Candida utilis for producing biological feed and production method of biological feed

By using the Candida utilis strain HLY-001 and a specific process, the problems of low fermentation efficiency and low protein extraction rate have been solved, achieving efficient and low-cost production of bio-feed, which is suitable for large-scale industrial application.

CN120988907APending Publication Date: 2025-11-21HULUNBUIR HAILIN BIOTECHNOLOGY CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511184270.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-22
Publication Date
2025-11-21

AI Technical Summary

Technical Problem

In existing technologies, the fermentation efficiency of Candida utilis for producing protein raw materials is low, the protein extraction rate is not high, and the cost is high, which limits its large-scale industrial application.

Method used

Using the Candida utilis strain HLY-001, through pretreatment, culture medium preparation, liquid fermentation, concentration, and drying granulation, and utilizing corn soaking solution, threonine mother liquor, and glucose mother liquor, fermentation efficiency was improved and production costs were controlled, thereby increasing the protein extraction rate.

Benefits of technology

It improves fermentation efficiency and protein extraction rate, shortens fermentation time, realizes efficient production of bio-feed, reduces production costs, and is suitable for large-scale industrial application.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The invention relates to the crossing field of biotechnology and feed industry, and provides candida utilis for producing a biological feed and a production method of the biological feed, which can effectively improve the fermentation efficiency and the protein extraction rate, control the production cost and facilitate large-scale industrial application. The strain is Candida utilis (Cyberlindnera jadinii) HLY-001, and is preserved in the China General Microbiological Culture Collection Center on April 29, 2025, the preservation number is CGMCC No.34399, and the preservation address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the intersection of biotechnology and the feed industry, specifically to a method for producing Candida utilis for bio-feed and a bio-feed production method. Background Technology

[0002] Microbial protein, as a sustainable protein source, boasts advantages such as high production efficiency, efficient resource utilization, and environmental friendliness. *Candida utilis*, a yeast strain capable of efficiently utilizing carbon and nitrogen sources for growth and accumulating large amounts of protein, is an ideal microbial protein production strain. However, current methods for producing protein raw materials using *Candida utilis* suffer from low fermentation efficiency, low protein extraction rates, and high costs, limiting its large-scale industrial application.

[0003] Therefore, we propose a method for producing Candida utilis and bio-feed. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides a method for producing Candida utilis and bio-feed, which can effectively improve fermentation efficiency, protein extraction rate, and control production costs, thus facilitating large-scale industrial application.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] A type of Candida utilis for producing biological feed, characterized in that: the strain is Candida utilis (Cyberlindnera jadinii) HLY-001, which was deposited on April 29, 2025 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34399, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0007] The above-mentioned method for producing biological feed using Candida utilis HLY-001.

[0008] Furthermore, the method includes the following steps: pretreatment, culture medium preparation, liquid fermentation, concentration, and drying granulation;

[0009] in,

[0010] The pretreatment involves premixing corn soaking solution with threonine mother liquor at a ratio of 9:1, and controlling the moisture content to 10-20% after mixing to obtain the fermentation substrate.

[0011] The culture medium is prepared by mixing the pre-fermentation substrate and glucose mother liquor at a mass ratio of (6-8):(1-2), adding glucose, and controlling the total sugar concentration to 80-120 g / L to obtain the fermentation culture medium.

[0012] The liquid fermentation involves inoculating a culture medium with a broth of Candida utilis and fermenting it to form a liquid fermentation broth.

[0013] Furthermore, in the preprocessing steps,

[0014] The corn soaking solution is a byproduct of corn kernels soaked in sulfurous acid, with a moisture content of 8%-12% and a dry-basis protein content of 44%-47%.

[0015] The threonine mother liquor is a liquid byproduct of crystalline threonine production, with a moisture content of 55%-65% and a dry-basis protein content of 57%-62%.

[0016] The premixing parameters in the pretreatment step are as follows: pH 4.0, rotation speed 200-400 rpm, and time 5-10 min.

[0017] Furthermore, in the preparation of the culture medium, the glucose mother liquor comes from the deep processing of corn starch milk, which involves slurrying, spraying liquefaction, adding enzymes for saccharification, and plate and frame filtration to form a liquid.

[0018] Furthermore, in the liquid fermentation step, the concentration of *Candida utilis* HLY-001 bacterial culture was 10. 4 -10 6 CFU / mL, inoculum size 3-5% (v / v), temperature 37±1℃, initial pH 3.9, dissolved oxygen 0.5-2.0 mg / L, fermentation 18-24 h.

