Deuterated nucleotides and uses thereof

Abstract

The application belongs to the field of biological medicine, and particularly relates to deuterated nucleotides shown in formula (I) and application thereof.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to the deuterated nucleotides shown in formula (I) and their applications. Background Technology

[0002] As a next-generation biomedical platform, mRNA has shown great potential in areas such as vaccine development, protein replacement therapy, tumor immunotherapy, and gene editing therapy. Although mRNA technology has made breakthrough progress in COVID-19 vaccines, its wider clinical application still faces two key challenges: first, mRNA molecules are easily recognized by the innate immune system, triggering an inflammatory response, which limits the effective dose window; second, the translation efficiency and stability of mRNA still have room for improvement, directly affecting the yield and duration of therapeutic proteins.

[0003] The immunogenicity and translation efficiency of mRNA are regulated by nucleotide composition: on the one hand, unmodified uracil nucleotides are easily recognized by pattern recognition receptors (such as TLR7 / 8, RIG-I, etc.) and activate the type I interferon pathway (Karikó et al., 2005, Immunity); on the other hand, traditional chemical modifications (such as 5-methoxyuridine (5 moU)) can reduce immunogenicity, but have limited effect on improving translation efficiency. In existing technologies, Moderna and BioNTech's COVID-19 vaccines (mRNA-1273 and BNT162b) use m1Ψ to completely replace uridine (U), significantly reducing the immunogenicity of mRNA (by inhibiting the activation of receptors such as TLR7 / 8 and RIG-I), while improving translation efficiency (enhanced ribosome binding ability). However, m1Ψ has not completely eliminated immunogenicity and may still activate innate immune responses through secondary pathways such as TLR3, leading to inflammatory side effects in some patients; m1Ψ also has translational fidelity issues, which may cause ribosome misreading at high doses, resulting in truncated proteins or abnormal translational slip (Mulroney et al., 2024, Nature).

[0004] Therefore, developing novel nucleotide modifiers that can effectively circumvent innate immune recognition while enhancing translational activity and maintaining translational fidelity is key to overcoming the current bottlenecks in mRNA drug development. Summary of the Invention

[0005] This invention provides a deuterated nucleotide that can be used for in vitro transcription of mRNA, which can reduce innate immunity, improve the expression level of mRNA-encoded proteins, and enhance translational fidelity.

[0006] Nucleotides

[0007] A first aspect of the invention provides a nucleotide or a pharmaceutically acceptable salt thereof, wherein the nucleotide has the structure shown in formula (I).

[0008]

[0009] in,

[0010] R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 Each is independently H or D, provided that R is... 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 At least one of them is D;

[0011] R 12 Selected from

[0012] In some implementation schemes, R 5 R 10 R 11 At least one of them is D.

[0013] In some implementation schemes, R 5 The answer is D.

[0014] In some implementation schemes, R 5 It has a deuterium content of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99%. In some embodiments, R 5 It has a deuterium content of at least 95%. In some embodiments, R 5 It has a deuterium content of at least 98%.

[0015] In some implementation schemes, R 10 R 11 The answer is D.

[0016] In some implementation schemes, R 10 R 11It has a deuterium content of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99%. In some embodiments, R 10 R 11 It has a deuterium content of at least 95%. In some embodiments, R 10 R 11 It has a deuterium content of at least 98%.

[0017] In some implementation schemes, R 1 R 2 R 3 R 4 R 6 R 7 R 8 R 9 For H.

[0018] In some implementation schemes, R 12 for

[0019] In some implementation schemes, R 12 for

[0020] In some embodiments, the compound represented by formula (I) is selected from the compound represented by formula (I-1).

[0021]

[0022] Among them, R 5 R 10 R 11 R 12 As defined in any embodiment of the present invention.

[0023] In some embodiments, the nucleotides are selected from...

[0024]

[0025] In some embodiments, the nucleotides are selected from...

[0026]

[0027] nucleosides

[0028] A second aspect of the invention provides a nucleoside or a pharmaceutically acceptable salt thereof, wherein the nucleoside has the structure shown in formula (II).

[0029]

[0030] Among them, R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 As defined in any embodiment of the present invention.

[0031] In some embodiments, the nucleoside is selected from...

[0032]

[0033] Polynucleotides

[0034] A third aspect of the present invention provides a polynucleotide encoding a target polypeptide and / or protein, wherein the polynucleotide comprises one or more modified uracil nucleotides or nucleosides derived from the nucleotides of the first aspect of the present invention or pharmaceutically acceptable salts thereof, or the nucleosides of the second aspect of the present invention or pharmaceutically acceptable salts thereof.

[0035] In some embodiments, the modified uracil nucleotide or nucleoside comprises or has the structure shown in formula (III).

[0036]

[0037] Among them, R 1 R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 As defined in any embodiment of the present invention.

[0038] In some implementations, the structure shown in equation (III) is selected from...

[0039]

[0040] In some embodiments, the modified uracil nucleotide comprises or has the structure shown in formula (III-1).

[0041]

[0042] Among them, R 1R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 As defined in any embodiment of the present invention.

[0043] In some implementations, the structure shown in formula (III-1) is selected from...

[0044]

[0045] In some embodiments, the deuterium content at each position denoted as D in the nucleotides or pharmaceutically acceptable salts thereof described in the first aspect of the invention, the nucleosides or pharmaceutically acceptable salts thereof described in the second aspect, and the polynucleotides encoding the target polypeptides and / or proteins described in the third aspect, is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99%. In some embodiments, the deuterium content at each position denoted as D is at least 95%. In some embodiments, the deuterium content at each position denoted as D is at least 98%.

[0046] In some embodiments, the uracil nucleotides in the polynucleotide encoding the target polypeptide and / or protein are all or partly replaced by the structure shown in formula (III) or formula (III-1).

[0047] In some embodiments, the polynucleotide encoding the target polypeptide and / or protein comprises (or is) a sequence of n linked nucleotides selected from guanosine monophosphate, adenosine monophosphate, cytidine monophosphate, and the nucleotides described in the first aspect of the invention or their pharmaceutically acceptable salts. Those skilled in the art will understand that the nucleotides are linked by bonds, for example, by phosphodiester bonds.

[0048] Nucleic acid molecules

[0049] A fourth aspect of the present invention provides a nucleic acid molecule comprising the polynucleotides encoding target polypeptides and / or proteins as described in the third aspect of the present invention.

