A high specific activity acid mannanase mutant

Abstract

The present application relates to the technical field of genetic engineering and protein engineering, and particularly provides a high specific activity acid mannanase mutant. The specific activity of the mutant is significantly improved compared with wild type, which is beneficial to its practical application in livestock and poultry and marine aquatic feed.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and protein engineering, specifically to a high specific activity acid mannanase mutant. Background Technology

[0002] β-Mannanases are a class of hemicellulases that catalyze the cleavage of β-1,4-glycosidic bonds in mannan to produce oligosaccharides, and are widely found in nature. Microbial β-mannanases are more numerous, possess excellent enzymatic properties, and are the most frequently reported in research. Bacterial β-mannanases were first identified in the genus *Bacillus* (…). Bacillus It was later discovered in the genus Bifidobacterium ( Bifidobacterium ), Cyclocycline Bacillus spp. Alicyclobacillus ) and Bacillus spp. ( Paenibacillus ) and others were found. Among actinomycetes, Streptomyces ( Streptomyces ) and Nocardia spp. Nocardioides β-Mannanases exhibit significant mannan-degrading capabilities. The main fungi producing β-mannanases are Aspergillus and Penicillium. In plants, they are primarily found in tomatoes and coffee. Animal-derived β-mannanases are less common, mainly found in some gastropod marine mollusks, such as sea hares and abalone. Microbial-derived β-mannanases are easier to obtain than those from other organisms, are less expensive, and possess excellent enzymatic properties. Furthermore, heat-resistant, alkali-resistant, and low-temperature-resistant β-mannanases that meet industrial and domestic needs can be screened under extreme conditions. Recent studies have shown that β-mannanases have broad application value in fields such as petroleum exploration, detergents, textiles, food, animal feed, and bioethanol refining.

[0003] Mannan is an important component of hemicellulose and is widely found in hardwoods, softwoods, and the seeds of legumes. Mannan acts as a structural polysaccharide, contributing to the maintenance of plant cell structure integrity, and also exists as a storage polysaccharide in the endosperm and vacuoles of various plant seeds. Some cereal crops, used as unconventional feed ingredients, commonly contain the anti-nutritional factor mannan, which is the only key factor limiting their application. Monogastric animals cannot secrete mannanase to hydrolyze it into usable nutrients. When mannan comes into contact with water, it becomes viscous, increasing the viscosity of the digestive tract and slowing down digestion, thus affecting animal production performance. Directly adding enzyme preparations to feed is an effective and practical measure. Studies have shown that adding β-mannanase to diets containing mannan can improve animal production performance.

[0004] The currently used β-mannanase has problems such as low specific enzyme activity, instability, and high cost, which cannot meet production needs. It is necessary to optimize its properties through molecular modification to make it more suitable for practical application in the fields of livestock, poultry, and marine aquatic feed. Summary of the Invention

[0005] The purpose of this invention is to provide a high specific activity acid mannanase mutant. The specific activity of the mutant is significantly improved compared to the wild type, which is beneficial for its practical application in livestock, poultry, and marine aquatic feed.

[0006] One aspect of this invention relates to a mannanase mutant, which is obtained by mutating the 128th amino acid of mannanase with the amino acid sequence SEQ ID NO:4 from Tyr to Asn.

[0007] The present invention also relates to DNA molecules encoding the above-mentioned mutants.

[0008] The present invention also relates to recombinant expression plasmids comprising the above-described DNA molecules.

[0009] The present invention also relates to a host cell comprising the above-described recombinant expression plasmid.

[0010] When the above plasmids were transferred into host cells, the specific activity of the recombinant mannanase mutant was significantly improved.

[0011] In some embodiments of the present invention, the host cell is *Trichoderma reesei* (…). Trichoderma reesei ).

[0012] Based on wild-type mannanase MAN, this invention provides a mannanase mutant containing a single-point mutation of Y128N. Compared with mannanase MAN, the specific activity of the mannanase mutant provided by this invention is increased by 42.81%, reaching 762.25 U / mg, achieving unexpected technical effects.

