MsGWAS1 coding gene and application thereof in promoting leaf development

Abstract

The invention relates to the technical field of plant genetic engineering. The invention provides an MsGWAS1 coding gene, and a nucleotide sequence of the MsGWAS1 coding gene is shown as SEQ ID NO.3. The invention also provides a gene for detecting the MsGWAS1 gene. The invention also provides an application of the MsGWAS1 coding gene in promoting leaf development, and the leaf development shows that the plant leaf area is increased according to the application. According to the application, the leaf development shows that the number of plant leaves is increased. The MsGWAS1 gene participating in alfalfa leaf size regulation is cloned, the function of the MsGWAS1 gene is verified through genetic transformation of arabidopsis thaliana, and the leaf area of transgenic arabidopsis thaliana is increased. Research on the regulation and control mechanism of the leaf size in the leaf development process has important significance on cultivation and selection of excellent alfalfa germplasm resources.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to the MsGWAS1 encoding gene and its application in promoting leaf development. Background Technology

[0002] Alfalfa, Latin name Medicago sativa L. Arabidopsis thaliana is a high-quality, high-yield perennial leguminous forage grass, known as the "King of Forages" due to its high yield and quality. Its cultivation is a primary means of ensuring the high-quality development of the forage industry. As the main harvested organ of alfalfa, the size of the leaves is closely related to yield and quality. Studying the regulatory mechanisms of leaf size during leaf development is of great significance for breeding and selecting high-quality alfalfa germplasm resources. Arabidopsis thaliana, Latin name... Arabidopsis thaliana It is a small flowering plant. It is world-renowned not for its economic value or ornamental value, but because it is known as the "fruit fly of plant science" or a "model organism," and is one of the most important model organisms in modern plant biology research.

[0003] Therefore, it is of great significance to discover new genes related to the regulation of leaf size and to cultivate new plant materials that can improve the aboveground biomass of alfalfa. Summary of the Invention

[0004] To address the aforementioned issues, this invention provides the MsGWAS1 encoding gene and its application in promoting leaf development. This invention, through a genome-wide association study (GWAS), identified one of the key genes regulating leaf size development, named MsGWAS1. This gene encodes a class of calcium-binding proteins, EF-Hand Proteins, which, as a special member of the calcium ion-binding protein family, participates in the functional regulation of various aspects of cell proliferation and cell cycle along with calcium ions.

[0005] The technical solution of the present invention is as follows: In a first aspect, the present invention provides a MsGWAS1 encoding gene, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0006] Secondly, based on the same inventive concept, the present invention provides the application of the MsGWAS1 encoding gene as described above in promoting leaf development, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0007] As described above, leaf development manifests as an increase in plant leaf area.

[0008] As described above, leaf development is characterized by an increase in the number of plant leaves.

[0009] As described above, the expression vector is pFGC-eYFP, and the nucleotide sequence of pFGC-eYFP is shown in SEQ ID NO. 27.

[0010] As described above, the method for overexpressing the MsGWAS1 gene includes the following steps: The cDNA of plant leaves containing the MsGWAS1 encoding gene was used as a template for PCR amplification. The amplification product was ligated into the expression vector pFGC-eYFP to obtain an overexpression vector; the overexpression vector was transformed into Agrobacterium to upregulate the expression level of the MsGWAS1 gene.

[0011] As described above, the pFGC-eYFP expression vector is digested with the restriction endonuclease BamHI, and the amplification product and expression vector are ligated at a molar ratio of 1:2.

[0012] In the application described above, the plant is alfalfa or Arabidopsis thaliana. Preferably, the alfalfa variety is Zhongmu No. 1.

[0013] Thirdly, based on the same inventive concept, the present invention provides a method for promoting plant leaf development by overexpressing the MsGWAS1 encoding gene as described above to obtain transgenic plants, thereby improving the promotion of plant leaf development.

[0014] One method for promoting plant leaf development as described above, wherein the leaf development is an increase in plant leaf area or an increase in the number of plant leaves.