[0050] In some embodiments, the nucleic acid molecule further comprises one or more of a 5' cap structure, a 5' untranslated region (5'UTR), a 3' untranslated region (3'UTR), and a 3' poly-A tail.

[0051] In some embodiments, the nucleic acid molecule comprises, from the 5' end to the 3' end, the following in sequence: a 5' cap structure, a 5' UTR, a polynucleotide encoding the target polypeptide and / or protein, and a 3' UTR.

[0052] In some embodiments, the 5' cap structure is selected from Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-denitro-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0053] In some embodiments, the nucleic acid molecule is selected from small interfering RNA (siRNA), messenger RNA (mRNA), short hairpin RNA (shRNA), antisense oligonucleotides, and RNA aptamers.

[0054] In some implementations, the nucleic acid molecule is mRNA.

[0055] In some implementations, the nucleic acid molecules are isolated.

[0056] In some implementations, the nucleic acid molecules are purified.

[0057] carrier

[0058] A fifth aspect of the present invention provides a carrier comprising the nucleic acid molecule described in the fourth aspect of the present invention.

[0059] In some implementations, the vector is selected from plasmids, bacteriophages, and viral vectors.

[0060] Delivery composition

[0061] A sixth aspect of the present invention provides a delivery composition comprising a delivery vector and one or more of the following: a polynucleotide encoding a target polypeptide and / or protein as described in the third aspect of the present invention, a nucleic acid molecule as described in the fourth aspect of the present invention, and a vector as described in the fifth aspect of the present invention.

[0062] In some embodiments, the delivery vector is selected from lipid particles, sugar particles, metal particles, protein particles, liposomes, exosomes, microvesicles, gene guns, and viral vectors (e.g., replication-defective retroviruses, lentiviruses, adenoviruses, or adeno-associated viruses).

[0063] In some embodiments, the delivery carrier is a lipid nanoparticle.

[0064] In some embodiments, the nanolipid particles comprise one or more of cationic lipids, polyethylene glycol-modified lipids, neutral lipids, and steroids or steroid analogs.

[0065] In some embodiments, the nanolipid particles comprise an ionizable cationic lipid SM-102, an auxiliary lipid DSPC, cholesterol, and a PEG-2000-DMG lipid.

[0066] Pharmaceutical Composition

[0067] A seventh aspect of the present invention provides a pharmaceutical composition comprising a polynucleotide encoding a target polypeptide and / or protein as described in the third aspect of the present invention, a nucleic acid molecule as described in the fourth aspect of the present invention, a carrier as described in the fifth aspect of the present invention and / or a delivery composition as described in the sixth aspect of the present invention, and one or more pharmaceutically acceptable carriers and / or excipients.

[0068] In some embodiments, the pharmaceutical composition further comprises additional pharmaceutically active agents.

[0069] In some embodiments, the additional pharmaceutically active agent is provided as a separate component or as a mixed component with the polynucleotide, nucleic acid molecule, carrier, and / or delivery composition encoding the target polypeptide and / or protein.

[0070] The pharmaceutical compositions of the present invention can be formulated into any dosage form known in the medical field, such as tablets, pills, suspensions, emulsions, solutions, gels, capsules, powders, granules, elixirs, lozenges, suppositories, injections (including injection solutions, sterile powders for injection, and concentrated solutions for injection), inhalers, sprays, etc. Preferred dosage forms depend on the intended route of administration and therapeutic use. The pharmaceutical compositions of the present invention should be sterile and stable under the conditions of production and storage. A preferred dosage form is an injection. Such injections can be sterile injectable solutions. For example, sterile injectable solutions can be prepared by incorporating the required dose of the pharmaceutical composition of the present invention into a suitable solvent, and optionally, simultaneously incorporating other desired components (including, but not limited to, pH adjusters, surfactants, adjuvants, ionic strength enhancers, isotonic agents, preservatives, diluents, or any combination thereof), followed by sterile filtration. Furthermore, sterile injectable solutions can be prepared as sterile lyophilized powders (e.g., by vacuum drying or freeze-drying) for easy storage and use. Such sterile lyophilized powders can be dispersed in a suitable carrier, such as sterile pyrogen-free water, before use.

[0071] Furthermore, the polynucleotides, nucleic acid molecules, carriers, or delivery compositions encoding target polypeptides and / or proteins of the present invention can be present in the pharmaceutical composition in unit dose form for ease of administration.

[0072] The pharmaceutical compositions of the present invention can be administered by any suitable method known in the art, including but not limited to oral, oral, sublingual, ocular, topical, parenteral, rectal, intrathecal, intracytoplasmic reticulum groove, groin, bladder, topical (e.g., powder, ointment, or drops), or nasal routes. However, for many therapeutic uses, the preferred route / method of administration is parenteral administration (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular, intratumoral). Those skilled in the art will understand that the route and / or method of administration will vary depending on the intended purpose. In some preferred embodiments, the pharmaceutical compositions of the present invention are administered by intravenous infusion or injection.

[0073] The pharmaceutical compositions of the present invention may include a therapeutically effective amount or a preventatively effective amount of a polynucleotide, nucleic acid molecule, carrier, or delivery composition encoding a target polypeptide and / or protein. The effective amount of the polynucleotide, nucleic acid molecule, carrier, or delivery composition encoding the target polypeptide and / or protein may vary depending on factors such as the severity of the disease to be treated, the overall state of the patient's own immune system, the patient's general characteristics such as age, weight, and sex, the method of drug administration, and other concurrent treatments, etc.

[0074] In this invention, the dosing regimen can be adjusted to obtain the optimal target response (e.g., treatment or prevention). For example, it can be administered as a single dose, multiple times over a period of time, or the dose can be reduced or increased proportionally according to the urgency of the treatment situation.

[0075] Reagent test kit

[0076] An eighth aspect of the present invention provides a kit comprising the nucleotides described in the first aspect of the present invention or pharmaceutically acceptable salts thereof.

[0077] In some embodiments, the kit further comprises adenosine triphosphate (ATP), guanosine triphosphate (GTP), and cytidine triphosphate (CTP).

[0078] use

[0079] The ninth aspect of the present invention provides the use of the nucleosides or pharmaceutically acceptable salts thereof described in the second aspect of the present invention in the preparation of the nucleotides or pharmaceutically acceptable salts thereof described in the first aspect of the present invention.