[0019] Furthermore, before the concentration process, a detoxification step is also included.

[0020] The detoxification process involves adding 0.5%-0.1% of modified montmorillonite adsorbent and 0.1%-0.3% of detoxifying bacteria to the fermentation broth (pH 6.0) to degrade vomitoxin (degradation rate over 90%).

[0021] Furthermore, the process involves evaporation concentration. The detoxified fermentation broth is concentrated by vacuum evaporation (60-65℃) until the dry matter content is 60±2%.

[0022] Furthermore, the drying and granulation is spray drying granulation, which is carried out by atomization in a centrifugal granulation bed (atomization pressure 0.2-0.4 MPa), with an inlet air temperature of 175-185℃, an outlet air temperature of 80-85℃, and a particle size of 80-120 mesh, to obtain biological feed.

[0023] This invention provides a Candida utilis strain for producing biological feed and a method for producing biological feed, which has the following beneficial effects: The Candida utilis HLY-001 of this invention ferments for 24 hours, with a sugar conversion rate of ≥95%, forming a liquid fermentation broth with a dry matter content of 10-15% and a dry-based protein content of over 55% from 45%, which can effectively improve fermentation efficiency, protein extraction rate, and shorten fermentation time. At the same time, the fermentation culture medium raw materials of this invention use corn soaking solution, threonine mother liquor, and threonine mother liquor, which can realize the reuse of by-products, effectively control production costs, and facilitate large-scale industrial application. Detailed Implementation

[0024] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0025] Example 1

[0026] This example demonstrates the isolation and identification of bacterial strains.

[0027] 1. Isolation of bacterial strains

[0028] 1.1 Sample collection: Soil samples were collected from Horqin District, Tongliao, Inner Mongolia.

[0029] 1.2 Strain strain isolation, including the following steps:

[0030] 1.2.1 Strains Isolation

[0031] Weigh 10g of soil sample and add it to a 90mL Erlenmeyer flask containing 0.1% Tween-80 sterile saline. Shake at 30℃ and 200rpm for 20min. Take 200μL of the homogenate and add it to a 1.5mL EP tube containing 800μL sterile saline. Dilute serially to 10⁻⁻⁶. 7 .

[0032] Take 150 μL of each graded dilution and spread it on YEPD enrichment medium (containing 50 μg / mL chloramphenicol), and incubate at 30℃ inverted for 72 h; pick up suspected yeast colonies with regular edges, milky white color and viscous texture, and observe them under a microscope after staining with methylene blue, and screen out oval cells with budding characteristics.

[0033] The target colonies were transferred to PDA solid medium using the three-zone streak method and cultured at 30°C for 48 hours. By observing the colony color, edge morphology and microscopic cell purity, the culture was obtained by repeating the transfer more than 5 times and named CLJSJM-HL-2501.

[0034] 2. Strain identification:

[0035] The gene was sequenced using universal primers NL1 and NL4 (NL1: GCA TAT CAA TAA GCG GAGGAA AAG; NL4: GGT CCG TGT TTC AAG ACG G) for the D1 / D2 LSU rRNA gene, yielding a 624 bp fragment, the sequence of which is shown in SEQ ID No. 1. This fragment showed the highest similarity (100%) to the known type species of *Cyberlindnera jadini*, CBS 1600T. The gene was then sequenced using universal primers for the rDNA ITS gene (5'-TCC TCC GCT TAT TGA TAT GC-3'; 5'-GGA AGT AAAAGT CGT AAC AAG G-3'), yielding a 597 bp fragment, the sequence of which is shown in SEQ ID No. 2. This fragment showed the highest similarity (98.66%) to the known type species of *Cyberlindnera jadini*, CBS 1600T. Phylogenetic trees were constructed using the rDNA ITS and D1 / D2 LSU rRNA gene sequences of strain CLJSJM-HL-2025 and the sequences of published model strains of closely related species in the genus Cyberlindnera. The results showed that strain CLJSJM-HL-2025 and the Cyberlindnerajadini model strain NRRL Y-1542T stably clustered in the same branch.