[0013] In summary, the specific activity of the acidic mannanase mutant provided by this invention is significantly improved, which is beneficial to reducing production costs and promoting its widespread application in the fields of livestock and poultry and marine aquatic feed. Detailed Implementation

[0014] This invention discloses an acidic mannanase mutant, its preparation method and application, the DNA molecule encoding the mannanase mutant, the vector, and the host cell. Those skilled in the art can refer to the content herein and appropriately modify the process parameters to achieve the desired result. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0015] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECULAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENTPROTOCOLS IN MOLECULAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can use other conventional methods, experimental protocols, and reagents based on the technical solutions described in this invention, without being limited to the specific embodiments of this invention. For example, the following experimental materials and reagents may be used in this invention:

[0016] Strains and reagents: Escherichia coli DH5α was purchased from Invitrogen, PCR enzymes and ligases were purchased from Takara, restriction endonucleases were purchased from Fermentas, lyases were purchased from Sigma, Amp, sorbitol, PEG6000, Tris and CaCl2 were purchased from Invitrogen, plasmid extraction kits and gel purification and recovery kits were purchased from Omega, and GeneMorph II random mutagenesis kits were purchased from Beijing Bomais Biotechnology Co., Ltd.

[0017] Culture medium formulation:

[0018] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;

[0019] LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0;

[0020] Upper culture medium: 0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose;

[0021] The lower culture medium plate contains: 2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, and 1.5% agar.

[0022] The present invention will be further illustrated below with reference to the embodiments:

[0023] Example 1 Cloning of the mannanase gene

[0024] Aspergillus niger ( Aspergillus nigerThe genome was used as a template for PCR amplification. The PCR primers MAN-F1 and MAN-R1 are as follows:

[0025] MAN-F1: GCT GAATTC CTCCCCAAAGCTTCACCAGCTCC (SEQ ID NO: 1, underlined is the EcoRI restriction enzyme recognition site);

[0026] MAN-R1: CTG GCGGCCGC TTATCAGGCGGAGTCAATAGCG (SEQ ID NO: 2, underlined is the NotI restriction enzyme recognition site).

[0027] The PCR product was recovered via gel extraction, ligated into the pEASY-T vector, and transformed into *E. coli* DH5α. Correct transformants were selected for sequencing. Sequencing results showed that the nucleotide sequence of the amplified gene fragment was SEQ ID NO: 3, and its encoded amino acid sequence was SEQ ID NO: 4. NCBI BLAST comparison revealed that SEQ ID NO: 4 had 100% similarity to the mannanase sequence derived from *Aspergillus niger*, thus confirming that the gene obtained by PCR was the mannanase gene, named MAN.

[0028] Example 2: Screening for high specific activity mannanase mutants

[0029] To improve the specific activity of mannanase MAN, the applicant screened for a large number of mutations in the enzyme using directed evolution technology.

[0030] Using the MAN gene (SEQ ID NO: 3) as a template, PCR amplification was performed using the primers MAN-F1 and MAN-R1 described in Example 1 with the GeneMorph II random mutagenesis PCR kit. The PCR product was recovered from the gel, digested with EcoRI and Not I, and then ligated into the pET21a vector digested with the same enzymes. The transformed product was then transformed into Escherichia coli BL21(DE3), plated on LB-Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one with a toothpick and transferred to a 96-well plate. 150 μL of LB-Amp medium containing 0.1 mM IPTG was added to each well, and the plates were incubated at 37°C and 220 rpm for about 6 h. The supernatant was discarded by centrifugation, and the cells were resuspended in buffer and repeatedly freeze-thawed to break the cell walls, obtaining Escherichia coli cell lysate containing acid mannanase.

[0031] 30 μL of lysis buffer was transferred to two new 96-well plates. 30 μL of substrate was added to one well, and the mixture was incubated at 37°C for 30 min. The reducing sugar content was then determined using the DNS method. 150 μL of Coomassie Brilliant Blue solution was added to the other well, and the mixture was allowed to stand for 10 min. The protein content was then determined using the Coomassie Brilliant Blue (Bradford) binding assay. The enzyme activity and protein content of different mutants were calculated. Ultimately, the applicant screened tens of thousands of transformants to identify the mutation site Y128N, which significantly increased the MAN specific activity of the mannanase mutant.

[0032] Based on wild-type mannanase MAN, this invention provides a mutant containing a single point mutation of Y128N.

[0033] Example 3 Expression of mannanase in Trichoderma reesei

[0034] First, based on the codon preference of Trichoderma, the gene sequences of mannanase MAN and its mutants were optimized. The optimized gene sequences were synthesized by Shanghai Jierui Biotechnology Co., Ltd., and two restriction enzyme sites, KpnI and MluI, were added to the 5' and 3' ends of the synthesized sequences, respectively.

[0035] 3.1 Construction of expression plasmids

[0036] The synthesized mannanase gene fragment and the pSC1G vector were digested with restriction endonucleases KpnI and MluI (Fermentas), respectively. The digestion products were purified using a gel purification kit, and the digestion products of the mannanase gene and the pSC1G vector were ligated using T4 DNA ligase (Fermentas) and transformed into E. coli DH5α (Invitrogen). Selection was performed using ampicillin, and the clones were sequenced (Invitrogen) for verification. After successful sequencing, recombinant plasmids containing the mannanase gene were obtained.