[0080] The tenth aspect of the present invention provides the use of the nucleotides or pharmaceutically acceptable salts thereof described in the first aspect of the invention, or the nucleosides or pharmaceutically acceptable salts thereof described in the second aspect of the invention, or the kits described in the eighth aspect of the invention in the preparation of polynucleotides encoding target polypeptides and / or proteins described in the third aspect of the invention, nucleic acid molecules described in the fourth aspect of the invention, carriers described in the fifth aspect of the invention, delivery compositions described in the sixth aspect of the invention, or pharmaceutical compositions described in the seventh aspect of the invention.

[0081] The eleventh aspect of the present invention provides the use of the polynucleotide encoding the target polypeptide and / or protein described in the third aspect of the present invention, the nucleic acid molecule described in the fourth aspect of the present invention, the carrier described in the fifth aspect of the present invention, the delivery composition described in the sixth aspect of the present invention, or the pharmaceutical composition described in the seventh aspect of the present invention in the preparation of a medicament for treating and / or preventing a disease or condition or reducing the severity of said disease or condition.

[0082] The twelfth aspect of the present invention provides a polynucleotide encoding a target polypeptide and / or protein as described in the third aspect of the present invention, a nucleic acid molecule as described in the fourth aspect of the present invention, a carrier as described in the fifth aspect of the present invention, a delivery composition as described in the sixth aspect of the present invention, or a pharmaceutical composition as described in the seventh aspect of the present invention, for treating and / or preventing a disease or condition or reducing the severity of said disease or condition.

[0083] The thirteenth aspect of the present invention provides a method for treating and / or preventing a disease or symptom or reducing the severity of said disease or symptom, comprising administering to an individual an effective amount of a polynucleotide encoding a target polypeptide and / or protein as described in the third aspect of the present invention, a nucleic acid molecule as described in the fourth aspect of the present invention, a carrier as described in the fifth aspect of the present invention, a delivery composition as described in the sixth aspect of the present invention, or a pharmaceutical composition as described in the seventh aspect of the present invention.

[0084] In some embodiments, the individual is administered a single dose, two doses, three doses or more of the polynucleotide, nucleic acid molecule, carrier, delivery composition or pharmaceutical composition, and, as appropriate, additional doses of the polynucleotide, nucleic acid molecule, carrier, delivery composition or pharmaceutical composition.

[0085] In some implementations, the individual is a mammal, such as a human.

[0086] Terminology Definition

[0087] In this application, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, to better understand this application, definitions and explanations of relevant terms are provided below.

[0088] Unless otherwise specified herein or clearly contradicted by the context, the terms “an” and “a kind” as well as “the” and similar designations shall be interpreted to cover both the singular and the plural in the context of describing the invention (especially in the context of the following claims).

[0089] As used in this application, the term "and / or" should be considered as a specific disclosure of each of two or more specified features or elements, and any combination of two or more features or elements. Therefore, the term "and / or" as used in phrases, such as "A and / or B," is intended to include "A and B," "A or B," "A" (alone), and "B" (alone).

[0090] Unless otherwise stated, when a position is designated as “H” or “hydrogen”, or its chemical properties imply hydrogen, it should be understood as hydrogen with a naturally occurring abundance isotopic composition.

[0091] Unless otherwise specified, when a position is designated as "D" or "deuterium," it indicates that the deuterium content (doping, abundance, or enrichment) is at least 50%. In some embodiments, the deuterium content (doping, abundance, or enrichment) is at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%. The deuterium content can be determined by techniques known in the art (such as... 1 Measurement by 1H NMR spectroscopy.

[0092] As used in this application, the term "deuterated" refers to the substitution of one or more hydrogen atoms in a compound or group by deuterium.

[0093] As used herein, the term "pharmaceutically acceptable salt" refers to a salt of the compounds of the present invention that is pharmaceutically acceptable and has the desired pharmacological activity of the parent compound. Such salts include: salts formed by addition to inorganic acids or acids formed with organic acids, or salts in which acidic protons present on the parent compound are replaced by metal ions, or coordination compounds formed with organic bases.

[0094] Pharmaceutically acceptable salts of the compounds of this invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts are salts formed by amino groups with inorganic acids (e.g., hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid) or with organic acids (e.g., acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid), or salts formed by other methods used in the art (e.g., ion exchange). Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, hydrogen sulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, disglucuronate, dodecyl sulfate, ethanesulfonate, formate, transbutenedioate, glucono-heptahydrate, glyceryl phosphate, gluconate, hemisulfate, heptahydrate, hexanoate, hydroiodide, 2-hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, dihydroxynaphthalate, pectate, persulfate, 3-phenylpropionate, phosphate, p-pentanoate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate and similar salts.

[0095] Salts derived from suitable bases include alkali metals, alkaline earth metals, ammonium, and nitrogen. + (C 1-4 Alkyl)4 salts. Representative alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and similar salts. Where appropriate, other pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations formed using the relative ions of halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkyl sulfonates, and aryl sulfonates.

[0096] Pharmaceutically acceptable salts are also intended to include hemisalts, wherein the ratio of compound to acid is 2:1. Exemplary hemisalts are those derived from acids containing two carboxylic acid groups, such as malic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, glutaric acid, oxalic acid, adipic acid, and citric acid. Other exemplary hemisalts are those derived from diprotic mineral acids (e.g., sulfuric acid). Preferred exemplary hemisalts include (but are not limited to) hemi-maleic acid salts, hemi-fumaric acid salts, and hemi-succinic acid salts.

[0097] As used herein, the term "nucleic acid" refers to a polymer comprising nucleotide monomers or composed of nucleotide monomers covalently linked to each other by phosphodiester bonds. Nucleic acid may also encompass modified nucleic acid molecules, such as DNA or RNA molecules with base modifications, sugar modifications, or backbone modifications, such as deuteration modifications. Nucleic acids can exist in various forms, such as: isolated segments incorporated into a sequence and recombinant vectors or recombinant polynucleotides encoding polypeptides (such as one or both strands of an antigen or antibody, or fragments, derivatives, mutant proteins, or variants thereof); polynucleotides sufficient to serve as hybridization probes; PCR primers; or sequencing primers for identifying, analyzing, mutating, or amplifying polynucleotides encoding polypeptides.