[0015] Compared with existing technologies, the effects and advantages of this invention are: This invention cloned a MsGWAS1 gene involved in regulating leaf size in alfalfa and verified its function through genetic transformation in Arabidopsis thaliana. The transgenic Arabidopsis thaliana showed increased leaf area. Studying the regulatory mechanism of leaf size during leaf development is of great significance for breeding and selecting superior alfalfa germplasm resources. Attached Figure Description

[0016] Figure 1 This is a phenotypic variation diagram of leaf size correlation traits in 109 alfalfa germplasms; Figure 2 This is a Manhattan plot of a genome-wide association study of traits related to leaf size in alfalfa. Figure 3This study presents observations and statistics on the lower epidermal cells of leaves at different developmental stages. A represents the lower epidermal cells of alfalfa leaves at different developmental stages observed under a 20x microscope (scale bar: 50 μm); B represents the leaf area at different developmental stages; C represents the area of ​​a single cell at different developmental stages; and D represents an estimate of the total number of lower epidermal cells at different developmental stages. L0, L1, L2, and L3 represent leaves at different leaf positions. Figure 4 This is a qRT-PCR analysis diagram of 9 candidate genes in leaves of different sizes; where: X represents Xinjiang large-leaf alfalfa, and N represents Inner Mongolia small-leaf alfalfa; Figure 5 This is a qRT-PCR analysis diagram of three Arabidopsis thaliana lines overexpressing GWAS1; Figure 6 This is a growth graph of leaf size in Arabidopsis thaliana overexpressing GWAS1; where: A is the phenotype of Arabidopsis thaliana after 1 week of growth; B is the phenotype of Arabidopsis thaliana after 3 weeks of growth. The first row consists of wild-type phenotypes, and each column shows the T1 generation of Arabidopsis thaliana overexpressing alfalfa GWAS1 and the wild-type phenotype. Detailed Implementation

[0017] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0018] Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this specification includes any and all combinations of one or more of the associated listed items.

[0019] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0020] Example 1: Screening of the MsGWAS1 gene 1. Statistical analysis of leaf size phenotypic data A genome-wide association study (GWAS) of leaf size was conducted on 109 accessions from core alfalfa germplasm resources grown in Beijing. In May 2023, mature leaves from the middle and lower parts of the plants were photographed, and the leaf area, leaf length, leaf width, and aspect ratio were measured using ImageData software. Statistical analysis was performed to calculate the standard deviation and coefficient of variation for each trait. Generalized heritability (H2) was calculated using the R language package. The coefficient of variation was calculated as: Coefficient of variation = Standard deviation / Mean. Leaf area (LA), leaf length (LL), leaf width (LW), and aspect ratio (L / W) of the lower and middle leaves of alfalfa were used as phenotypic data. Figure 1 As shown, phenotypic data related to leaf size at the base and middle parts exhibited wide variation, with coefficients of variation ranging from 18.50% (M-LL) to 41.70% (B-LA). The normal distribution plot further illustrates that leaf size is a quantitative trait controlled by multiple genes. Pearson correlation analysis showed that LL and LW were positively correlated with LA at the same growth site, but negatively correlated with length-to-width ratio. Furthermore, the correlation coefficients for LL, LW, and LA were high at different growth sites. The broadly heritable capacity of LL (77.12%), LW (79.92%), LA (78.00%), and L / W (60.37%) was high, indicating that environmental factors had some influence on the observed phenotypic variation, but genetic factors played a major role.

[0021] 2. Genome-wide association analysis Phenotypic and genotypic data from the aforementioned relevant populations were used for GWAS. GWAS analysis was performed on the eight leaf-related traits measured in this study. The significance threshold was set as the logarithm of a LOD score ≥ 6. Figure 2 Manhattan plots show the genome-wide GWAS results and assess the distribution of expected and observed p-values. Identification of candidate genes in the *Alfalfa* 'Zhongmu-1' genome. A total of 262 SNPs (LOD≥5) significantly associated with leaf size development were identified. 50 SNPs were identified in the two loci (LA), 34 in the LL, 36 in the LW, and 141 in the L / W. 21 SNPs appeared twice. Further screening of recurring SNP sites revealed two SNP sites with high LOD values: Chr2_67669404 and Chr8_15891074. Chr2_67669404 was co-located in the LA and LW loci of the lower leaves, with LOD values ​​of 7.62 and 7.09, respectively, and contained multiple significant SNP variations on its flanks. Chr8_15891074 is not only co-located in the LA and LW of the middle blade, but also in LL (LOD=4.79).

