experiment, the Shannon index of group T3 was significantly higher than that of group T1, indicating improved microbial richness and evenness. Furthermore, the Simpson index of group T3 was also significantly higher than that of groups C and T1. Figure 8 (A). However, in the later stages of the trial, there were no significant differences in α-diversity among the four groups (see A). Figure 8 B).

[0075] To assess the β-diversity of the gut microbiota in each broiler group, principal coordinate analysis (PCoA) based on weighted Bray-Curtis distance was performed. In the early stages of the experiment, group T3 was significantly separated from other groups, exhibiting a unique microbial community structure. Groups T1 and T2 also partially separated from the control group, but the separation was not significant. Figure 8 (C). In the later stages of the experiment, all treatment groups showed clear separation in the PCoA plot, indicating significant differences in β-diversity among them (C). Figure 8 These results indicate that PIN prebiotic-probiotic combination leads to significant changes in gut microbiota composition over time.

[0076] 10. Effects of PIN prebiotics-probiotics on intestinal microbial metabolites in broilers To reveal the metabolic differences among the gut microbiota of different broiler groups, the quantities of differentially metabolites were quantified, and the results of positive ionization (POS) and negative ionization (NEG) patterns were presented in the form of bar charts. Figure 9 ).

[0077] Compared with the control group (C), the T1 group had 35 significantly upregulated metabolites (25 in positive ionization mode and 10 in negative ionization mode) and 39 significantly downregulated metabolites (24 in positive ionization mode and 15 in negative ionization mode); the T2 group had 95 upregulated metabolites (60 in positive ionization mode and 35 in negative ionization mode) and 66 downregulated metabolites (35 in positive ionization mode and 31 in negative ionization mode); and the T3 group had 43 upregulated metabolites (29 in positive ionization mode and 14 in negative ionization mode) and 50 downregulated metabolites (25 in positive ionization mode and 25 in negative ionization mode).

[0078] Compared to group T1, group T2 had 82 upregulated metabolites (41 in positive ionization mode and 41 in negative ionization mode) and 56 downregulated metabolites (28 in positive ionization mode and 28 in negative ionization mode); group T3 had 43 upregulated metabolites (27 in positive ionization mode and 16 in negative ionization mode) and 30 downregulated metabolites (17 in positive ionization mode and 13 in negative ionization mode). Between groups T2 and T3, there were 76 upregulated metabolites (40 in positive ionization mode and 36 in negative ionization mode) and 43 downregulated metabolites (21 in positive ionization mode and 22 in negative ionization mode).

[0079] Functional enrichment analysis of differentially metabolites in the gut microbiota of broiler chickens from different groups was performed to reveal changes in metabolic pathways. The results are as follows: Figure 10As shown in Figures A through C. The results showed that the metabolic pathways in group T2 exhibited the most extensive changes, exceeding those in groups T1 and T3. Groups T1, T2, and T3 all showed significant enrichment in core metabolic pathways compared to the control group, indicating that PIN prebiotic-probiotics induced extensive metabolic reprogramming. Groups T1 and T2 showed enrichment in thiamine metabolism and cofactor biosynthesis, while groups T2 and T3 showed changes in glycerophospholipid metabolism. The T1 group specifically affected taurine and low-taurine metabolism as well as purine metabolism. The T2 group specifically regulated porphyrin metabolism and adrenaline signaling in cardiomyocytes, while the T3 group significantly regulated amino acid metabolic pathways, including glycine, serine, and threonine metabolism, as well as arginine and proline metabolism. These results indicate that although the T1, T2, and T3 groups all induced basic metabolic changes, each group produced unique metabolic characteristics. Among them, the T2 group induced the most extensive regulation of metabolic pathways, suggesting that the combined use of LP and PIN prebiotics can regulate the metabolic pathways of broiler gut microbiota to a greater extent.

[0080] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.

[0081] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A combined application of prebiotics and probiotics, characterized in that, The application is to improve the growth performance, muscle yield, and immunity of broilers or to regulate the intestinal microbiota of broilers. The prebiotic is propyl inulin nanoprebiotic, and the probiotic is Lactobacillus plantarum.

2. The combined application of prebiotics and probiotics according to claim 1, characterized in that, The application is as follows: the propyl inulin nano-prebiotic and Bacillus plantarum are added to feed as feed additives; the Bacillus plantarum is added in the form of freeze-dried Bacillus plantarum powder.

3. The combined application of prebiotics and probiotics according to claim 2, characterized in that, The amount of propyl inulin nano-prebiotic added is 0.1 g / kg feed to 0.2 g / kg feed, and the amount of *Lactobacillus plantarum* freeze-dried powder added is 10 g / kg feed. 6 CFU / kg feed ~10 9 CFU / kg feed.

4. The combined application of prebiotics and probiotics according to claim 3, characterized in that, The propyl inulin nano-prebiotic is obtained by freeze-drying after mixing and reacting inulin, N,N-dimethylformamide and propionic anhydride; the plant lactobacillus freeze-dried powder is obtained by culturing plant lactobacillus in MRS medium, followed by centrifugation, resuspension and freeze-drying.

5. The combined application of prebiotics and probiotics according to claim 4, characterized in that, The preparation steps of the propyl inulin nano-prebiotic are as follows: inulin is dissolved in N,N-dimethylformamide to prepare a 5%~20% inulin solution, propionic anhydride is added to the inulin solution, and the reaction is carried out by stirring at 35℃~45℃. The reaction product is dialyzed through a dialysis membrane with a molecular weight of 14000. After the dialyzed product is freeze-dried, it is redissolved in N,N-dimethylformamide, dialyzed twice, and then freeze-dried again to obtain propyl inulin nano-prebiotic.

6. The combined application of prebiotics and probiotics according to claim 4, characterized in that, The Lactobacillus plantarum lyophilized powder is prepared by the following steps: Lactobacillus plantarum strain is cultured three times using MRS agar / broth medium to obtain third-generation single colonies, which are then inoculated into MRS broth medium for a second culture. The cultured bacterial suspension is centrifuged and the supernatant is discarded. The bacterial precipitate is resuspended using PBS buffer, and the resuspended solution is freeze-dried to obtain the Lactobacillus plantarum lyophilized powder.

7. The combined application of prebiotics and probiotics according to claim 5, characterized in that, The molar ratio of propionic anhydride to inulin is 3:1 to 9:

1.

8. The combined application of prebiotics and probiotics according to claim 1, characterized in that, The preservation number of the *Lactobacillus plantarum* is CGMCC NO. 34430.

Images