[0098] As used herein, the term "polynucleotide" refers to a nucleic acid molecule that may be recombinant or isolated from the total genomic nucleic acid. In some embodiments, a polynucleotide includes a regulatory sequence substantially isolated from its naturally occurring gene or protein-coding sequence. Polynucleotides may be single-stranded (coding or antisense) or double-stranded and may be RNA, DNA (genomic, cDNA, or synthetic), analogs thereof, or combinations thereof. Additional coding or non-coding sequences may (but not necessarily) be present within the polynucleotide.

[0099] As used herein, the term "RNA" refers to a nucleic acid molecule containing nucleotides such as adenosine monophosphate, uridine monophosphate, guanosine monophosphate, cytidine monophosphate, and modified uridine monophosphate monomers, which are linked together along a so-called backbone. The backbone is formed by phosphodiester bonds between the sugar (e.g., ribose) of the first monomer and the phosphate moiety of the second adjacent monomer. RNA can be obtained, for example, within a cell by transcription of a DNA sequence. In eukaryotic cells, transcription typically takes place in the nucleus or mitochondria. In vivo, transcription of DNA can produce immature RNA, which is processed into messenger RNA (mRNA). Processing of immature RNA in eukaryotes, for example, involves various post-transcriptional modifications such as splicing, 5' capping, polyadenylation, and export from the nucleus or mitochondria. Mature mRNA is a nucleotide sequence that processes the messenger RNA and provides an amino acid sequence that can be translated into a peptide or protein. Mature mRNA may contain a 5' cap, a 5' UTR, an open reading frame, a 3' UTR, and a polyadenylated tail sequence. RNA may contain all or most of the ribonucleotide residues. In one embodiment, the RNA may be messenger RNA (mRNA) associated with an RNA transcript encoding a peptide or protein. As known to those skilled in the art, mRNA generally contains a 5′ untranslated region (5′UTR), a polypeptide-coding region, and a 3′ untranslated region (3′UTR). Without any limitations, RNA may encompass double-stranded RNA, antisense RNA, single-stranded RNA, isolated RNA, synthetic RNA, recombinant RNA, and modified RNA.

[0100] As used herein, the terms "protein" and "polypeptide" are used synonymously and refer to polymers of amino acid monomers, such as molecules containing at least two amino acid residues. Polypeptides may include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, heterohomologs, homohomologs, fragments, and other equivalents, variants, and analogs thereof. Polypeptides may be single molecules or multi-molecule complexes, such as dimers, trimers, or tetramers. Proteins comprise one or more peptides or polypeptides and can fold into a three-dimensional form that may be necessary for the protein to perform its biological function.

[0101] As used herein, the term "pharmaceutically acceptable carrier and / or excipient" means a carrier and / or excipient that is pharmacologically and / or physiologically compatible with the subject and the active ingredient, and is well known in the art (see, for example, Remington's Pharmaceutical Sciences. Edited by Gennaro AR, 19th ed. Pennsylvania: Mack Publishing Company, 1995). Pharmaceutical carriers and / or excipients include, but are not limited to: pH adjusters, surfactants, ionic strength enhancers, diluents, agents for maintaining osmotic pressure, agents for delaying absorption, preservatives, and stabilizers. For example, pH adjusters include, but are not limited to, phosphate buffers. Surfactants include, but are not limited to, cationic, anionic, or nonionic surfactants, such as Tween-80. Ionic strength enhancers include, but are not limited to, sodium chloride. Preservatives include, but are not limited to, various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, etc. Agents for maintaining osmotic pressure include, but are not limited to, sugars, NaCl, and their analogues. Agents for delaying absorption include, but are not limited to, monostearates and gelatin. Diluents include, but are not limited to, water, aqueous buffers (such as buffered saline), alcohols, and polyols (such as glycerol). Preservatives include, but are not limited to, various antibacterial and antifungal agents, such as thimerosal, 2-phenoxyethanol, parabens, chlorobutanol, phenol, sorbic acid, etc. Stabilizers have the meaning commonly understood by those skilled in the art for stabilizing the desired activity of the active ingredient in a pharmaceutical product, including, but not limited to, monosodium glutamate, gelatin, SPGA, sugars (such as sorbitol, mannitol, starch, sucrose, lactose, dextran, or glucose), amino acids (such as glutamic acid, glycine), proteins (such as dried whey, albumin, or casein) or their degradation products (such as lactalbumin hydrolysate), etc.

[0102] As used herein, the term "effective amount" means an amount sufficient to achieve, or at least partially achieve, the desired effect. For example, an effective amount for disease prevention means an amount sufficient to prevent, stop, or delay the onset of a disease; an effective amount for disease treatment means an amount sufficient to cure or at least partially stop the disease and its complications in a patient already suffering from the disease. Determining such an effective amount is entirely within the capabilities of those skilled in the art. For example, an effective amount for therapeutic purposes will depend on the severity of the disease to be treated, the overall state of the patient's own immune system, the patient's general characteristics such as age, weight, and sex, the method of administration of the drug, and other concurrent treatments, etc.

[0103] As used in this application, the term "treatment" aims to alleviate, reduce, improve, or eliminate a targeted disease state or symptom. A subject is successfully "treated" if one or more indicators and symptoms of a subject show an observable and / or detectable reduction or improvement. It should also be understood that treatment of a disease state or symptom includes not only complete treatment but also the achievement of some biological or medically relevant outcome without achieving complete treatment.

[0104] As used in this application, the term "prevention" aims to avoid, reduce, prevent, or delay the onset of a disease or disease-related symptoms before the onset of the relevant drug. "Prevention" does not necessarily require the complete prevention of the onset of a disease or disease-related symptoms. For example, reducing the risk of a subject developing a specific disease or disease-related symptoms after the administration of the relevant drug, or lessening the severity of subsequently occurring related symptoms, can be considered as "prevention" of the onset or development of the disease.

[0105] Beneficial effects

[0106] The deuterated nucleotides provided by this invention can increase the level of proteins expressed by mRNA, reduce innate immune activation, and increase translational fidelity, making the optimized mRNA molecules have broad application prospects in the fields of vaccines, gene therapy, and antibody therapy. Attached Figure Description

[0107] Figure 1 Electrophoresis diagram of chemically modified mRNA (1).

[0108] Figure 2 . Results of toxicity testing of chemically modified mRNA in cells.