[0037] 3.2 Construction of recombinant Trichoderma reesei strains

[0038] (1) Preparation of protoplasts

[0039] Take the host fungus Trichoderma reesei ( Trichoderma reesei UE spore suspension was inoculated onto PDA plates and cultured at 30℃ for 6 days. After abundant sporulation, colonies of about 1cm×1cm were cut and placed in liquid medium containing 120 mL YEG+U (0.5% yeast powder, 1% glucose, 0.1% uridine) and cultured at 30℃ with shaking at 220 rpm for 14~16 h.

[0040] Mycelia were collected by filtration through sterile gauze and washed once with sterile water. The mycelia were placed in an Erlenmeyer flask containing 20 mL of 10 mg / mL lysin solution (Sigma L1412) and incubated at 30 °C and 90 rpm for 1-2 h. The progress of protoplast transformation was detected by microscopic observation.

[0041] Add 20 mL of pre-chilled 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl2) to the Erlenmeyer flask, shake gently, filter with sterile Miracloth filter cloth, collect the filtrate, centrifuge at 3000 rpm, 4℃ for 10 min; discard the supernatant, add 5 mL of pre-chilled 1.2 M sorbitol solution to suspend the bacterial cells, centrifuge at 3000 rpm, 4℃ for 10 min; discard the supernatant, add an appropriate amount of pre-chilled 1.2 M sorbitol to suspend and dispense.

[0042] (2) Expression plasmid transformation

[0043] All the following operations were performed on ice. 10 μg of the recombinant plasmid constructed above was added to a 7 mL sterile centrifuge tube containing 200 μL of protoplast solution. Then, 50 μL of 25% PEG (25% PEG, 50 mM Tris-Cl, 50 mM CaCl2) was added, mixed, and incubated on ice for 20 min. Next, 2 mL of 25% PEG was added, mixed, and incubated at room temperature for 5 min. Then, 4 mL of 1.2 M sorbitol was added, mixed, and poured into the upper culture medium. After gentle mixing, the mixture was spread onto the prepared lower culture medium plate and incubated at 30℃ for 5–7 days until transformants appeared. The transformed transformants were then transferred to the lower culture medium plate for rescreening; strains with smoother colony edges were considered positive transformants.

[0044] Following the above method, the applicant constructed recombinant Trichoderma reesei engineered strains expressing mannanase MAN and its mutants.

[0045] (3) Fermentation verification and enzyme activity assay

[0046] The engineered Trichoderma reesei strains constructed above were inoculated onto PDA plates and incubated upside down in a 30℃ incubator for 6-7 days until spores were abundant. Two 1cm diameter mycelial blocks were then inoculated into 250mL Erlenmeyer flasks containing 50mL of fermentation medium (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH4)2SO4, 0.09% MgSO4, 2% KH2PO4, 0.04% CaCl2, 0.018% Tween-80, 0.018% trace elements). The flasks were incubated at 30℃ for 48 hours, followed by incubation at 25℃ for 48 hours. The fermentation broth was centrifuged to obtain fermentation supernatants containing mannanase MAN and its mutant, respectively. The enzyme activity and protein content were measured, and the specific activity was calculated.

[0047] 3.3 Mannanase Activity Detection Method

[0048] (1) Definition of mannanase enzyme activity unit

[0049] Under conditions of 37°C and pH 5.5, the amount of enzyme required to degrade and release 1 μmol of reducing sugar per minute from a mannan solution with a concentration of 3 mg / ml is defined as one enzyme activity unit (U).

[0050] (2) Enzyme activity assay method

[0051] (2.1) Plotting the standard curve:

[0052] Pipette 4.0 ml of acetate-sodium acetate buffer solution, add 5.0 ml of DNS reagent, and heat in a boiling water bath for 5 min. Cool to room temperature with tap water, and dilute to 25.0 ml with water to prepare a standard blank sample.

[0053] Pipette 1.00, 2.00, 3.00, 4.00, 5.00, 6.00 and 7.00 ml of mannose solution respectively, and dilute to 100 ml with acetate-sodium acetate buffer solution to prepare D-mannose standard solutions with a concentration of 0.10~0.70 mg / ml.

[0054] Pipette 2.00 ml of each of the above concentration series of mannose standard solutions (make two replicates) into separate graduated test tubes, then add 2 ml of acetate-sodium acetate buffer solution and 5 ml of DNS reagent to each. Incubate with electromagnetic oscillation for 3 seconds, then heat in a boiling water bath for 5 minutes. Cool to room temperature with tap water, then dilute to 25 ml with water. Zero the tube using a standard blank as a control, and measure the absorbance (OD) value at 540 nm.