[0022] 3. Observation of leaf phenotypes at different developmental stages The shape and size of leaves vary at different developmental stages. Based on the different developmental stages of leaves, the leaf area and lower epidermal cell count of alfalfa at different developmental stages were observed and measured. Figure 3 A), L0 represents leaves that are not fully expanded, and according to leaf position, they are designated L1, L2, and L3. The leaf area differs significantly between the L0 stage and the L1-L3 stages. Figure 3 B). Microscopic observation of the lower epidermal cells of the leaves showed results consistent with the leaf area analysis: the cell area was smallest at stage L0, and significantly different from that at stages L1-L3. Figure 3 C). Calculations of the number of lower epidermal cells in leaves based on leaf area and individual cell area showed that the number of cells varied slightly at different developmental stages. Figure 3 D).

[0023] 4. Real-time fluorescence quantification To validate gene expression patterns observed in RNA-seq analysis, qRT-PCR was performed using total RNA from all RNA-seq samples. Nine candidate genes were selected for qRT-PCR detection, with MtACTIN as an internal control. The qRT-PCR method was performed using the Novizan ChamQ SYBR Color qPCR Master Mix, with each reaction performed in triplicate. All primers were designed using Primer 5.0 software. Results are shown below. Figure 4 As shown, most genes are consistent with transcriptome expression, with significant differences between large and small leaves. The expression levels of MsG0280010299.01, MsG0280010312.01, and MsG0880042855.01 gradually increase during leaf development, showing significant differences between large and small leaves. The expression levels of MsG0280010299.01, MsG0880042920.01, MsG0880042940.01, and MsG0880042966.01 are high in the early leaf development stage. MsG0280010299.01, MsG0880042855.01, MsG0880042920.01, and MsG0880042940.01 are negatively correlated with leaf size.

[0024] Table 1 Candidate genes regulating leaf size

[0025] The upstream quantitative primer for the MsGWAS1 gene, MsGWAS1-qF, is 5'-CCCTCATGGCAAACAAGCT-3', denoted as SEQ ID NO.7; The downstream quantitative primer for the MsGWAS1 gene, MsGWAS1-qR, is 5'-GAAGTTCCAAATCGGTCAA-3', denoted as SEQ ID NO.8; The upstream quantitative primer for the MsGWAS2 gene, MsGWAS2-qF, is 5'-CACTCCCATTCCCACTTC-3', denoted as SEQ ID NO.9; The downstream quantitative primer for the MsGWAS2 gene, MsGWAS2-qR, is 5'-TCATTCCACCTTTCTTTACAC-3', denoted as SEQ ID NO.10; The upstream quantitative primer for the MsGWAS3 gene, MsGWAS3-qF, is 5'-GCCAGATGTCCTCATAGATG-3', denoted as SEQ ID NO.11; The downstream quantitative primer for the MsGWAS3 gene, MsGWAS3-qR, is 5'-GACCAAAGTCTTCCCACAAT-3', denoted as SEQ ID NO.12; The upstream quantitative primer for the MsGWAS4 gene, MsGWAS4-qF, is 5'-TCAGCCTGAGGTTCCTACA-3', denoted as SEQ ID NO.13; The downstream quantitative primer for the MsGWAS4 gene, MsGWAS4-qR, is 5'-TTCTTCTCTCCCTTCATCCA-3', denoted as SEQ ID NO.14; The upstream quantitative primer for the MsGWAS5 gene, MsGWAS5-qF, is 5'-ATCAGCAGCAGCAGCAGCAA-3', denoted as SEQ ID NO.15; The downstream quantitative primer for the MsGWAS5 gene, MsGWAS5-qR, is 5'-CACCACCACGCCCGTCATT-3', denoted as SEQ ID NO.16; The upstream quantitative primer for the MsGWAS6 gene, MsGWAS6-qF, is 5'-TCACCACAAACCCTAACCC-3', denoted as SEQ ID NO.17; The downstream quantitative primer for the MsGWAS6 gene, MsGWAS6-qR, is 5'-TTGGAAATAGCCTTCACCC-3', denoted as SEQ ID NO.18; The upstream quantitative primer for the MsGWAS7 gene, MsGWAS7-qF, is 5'-CTTCGAGGAATCTCCTGTCG-3', denoted as SEQ ID NO.19; The downstream quantitative primer for the MsGWAS7 gene, MsGWAS7-qR, is 5'-CTGCCCAATCTCAAGTCCC-3', denoted as SEQ ID NO.20; The upstream quantitative primer for the MsGWAS8 gene, MsGWAS8-qF, is 5'-ATTGCAGCCAAGACAAGTT-3', denoted as SEQ ID NO.21; The downstream quantitative primer for the MsGWAS8 gene, MsGWAS8-qR, is 5'-TCACCTCAGCCTCACATT-3', denoted as SEQ ID NO.22; The upstream quantitative primer for the MsGWAS9 gene, MsGWAS9-qF, is 5'-CAAGATGGCGACAGATAAGC-3', denoted as SEQ ID NO.23; The downstream quantitative primer for the MsGWAS9 gene, MsGWAS9-qR, is 5'-AAGTTCAGCAGCAGTAGTTCC-3', denoted as SEQ ID NO.24; The upstream quantitative primer for the internal reference gene, MtUBC Q-qF: 5'-CTGACAGCCCACTGAATTGTGA-3', is designated as SEQ ID NO.25; The downstream quantitative primer for the internal reference gene, MtUBC Q-qR: 5'-TTTTTGGCATTGCTGCAAGC-3', is designated as SEQ ID NO.26.