[0109] Figure 3 Parameter detection results of chemically modified mRNA lipid nanoparticles.

[0110] Figure 4 The expression results of chemically modified mRNA in mice.

[0111] Figure 5 The level of innate immune response to chemically modified mRNA in mice.

[0112] Figure 6 Electrophoresis diagram of chemically modified mRNA (2).

[0113] Figure 7 Results of frameshift detection for chemically modified mRNA translation.

[0114] In the attached figures, * indicates p < 0.05; ** indicates p < 0.01; and *** indicates p < 0.001.

[0115] Sequence information

[0116] Information on some of the sequences involved in this application is shown in Table 1 below.

[0117] Table 1. Information on partial sequences

[0118]

[0119]

[0120]

[0121]

[0122] Detailed Implementation

[0123] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0124] Example 1: Preparation of ((2R,3S,4R,5R)-3,4-dihydroxy-5-(5-methoxy-2,4,-dioxo-3,4-dihydropyrimidin-1(2H)-yl-6-d)tetrahydrofuran-2-yl)methyltetrahydrotriphosphate (2583U)

[0125]

[0126] Step 1) 5-Methoxypyrimidine-2,4(1H,3H)-dione-6-d

[0127] Under ice bath conditions, metallic sodium (138 mg, 6.0 mmol) was added in portions to heavy water (2.0 mL), and the mixture was stirred for 30 minutes. Then, 5-methoxyuracil (265 mg, 1.87 mmol) was added, the system was purged with argon, and the mixture was heated to 125 °C for 16 hours in a sealed tube. After the reaction solution cooled to room temperature, it was acidified with 1.0 N hydrochloric acid, filtered, and the filter cake was collected and dried to give the title product: 240 mg of white solid, yield: 90%. LC-MS (ESI): m / z = 166.1 [M + Na] + ].

[0128] Step 2) (2R,3S,4R,5R)-2-((benzoyloxy)methyl)-5-(5-methoxy-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl-6-d)tetrahydrofuran-3,4-dibenzoate

[0129] To a solution of 240 mg (1.68 mmol) of 5-methoxypyrimidine-2,4(1H,3H)-dione-6-d in anhydrous acetonitrile (20 mL), N,O-bis(trimethylsilylacetamide) (BSA) (1.25 mL, 5.04 mmol) was added under argon protection. The resulting mixture was heated under reflux for 1 hour. After cooling to room temperature, 1-acetyl-trisyloxy-roporose (1.1 g, 2.18 mmol) and trimethylsilyltrifluoromethanesulfonate (0.40 mL, 2.18 mol) were added. The resulting reaction solution was heated under reflux for 2 hours. After cooling to room temperature, the mixture was evaporated to dryness under reduced pressure. The residue was purified by column chromatography (petroleum ether:ethyl acetate = 1:1) to give the title product, 600 mg of white solid, yield: 61%. LC-MS (ESI): m / z = 588.1 [M+H] + ].

[0130] Step 3) 1-((2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)-5-methoxypyrimidine-2,4(1H,3H)-dione-6-d

[0131] (2R,3S,4R,5R)-2-((benzoyloxy)methyl)-5-(5-methoxy-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl-6-d)tetrahydrofuran-3,4-dibenzoate (370 mg, 0.63 mmol) was added to 7N ammonia-methanol solution (6 mL), and the mixture was heated to 45 °C for 24 hours. The mixture was evaporated to dryness under reduced pressure, and the residue was purified by successively beating with ethyl acetate and acetonitrile to give the title product, 145 mg of white solid, yield: 83%. LC-MS (ESI): m / z = 276.0 [M+H] + ]. 1H-NMR (500MHz, CD3OD) δ5.98-5.95(m,1H),4.24-4.21(m,2H),4.06-4.03(m,1H),3.93-3.89(m,1H),3.81-3.77(m,1H),3.72(s,3H).

[0132] Step 4)((2R,3S,4R,5R)-3,4-dihydroxy-5-(5-methoxy-2,4,-dioxo-3,4-dihydropyrimidin-1(2H)-yl-6-d)tetrahydrofuran-2-yl)methyltetrahydrotriphosphate (2583U)

[0133] Under argon protection and at 0°C, phosphorus oxychloride (25 μL, 0.273 mmol) was added dropwise to a solution of 1-((2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)-5-methoxypyrimidine-2,4(1H,3H)-dione-6-d (50 mg, 0.182 mmol) in 2 mL of trimethyl phosphate, and the mixture was stirred for half an hour. Then, another 25 μL of phosphorus oxychloride (0.273 mmol) was added and the mixture was stirred for 1 hour. Finally, acetonitrile (2 mL) solvent containing pyrophosphate (96 mg, 0.545 mmol) and tripropylamine (0.4 mL, 2.182 mmol) was added, and the mixture was stirred at room temperature for 2 hours. Dilute with water to 30 mL, purify using a 650Q ion column (elution buffer: 1M triethylammonium bicarbonate buffer), collect the product tube, concentrate, and then purify three more times using a reverse column. The resulting product is then purified again using a 650Q ion column (elution buffer: 1M triethylammonium bicarbonate buffer) to obtain 60 mg of the triethylamine salt of the title product, yield: 32%. Deuteration rate: 98%. 1 H NMR (500MHz, D2O) δ6.07(s,1H),4.47(s,2H),4.32-4.28(m,2H),4.24-4.22(m,1H),3.83(s,3H). 31 P NMR (202MHz, D2O) δ -10.80 (d, J = 19.6Hz, 1P), -11.74 (d, J = 19.9Hz, 1P), -22.30 (t, J = 19.3Hz, 1P).

[0134] Example 2: Preparation of ((2R,3S,4R,5R)-3,4-dihydroxy-5-(5-methoxy-2,4,-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-2-yl)methyl-d2tetrahydrotriphosphate (2586U)

[0135]

[0136] Step 1) 1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetrahydrofurano[3,4-d][1,3]dioxane-4-yl)-5-methoxypyrimidine-2,4(1H,3H)-dione

[0137] To a solution of 5-methoxyuridine (2.4 g, 8.75 mmol) in acetone (35 mL), p-toluenesulfonic acid monohydrate (1.58 g, 8.31 mmol) and 2,2-dimethoxypropane (5.3 mL, 43.7 mmol) were added. The resulting mixture was stirred at room temperature for 2 hours. Sodium bicarbonate (768 mg, 9.14 mmol) was added, and the mixture was stirred for 10 minutes. The solution was then evaporated to dryness and purified by column chromatography (dichloromethane:methanol = 50:1 to 25:1) to give the title product, 2.52 g solid, yield: 92%. L-MS (ESI): m / z = 314.9 [M+H] + .