[0055] A standard curve was plotted with mannose concentration on the Y-axis and absorbance (OD) value on the X-axis. The standard curve needs to be re-plotted each time a new DNS reagent is prepared.

[0056] (2.2) Enzyme activity assay:

[0057] Take 10.0 ml of mannan solution and equilibrate at 37°C for 10 min.

[0058] Take 10.0 ml of appropriately diluted enzyme solution and equilibrate at 37°C for 10 min.

[0059] Pipette 2.00 ml of appropriately diluted enzyme solution (equilibrated at 37°C) into a graduated test tube, add 5 ml of DNS reagent, and vortex for 3 seconds. Then add 2.0 ml of mannan solution, incubate at 37°C for 30 minutes, and heat in a boiling water bath for 5 minutes. Cool to room temperature with tap water, add water to a final volume of 25 ml, and vortex for 3 seconds. Using a standard blank sample as a blank control, measure the absorbance at 540 nm. A B .

[0060] Pipette 2.0 ml of appropriately diluted enzyme solution (equilibrated at 37°C) into a graduated test tube, then add 2.0 ml of mannan solution (equilibrated at 37°C), vibrate electromagnetically for 3 seconds, and incubate at 37°C for 30 minutes. Add 5.0 ml of DNS reagent, vibrate electromagnetically for 3 seconds to initiate the enzymatic hydrolysis reaction. Heat in a boiling water bath for 5 minutes, cool to room temperature with tap water, and dilute to 25 ml with water, vibrating electromagnetically for 3 seconds. Using a standard blank sample as a blank control, measure the absorbance at 540 nm. A E .

[0061] Enzyme activity calculation formula:

[0062] X D =[(A E -A B )×K+ C0]×N×1000 / (M×t).

[0063] In the formula: X D To dilute the mannanase activity in the enzyme solution, U / ml; A E The absorbance of the enzyme reaction solution; A B λ is the absorbance of the enzyme blank solution; K is the slope of the standard curve; C0 is the intercept of the standard curve; M is the molar mass of mannose, 180.2 g / mol; t is the enzymatic reaction time, min; N is the enzyme dilution factor; 1000 is the conversion factor, 1 mmol = 1000 μmol.

[0064] 3.4 Protein content determination method

[0065] (1) Measurement method

[0066] The Coomassie Brilliant Blue (Bradford) binding method for protein determination is a combined colorimetric and dye-based method. Coomassie Brilliant Blue G-250 is brownish-red in acidic solution, turning blue upon binding with protein. Within a certain protein concentration range, it follows Beer's Law and can be measured colorimetrically at 595 nm. It exhibits significant absorption within 3–5 minutes and remains stable for at least 1 hour. In the range of 10–1000 μg / mL, the absorbance is directly proportional to the protein concentration.

[0067] The enzyme solution and Coomassie Brilliant Blue solution were mixed at a volume ratio of 1:5, allowed to stand for 10 min, and the protein content was determined by the Coomassie Brilliant Blue (Bradford) binding method.

[0068] 3.5 Specific vitality calculation

[0069] "Specific Activity" refers to the number of enzyme activity units per unit weight of protein, usually expressed as U / mg protein.

[0070] Specific activity calculation formula: Specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).

[0071] The specific calculation results are shown in Table 1.

[0072] Table 1 Comparison of specific activities of mannanase mutants

[0073] Mannanase MAN and its mutants Specific activity (U / mg) Wild-type MAN 533.75 Y128N single-point mutant 762.25

[0074] As shown in Table 1, compared with wild-type mannanase MAN, the specific activity of the acidic mannanase single-point mutant provided by this invention is generally increased by 42.81%, reaching 762.25 U / mg, achieving unexpected technical results.

[0075] The acid mannanase mutant provided by this invention has a significantly higher specific activity than the wild type, which is beneficial for reducing production costs and promoting its widespread application in the fields of livestock, poultry, and marine aquatic feed.

Claims

1. An acid mannanase mutant, characterized in that, The mutant is obtained by mutating the amino acid at position 128 of the acid mannanase with the amino acid sequence of SEQ ID NO: 4 from Tyr to Asn.

2. A DNA molecule encoding the acid mannanase mutant of claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid of claim 3; the host cell is Trichoderma reesei (Rut C-30) Trichoderma reesei ).

5. Use of the acid mannanase mutant of claim 1 in the production of feed for livestock, poultry or marine aquaculture.