[0026] Example 2 Cloning of MsGWAS1 gene CDS and construction of overexpression vector 1. Extraction of RNA from alfalfa and synthesis of cDNA This invention uses cultivated alfalfa as the plant material. Alfalfa seeds are placed in a petri dish containing H2O, and then placed in a germination bag. After 7 days, the germinated seedlings are transferred to a 1 / 2 Hoagland nutrient solution for further growth, with the nutrient solution changed every 3 days. The plants are placed in an artificial climate incubator with 16 hours of light, 8 hours of darkness, a day / night temperature of 22°C, and a relative humidity of 65%. After the material has grown uniformly, it is used for experimental treatment, with alfalfa seedlings at a light intensity of 65% and a light intensity of 150 μmol / m². -1 s -1After the materials grew uniformly, they were used for experimental treatment. Mature leaves of alfalfa were taken, and total RNA was extracted using a plant RNA extraction kit. Using the RNA as a template, cDNA was reverse transcribed into cDNA using Novizan HiScriptIII RT SuperMix for qRT-PCR (+gDNA wiper) for subsequent gene cloning. The plant RNA extraction kit was purchased from TakaraBio. Hogland nutrient solution was purchased from Hogland Biosciences.

[0027] 2. Design primers for amplifying the MsGWAS1 gene Based on the cDNA sequence of the MsGWAS1 gene from the "Zhongmu No. 1" alfalfa variety whose genome has been published, Beijing Qingke Biotechnology Co., Ltd. synthesized and designed primers to amplify MsGWAS1 of alfalfa.

[0028] The upstream primer for amplifying MsGWAS1, MsGWAS1-F: 5'-CCCTCATGGCAAACAAGCT-3', is designated as SEQ ID NO.1; The upstream primer for amplifying MsGWAS1, MsGWAS1-R: 5'- GAAGTTCCAAATCGGTCAA -3', is designated as SEQ ID NO.2; The coding region of MsGWAS1 is obtained by amplification, and the coding region is abbreviated as CDS.

[0029] The obtained cDNA and primers for amplifying the MsGWAS1 gene were used to amplify the target gene using Novizan Fast Pure Ge1DNA Extraction and Novizan 2×Phanta Max Master Mix (Dye Plus): The total volume of the PCR reaction system was 50 μL: 25 μL of 2×Phanta Max Master Mix, 2 μL of upstream primer (10 μmol·L), 2 μL of downstream primer (10 μmol·L), 2 μL of first-strand cDNA for reverse transcription, and ddH2O to make up to 50 μL; PCR reaction program: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 15 s, 72℃ for 2 min, 34 cycles; 72℃ for 5 min; amplification products were detected by agarose gel electrophoresis at a mass fraction of 1.2%. The obtained PCR products were processed using FastPure. ® The Gel DNA Extraction Mini Kit was used to recover and purify MsGWAS1 CDS.