[0138] Step 2)(3aS,4S,6R,6aR)-6-(5-methoxy-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,2-dimethyltetrahydrofurano[3,4-d][1,3]dioxane-4-carboxylic acid tert-butyl ester

[0139] To a solution of 1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetrahydrofurano[3,4-d][1,3]dioxan-4-yl)-5-methoxypyrimidine-2,4(1H,3H)-dione (2.33 g, 7.41 mmol) in dichloromethane (50 mL) and tert-butanol (14 mL), PDC (4.4 g, 14.8 mmol) and acetic anhydride (6.95 mL, 74.1 mmol) were added. The resulting mixture was stirred at room temperature for 2.5 h. The solution was evaporated to dryness and purified by column chromatography (petroleum ether:ethyl acetate = 2:1 to 1:1) to give the title product, 1.8 g solid, yield: 63%. LC-MS (ESI): m / z = 384.9 [M+H] + .

[0140] Step 3) 1-((3aR,4R,6R,6aR)-6-(hydroxymethyl-d2)-2,2-dimethyltetrahydrofurano[3,4-d][1,3]dioxane-4-yl)-5-methoxypyrimidine-2,4(1H,3H)-dione

[0141] Under ice bath conditions, sodium borodeide (304 mg, 7.26 mmol) was added in portions to a solution of (3aS,4S,6R,6aR)-6-(5-methoxy-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,2-dimethyltetrahydrofuran[3,4-d][1,3]dioxane-4-carboxylic acid tert-butyl ester (930 mg, 2.42 mmol) in tetrahydrofuran (10 mL), deuterated methanol (2 mL), and heavy water (1 mL). After the addition was complete, the reaction was brought to 50 °C and carried out for 4 hours. The pH was adjusted to approximately 7 with deuterated acetic acid, water was added, and the mixture was extracted with ethyl acetate. The combined organic layers were washed with saturated brine, dried over anhydrous sodium sulfate, and evaporated to dryness. The residue was purified by column chromatography (petroleum ether:ethyl acetate = 1:1 to 0:1) to give the title product, 420 mg, white solid, yield: 55%. LC-MS (ESI): m / z = 317.0 [M+H] + .

[0142] Step 4) 1-((2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl-d2)tetrahydrofuran-2-yl)-5-methoxypyrimidine-2,4(1H,3H)-dione

[0143] 1-((3aR,4R,6R,6aR)-6-(hydroxymethyl-d2)-2,2-dimethyltetrahydrofurano[3,4-d][1,3]dioxane-4-yl)-5-methoxypyrimidine-2,4(1H,3H)-dione (420 mg, 1.33 mmol) was dissolved in trifluoroacetic acid (3 mL) and water (3 mL) and reacted at room temperature for 2 hours. The solution was evaporated to dryness, dissolved in ethanol, evaporated to dryness again, and then slurried with ethyl acetate to give the title product, 349 mg of white solid, yield: 95%. LC-MS (ESI): m / z = 276.9 [M+H] + .

[0144] Step 5)((2R,3S,4R,5R)-3,4-dihydroxy-5-(5-methoxy-2,4,-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-2-yl)methyl-d2tetrahydrotriphosphate (2586U)

[0145] Referring to Example 1, 1-((2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl-d2)tetrahydrofuran-2-yl)-5-methoxypyrimidine-2,4(1H,3H)-dione was substituted for 1-((2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)-5-methoxypyrimidine-2,4(1H,3H)-dione-6-d to obtain 40 mg of the triethylamine salt of the title product, yield: 27%. Deuteration rate: 98.5%. MS (ESI): m / z = 515.0 [MH]- . 1 H NMR (500MHz, D2O) δ7.41 (s, 1H), 6.08 (d, J = 5.5Hz, 1H), 4.51-4.48 (m, 2H), 4.34 (s, 1H), 3.85 (s, 3H). 31 P NMR (202MHz, D2O) δ -10.21 (d, J = 19.1Hz, 1P), -11.67 (d, J = 20.0Hz, 1P), -23.18 (t, J = 19.9Hz, 1P).

[0146] Example 3: In vitro transcription (IVT)

[0147] Linearized templates for IVT were prepared using PCR with Novizan 2×Phanta Flash MasterMix. PCR reactions were performed according to the following conditions: 98°C for 5 seconds, followed by 25 cycles of 98°C for 10 seconds, 58°C for 5 seconds, 72°C for 10 seconds, 72°C for 1 minute, and finally terminated at 4°C.

[0148] Table 2 PCR reaction system (50 μL)

[0149]

[0150] PCR amplification was performed using EGFP (SEQ ID NO:1) and Flu (Firefly Luciferase) (SEQ ID NO:2) as plasmid templates, respectively. The primer sequences for the plasmid template amplification were as follows:

[0151] HBB-F: CGTTGTAAAACGACGGCCAGAGAATTC (SEQ ID NO: 5);

[0152] HBB-R:

[0153] TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCAATGAAAATAAATGTTTTTTATTAGG (SEQ ID NO: 6).

[0154] IVT templates (SEQ ID NO:1 and SEQ ID NO:2) in PCR products were recovered using the Promega (Catalog No.: A9282) kit.

[0155] mRNA is transcribed using natural nucleotides and modified nucleotides, and the IVT system is configured according to the following system:

[0156] Table 3. IVT reaction system (20 μL)

[0157]

[0158]

[0159] In this study, the NTPs in the control group consisted of natural nucleotides ATP, GTP, CTP, and UTP; the NTPs in experimental group 1 consisted of natural nucleotides ATP, GTP, CTP, and 2583U of modified nucleotides; and the NTPs in experimental group 2 consisted of natural nucleotides ATP, GTP, CTP, and 2586U of modified nucleotides. IVT reactions were performed using EGFP (SEQ ID NO:1) and Flux (SEQ ID NO:2) as templates, respectively, as detailed below.