[0036] Sequencing results of the strain:

[0037] LSU:

[0038] TTGATTTTTCCAATAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGAGGCTCTCAGCCCCCGAGTTGTAATTTGAAGATGGTGTTCTGGCGCCGGCCCCCTGTCTACGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTCTGGCGGGGCGGCCTGGCTCCGTGTAGAGCGCCATCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTATTGGATCAGACTTGGTGCTGTGCGAATAGCGGCTCTTCTTGGGCCGCCCACTCGCACTCCACCGGGCCAGCATCGGTTTGGGCGGCAAGACAATGGCGGGGGAACGTGGCACTGCTCTCGGGCAGTGTGTTTATAGCCCCCGCTGATGTTGCCTGCCTAGACCGAGGACTGCGGCTTCTGCCTAGGATGCTGGCGTAATGATCCAACACCGCCCGTCTTGACCCCCGAACCA

[0039] ITS:

[0040] TTTTCCCCCCCCCTTTTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAGCTTAGAAAGGTTGTTCAGCCGAGCTCTGCCTGGAAGTCTGTCTGGAAAATAACGAGTTGGTAGAACCTAATACATTATTTCGGCCC AGAGGATTTCTAGGGGGAGCTCTGCCTAGAGTATTTCAAGTTAACACAGAGTATCACTCAATACCAAGTCCCCTAGAGGATCTTGAGAGAGAAATGACGCTCAAACAGGCATGCTCTCTGGAATGCCAGAGAGCGCAATATGCGTTCAA AGATTCGATGATTCACGAAAACCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGTTGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGAAGATTAAAATTCAAATTGACTAGTTTCTAGAGAAAATAAATTTCTG TGTTTAAAACCTTTGGCAGAGCCAAAGCAAAAGAAGCAAAATACACTGTGTATTGGTTGGAGCCGCGCTAGAAGCGCAGGCCCAGGTTCTCTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGCTTTTTTACACTTCCAA

[0041] Based on the above results, the strain was identified as *Cyberlindnera jadinii*. Due to a change in taxonomic status, *Candida utilis* has been renamed *Cyberlindnera jadinii*, making them synonyms. This identification result is only applicable to the current state of this strain.

[0042] Example 2

[0043] A method for producing bio-feed using Candida utilis includes the following steps:

[0044] S1. Premixing: The corn soaking solution and threonine mother liquor are premixed at a ratio of 9:1. The mixing conditions are pH 4.0, speed 400 rpm and time 10 min. After mixing, the moisture content is controlled to 80-90% to obtain the fermentation substrate.

[0045] The corn soaking solution is a byproduct of corn kernels soaked in sulfurous acid, with a moisture content of 89.8% and a dry-basis protein content of 45.2% (the raw material for the corn soaking solution has a moisture content of 88%-92% and a dry-basis protein content of 44%-47%).

[0046] Threonine mother liquor is a liquid byproduct of crystalline threonine production, with a moisture content of 62.4% and a dry-basis protein content of 58.6% (the raw material for threonine mother liquor has a moisture content of 55%-65% and a dry-basis protein content of 57%-62%).

[0047] S2. Culture medium preparation: Mix the premixed solution and glucose stock solution at a mass ratio of 8:2, and add glucose to achieve a total sugar concentration of 96.3 g / L. Mix for 10 min to obtain the fermentation culture medium.

[0048] The glucose mother liquor comes from the deep processing of corn starch milk. It is the liquid (i.e., filtrate) obtained after corn starch milk is slurried, sprayed liquefied, saccharified with enzymes, and filtered through a plate and frame filter.

[0049] S3, Liquid Fermentation: Inoculate Candida utilis into the culture medium at an inoculation rate of 3-5% (v / v), temperature 37±1℃, initial pH 3.9, dissolved oxygen 2.0 mg / L (microaerobic fermentation), ferment for 20 h, sugar conversion rate ≥95%, forming a liquid fermentation broth with a dry matter content of 13.8%, dry basis protein content increased from 45.2% to 55.5%, reducing sugar content <1%, and pH 5.0;

[0050] S4. Detoxification process: 0.1% modified montmorillonite adsorbent and 0.2% detoxifying agent are added to the fermentation broth (pH 6.0) to degrade vomitoxin (degradation rate of over 90%), reducing the vomitoxin (dry basis) index from 10,000 ug / kg to below 2,000 ug / kg, with a detoxification rate of over 80%.

[0051] S5. Evaporation and Concentration: The detoxified fermentation broth is concentrated by vacuum evaporation (60-65℃) to a dry matter content of 61.3%.

[0052] S6. Spray drying granulation: Biological feed is obtained by atomizing the pellets in a centrifugal granulation bed (atomization pressure 0.2-0.4 MPa), with an inlet air temperature of 175-185℃, an outlet air temperature of 80-85℃, and a particle size of 80-120 mesh.