[0160] After adding the template, the mixture was incubated at 37°C for 2 hours. For each reaction, 1 μL of DNase I was added and incubated at 37°C for 30 minutes to digest the DNA template. RNA was then precipitated using LiCl at -80°C. The precipitated mRNA was collected by centrifugation and centrifuged at 14,000 rpm for 10 minutes at 4°C until a white RNA precipitate appeared at the bottom of the centrifuge tube. The supernatant was discarded, and 1 mL of pre-chilled 70% ethanol was added. The RNA was washed by vortexing, and the washing was repeated once. The precipitate was dried at room temperature until it became translucent. RNase-free water was added to fully dissolve the RNA, and the mRNA concentration was determined using NanoDrop One. The mRNA quality was assessed by 1% TBE agarose gel electrophoresis. Results are as follows: Figure 1 As shown, high-quality EGFP (SEQ ID NO:1) and Fluc (SEQ ID NO:2) mRNA products were prepared by replacing natural UTP with modified nucleotides 2583U and 2586U, respectively.

[0161] Example 4: Detection of the toxicity of chemically modified mRNA in cells

[0162] The toxicity of chemically modified mRNA was detected in A549 cells. DMEM medium containing 10% fetal bovine serum and 1% penicillin was used, at a concentration of 0.3 × 10⁻⁶ mRNA. 6100 μL of lipo8000 mRNA was seeded into each well of a 96-well plate at a concentration of 1.6:1. After culturing for 12 hours, A549 cell lines were transfected with lipo8000 and mRNA at a concentration of 1 μg / mL using opti-MEM. The mRNA was EGFP mRNA prepared in Example 3. Control cells were set up without any treatment, cells with only 0.16 μL / well of lipo8000, and cells transfected with lipo8000 and poly(I:C) at a concentration of 1 μg / mL using a 1.6:1 ratio. The transfected cells were cultured at 37°C for 48 hours and analyzed using a Cell Counting Kit-8 microplate reader. The results are as follows: Figure 2 As shown, the chemically modified mRNA is non-toxic to A549 cells.

[0163] Example 5: Expression of chemically modified mRNA in mice

[0164] SM102, DSPC, cholesterol, and DMG-PEG2000 were mixed in ethanol at a molar ratio of 50:10:38.5:1.5. Then, using a microfluidic mixer, this lipid mixture was mixed with Fluc mRNA (dissolved in 50 mM sodium acetate, pH 4.0) prepared in Example 3 at a volume ratio of 1:3. The total flow rate for mixing was set to 12 mL / min, and the flow rate ratio was 1:3. The mixture was dialyzed with PBS for 4 h to remove acetic acid and ethanol from the mRNA-LNP. The PBS was replaced after 2 h of dialyzing, and the mixture was dialyzed until neutral to obtain Fluc-mRNA-LNP. The particle size and distribution of Fluc-mRNA-LNP were detected using a Malvern nanoparticle size analyzer, and the encapsulation efficiency of the mRNA was detected using the Ribogreen method (ThermoFisher). The results are as follows: Figure 3 As shown, the encapsulated vaccine has an average particle size of 60-80 nm, uniform particle size distribution (PDI<0.1), and an encapsulation rate of over 90%, indicating good quality.

[0165] Six-week-old female BALB / c mice were randomly divided into groups of five. Each mouse received an intramuscular injection of 5 μg of Fluc-mRNA-LNP, followed by an intraperitoneal injection of 100 μL of luciferase (Perkin Elmer) substrate six hours later. In vivo imaging was performed using an AniView100Pro multimodal animal in vivo imaging system. Results are as follows: Figure 4 As shown, in BALB / c mice, the expression level of Fluc mRNA modified with nucleotide 2586U did not change significantly compared with UTP, while the expression level of Fluc mRNA modified with nucleotide 2583U was significantly reduced.

[0166] Example 6: Innate Immune Response of Chemically Modified mRNA in Mice

[0167] Six-week-old female BALB / c mice were randomly divided into groups of five. Each mouse received an intramuscular injection of Fluc-mRNA-LNP prepared in Example 5 at a dose of 5 μg / mouse. A negative control group received an intramuscular injection of PBS at a dose of 100 μL / mouse, and a positive control group received an intramuscular injection of poly(I:C) at a dose of 5 μg / mouse. Spleens were collected six hours later, and RNA was extracted using RNAiso Plus. Reverse transcription was performed using HyperScript III RT SuperMix for qPCR with gDNA Remover, 2x S6 UniversalSYBR qPCR Mix, and QuantStudio. TM 7. Flex was used to quantify the mRNA level of IFNb. Results are as follows: Figure 5 As shown, in BALB / c mice, compared with UTP, the level of IFNb mRNA stimulated by Fluc mRNA modified with nucleotide 2586U was significantly reduced, while the level of IFNb mRNA stimulated by Fluc mRNA modified with nucleotide 2583U was not significantly different.

[0168]

[0169] Example 7: Detection of frameshift rate in chemically modified mRNA translation

[0170] To investigate the effect of modified nucleotides on translational fidelity, a CTP was inserted after nucleotides 681-684 (TTTT) of Fluc-WT-2 (SEQ ID NO:3) to obtain the reporter gene Fluc-ISF-2 (SEQ ID NO:4) for detecting translation frameshifts. Fluc-ISF-2 can only express functional Fluc when the ribosome undergoes a frameshift across four consecutive UTPs; the expression ratio of Fluc-ISF-2 to Fluc-WT-2 represents the frequency of frameshifts. Using amplification primer sequences (SEQ ID NO:11) and (SEQ ID NO:12), Fluc-WT-2 and Fluc-ISF-2 mRNAs were prepared according to the method in Example 3, and the results are as follows: Figure 6 As shown.

[0171] HBB-F': GAATTCGCCGTAATACGACTCAC (SEQ ID NO: 11);

[0172] HBB-R': TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTCTTTTTTTTTTTTTTTTTTTTTTTTCTCGAGAGCGTAATCTGGAAC (SEQ ID NO: 12).

[0173] Chemically modified Fluc-WT-2 and Fluc-ISF-2 mRNA were transfected into HeLa cells using a lipo8000 transfectant. After culturing for 24 hours, the expression of Fluc-WT-2 and Fluc-ISF-2 mRNA was quantified using a firefly luciferase reporter gene assay kit (Yisheng Biotechnology) and a Perkin Elmer multi-functional microplate reader. The results are as follows: Figure 7 As shown, in HeLa cells, the frameshift rate of mRNA prepared by modifying nucleotide 2586U was significantly lower than that of mRNA prepared by modifying nucleotide 2583U.

[0174] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them; although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications can still be made to the specific implementation of the present invention or equivalent substitutions can be made to some technical features without departing from the spirit of the technical solutions of the present invention, and all such modifications and substitutions should be covered within the scope of the technical solutions claimed in the present invention.

Claims

1. Nucleotides or pharmaceutically acceptable salts thereof, wherein, The nucleotide is 。 2. The nucleotide of claim 1 or a pharmaceutically acceptable salt thereof, wherein, The deuterium content at each position, denoted as D, is at least 70%.

3. The nucleotide of claim 1 or a pharmaceutically acceptable salt thereof, wherein, The deuterium content at each position, denoted as D, is at least 95%.

4. The nucleotide of claim 1 or a pharmaceutically acceptable salt thereof, wherein, The deuterium content at each position, denoted as D, is at least 98%.

5. Nucleosides or their pharmaceutically acceptable salts, wherein, The nucleoside is 。 6. The nucleoside of claim 5 or a pharmaceutically acceptable salt thereof, wherein, The deuterium content at each position, denoted as D, is at least 70%.

7. The nucleoside of claim 5 or a pharmaceutically acceptable salt thereof, wherein, The deuterium content at each position, denoted as D, is at least 95%.

8. The nucleoside or a pharmaceutically acceptable salt thereof as described in claim 5, wherein, The deuterium content at each position, denoted as D, is at least 98%.

9. Use of the nucleoside or a pharmaceutically acceptable salt thereof according to any one of claims 5-8 in the preparation of the nucleotide or a pharmaceutically acceptable salt thereof according to any one of claims 1-4.

10. A polynucleotide encoding a target polypeptide and / or protein, wherein, The polynucleotide comprises one or more modified uracil nucleotides or nucleosides, wherein the modified uracil nucleotides or nucleosides are derived from the nucleotides of any one of claims 1-4 or pharmaceutically acceptable salts thereof, or the nucleosides of any one of claims 5-8 or pharmaceutically acceptable salts thereof.

11. The polynucleotide encoding the target polypeptide and / or protein according to claim 10, wherein the modified uracil nucleotide or nucleoside comprises or has the following structure 。 12. The polynucleotide encoding the target polypeptide and / or protein according to claim 11, wherein, The deuterium content at each position, denoted as D, is at least 70%.

13. The polynucleotide encoding the target polypeptide and / or protein according to claim 11, wherein, The deuterium content at each position, denoted as D, is at least 95%.

14. The polynucleotide encoding the target polypeptide and / or protein according to claim 11, wherein, The deuterium content at each position, denoted as D, is at least 98%.

15. A nucleic acid molecule comprising a polynucleotide encoding a target polypeptide and / or protein as described in any one of claims 10-14.

16. The nucleic acid molecule of claim 15, wherein, The nucleic acid molecule also includes one or more of the following: a 5' cap structure, a 5' UTR, a 3' UTR, and a 3' poly-A tail.

17. The nucleic acid molecule of claim 15, wherein, The nucleic acid molecule comprises, from the 5' end to the 3' end, the following in sequence: a 5' cap structure, a 5' UTR, a polynucleotide encoding the target polypeptide and / or protein, and a 3' UTR.

18. The nucleic acid molecule of claim 15, wherein, The nucleic acid molecules are selected from siRNA, mRNA, shRNA, antisense oligonucleotides, and RNA aptamers.

19. The nucleic acid molecule of claim 15, wherein, The nucleic acid molecule is mRNA.

20. A vector comprising the nucleic acid molecule according to any one of claims 15-19.

21. The carrier according to claim 20, wherein, The vector is selected from plasmids, bacteriophages, and viral vectors.

22. A delivery composition comprising a delivery vector and one or more of the following: a polynucleotide encoding a target polypeptide and / or protein as described in any one of claims 10-14, a nucleic acid molecule as described in any one of claims 15-19, and a vector as described in claim 20 or 21.

23. The delivery composition of claim 22, wherein, The delivery vector is selected from lipid particles, sugar particles, metal particles, protein particles, liposomes, exosomes, microvesicles, gene guns, and viral vectors.

24. The delivery composition of claim 23, wherein, The viral vector is a replication-defective retrovirus, adenovirus, or adeno-associated virus.

25. The delivery composition of claim 23, wherein, The viral vector is a lentivirus.

26. The delivery composition of claim 23, wherein, The delivery carrier is a nanolipid particle.

27. The delivery composition of claim 26, wherein, The nanolipid particles comprise one or more of cationic lipids, polyethylene glycol-modified lipids, neutral lipids, and steroids.

28. The delivery composition of claim 27, wherein, The nanolipid particles contain ionizable cationic lipid SM-102, auxiliary lipid DSPC, cholesterol, and PEG2000-DMG.

29. A pharmaceutical composition comprising a polynucleotide encoding a target polypeptide and / or protein as described in any one of claims 10-14, a nucleic acid molecule as described in any one of claims 15-19, a carrier as described in claim 20 or 21 and / or a delivery composition as described in any one of claims 22-28, and one or more pharmaceutically acceptable carriers and / or excipients.

30. The pharmaceutical composition of claim 29, wherein, The pharmaceutical composition also contains additional pharmaceutically active agents.

31. The pharmaceutical composition of claim 30, wherein, The additional pharmaceutically active agent is provided as a component of the polynucleotide, nucleic acid molecule, carrier, and / or delivery composition encoding the target polypeptide and / or protein.

32. A kit comprising the nucleotide of any one of claims 1-4 or a pharmaceutically acceptable salt thereof.

33. The kit according to claim 32, wherein, The kit also contains adenosine triphosphate (ATP), guanosine triphosphate (GTP), and cytidine triphosphate (CTP).

34. Use of the nucleotide of any one of claims 1-4 or a pharmaceutically acceptable salt thereof, or the nucleoside of any one of claims 5-8 or a pharmaceutically acceptable salt thereof, or the kit of claim 32 or 33 in the preparation of the polynucleotide encoding the target polypeptide and / or protein of any one of claims 10-14, the nucleic acid molecule of any one of claims 15-19, the carrier of any one of claims 20 or 21, the delivery composition of any one of claims 22-28, or the pharmaceutical composition of any one of claims 29-31.

Images