[0053] Example 1 Comparative Example 1 Comparative Example 2 Comparative Example 3 Comparative Example 4 Comparative Example 5 Comparative Example 6 strains HLY-001 HLY-001 HLY-001 HLY-001 32254 32254 / 23485 23485 The ratio of corn soaking solution to threonine stock solution 9:1 9:1 9:1 9:1 9:1 9:1 9:1 reducing sugar content in culture medium 16.96% 16.96% 16.96% 16.96% 16.96% 16.96% 16.96% Fermentation time 20h 18h 24h 30h 20h 20h 20h Sugar conversion rate 88.38% 85.71% 87.35% 88.01% 45.69% 38.71% 35.68% Dry protein content 55.5% 54.39% 54.97% 55.00% 49.25% 48.46% 47.99%

[0054] Note:

[0055] 1. The dry-based protein content in the table above refers to the dry-based protein content of the fermentation broth.

[0056] 2. The inoculation amount and inoculation concentration are the same in the examples and comparative examples.

[0057] 3. The strain used in Comparative Example 4 was Saccharomyces cerevisiae CICC 32254.

[0058] 4. In Comparative Example 5, CICC 32254 and CICC 23485 were combined, with 32254:23485 = 2:1.

[0059] 5. Comparative Example 6 used lactic acid bacteria CICC 23485.

[0060] It should be noted that, in this document, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Unless otherwise specified, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.

[0061] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Candida utilis strain for producing biological feed, characterized in that: The strain is *Cyberlindnera jadinii* HLY-001, which was deposited on April 29, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34399. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

2. A method for producing biological feed using Candida utilis HLY-001 as described in claim 1.

3. The method for producing biological feed using Candida utilis HLY-001 as described in claim 2, characterized in that: The method includes the following steps: Pretreatment, culture medium preparation, liquid fermentation, concentration and drying granulation; in, The pretreatment involves premixing corn soaking solution with threonine mother liquor at a ratio of 9:1, and controlling the moisture content to 10-20% after mixing to obtain the fermentation substrate. The culture medium is prepared by mixing the pre-fermentation substrate and glucose mother liquor at a mass ratio of (6-8):(1-2), adding glucose, and controlling the total sugar concentration to 80-120 g / L to obtain the fermentation culture medium. The liquid fermentation involves inoculating a culture medium with a broth of Candida utilis and fermenting it to form a liquid fermentation broth.

4. The method for producing biological feed using Candida utilis HLY-001 as described in claim 3, characterized in that: In the preprocessing step, The corn soaking solution is a byproduct of corn kernels soaked in sulfurous acid, with a moisture content of 8%-12% and a dry-basis protein content of 44%-47%. The threonine mother liquor is a liquid byproduct of crystalline threonine production, with a moisture content of 55%-65% and a dry-basis protein content of 57%-62%. The premixing parameters in the pretreatment step are as follows: pH 4.0, rotation speed 200-400 rpm, and time 5-10 min.

5. The method for producing biological feed using Candida utilis HLY-001 as described in claim 3, characterized in that: In the liquid fermentation step, the concentration of *Candida utilis* HLY-001 bacterial culture was 10. 4 -10 6 CFU / mL, inoculum size 3-5% (v / v), temperature 37±1℃, initial pH 3.9, dissolved oxygen 0.5-2.0 mg / L, fermentation 18-24 h.

6. The method for producing biological feed using Candida utilis HLY-001 as described in claim 3, characterized in that: Before the concentration process, a detoxification step is also included. The detoxification process involves adding 0.5%-0.1% of modified montmorillonite adsorbent and 0.1%-0.3% of detoxifying bacteria to the fermentation broth to degrade vomitoxin.

7. The method for producing biological feed using Candida utilis HLY-001 as described in claim 3, characterized in that: The concentration step is evaporation concentration. The detoxified fermentation broth is concentrated by vacuum evaporation until the dry matter content is 60±2%.

8. The method for producing biological feed using Candida utilis HLY-001 as described in claim 3, characterized in that: The drying and granulation process is spray drying granulation, which involves atomization through a centrifugal granulation bed with an atomization pressure of 0.2-0.4 MPa, an inlet air temperature of 175-185℃, an outlet air temperature of 80-85℃, and a particle size of 80-120 mesh, to obtain biological feed.