[0030] The nucleotide sequence of MsGWAS1 is: ATGGCTTCACAAAATACTCAAGTTCAATTTCAAGACTCATTACCCCTCATGGCAAACAAGCTTGGTGGGGATGGATTAATAGATGAATTATGCAATGGTTTCAATCTCTTGATGGATTCTACTAAAGGTGTCATCACTTTTGAAAGCCTTAAGAAGAATTCAGCTTTGCTTGGGTTACAAGATTTGACCGATTTGGAACTTCAATCCATGATTGTTGAAGGTGATTTTGATGGTGATGGTGCTCTTAATCAAATGGAGTTTTGTGTTTTGATGTTTAGACTTAGTCCTGAACTTATGGATGGGTCTAAGATGTGCAAGGGCAAAAGTGGAATAAAATACAATAAGCTTGGTGGGGATGGATTAATAGATGAATTATGCAATGGTTTCAATCTTTTGATGGATTCTACTAAAGGGGTTATTACCTTTGAAAGCCTTAAAAAGAATTCAGCTTTGCTTGGGTTACAAGATTTGACCGATGTGGAACTTCAATCCATGATTGTTGAAGGTGATTTTGATGGTGATGGTGCTCTTAATCAAATGGAGTTTTGTGTTTTGATGTTTAGACTTAGTCCTGAACTTATGGATGGGTCTAAGATGTGGTTGGAACAAATGCTTCAACAAGAAGTCCAAGATTCTTTCTAA, denoted as SEQ ID NO.3.

[0031] The amino acid sequence of MsGWAS1 is: MASQNTQVQFQDSLPLMANKLGGDGLIDELCNGFNLLMDSTKGVITFESLKKNSALLGLQDLTDLELQSMIVEGDFDGDGALNQMEFCVLMFRLSPELMDGSKMCKGKSGIKYNKLGGDGLIDELCNGFNLLMDSTKGVITFESLKKNSALLGLQDLTDVELQSMIVEGDFDGDGALNQMEFCVLMFRLSPELMDGSKMWLEQMLQQEVQDSF, denoted as SEQ ID NO.4.

[0032]

[0033] A plant overexpression vector for MsGWAS1 was constructed using homologous recombination technology. Based on the nucleotide sequence of MsGWAS1 obtained in Example 2, amplification primers with a BamHI single enzyme restriction site were designed. MsGWAS1 was used to construct an overexpression vector to amplify the upstream primer MsGWAS1-Fa: 5'-TACATTTACAATTACGGATCCATGGCTTCACAAAATACTCAAGTTCA-3', denoted as SEQ ID NO.5.

[0034] MsGWAS1 was constructed to overexpress the vector and amplify the downstream primer MsGWAS1-Ra: 5'-CTCGCCCTTGCCCATGGATCCGAAAGAATCTTGGACTTCTTGTTGAA-3', denoted as SEQ ID NO.6.

[0035] The full-length DNA fragment of MsGWAS1 was amplified by PCR using MsGWAS1-Fa and MsGWAS1-Ra. After amplification, the PCR product was recovered by gel extraction, and the recovered product was used as the insert fragment. The plant expression vector pFGC-eYFP was ligated using homologous recombinase. During ligation, the pFGC-eYFP expression vector was digested with the restriction endonuclease BamHI to form a linearized vector. The insert fragment and the linearized vector were ligated at a molar ratio of 1:2. The reaction system was as follows: 5 μL of 2xClonExpress Mix, 1 μL of insert fragment, 2 μL of linearized vector, and ddH2O to a final volume of 10 μL. The reaction was carried out at 50 °C for 5 min. After cooling on ice, the ligation product was obtained. The homologous recombinase used was the ClonExpress II One Step Cloning Kit, purchased from Nanjing Novizan Biotechnology Co., Ltd.

[0036] Transformation of *E. coli* DH5α competent cells: The ligation product was added to 100 μL of DH5α competent cells and placed on ice for 30 min; after heat shock at 42°C for 45 s, the cells were placed on ice for another 2 min; the heat-shocked cells were added to 0.9 mL of LB medium and cultured on a 37°C incubator with shaking at 200 rpm for 1 h. After centrifugation at 5000 rpm for 5 min, 900 μL of the supernatant was discarded, leaving 100 μL of resuspended bacterial culture, which was then spread onto LB solid medium and incubated upside down at 37°C for 12 h. It should be noted that similar results can be achieved by shaking at 200-250 rpm on a 37°C incubator with shaking and incubation upside down for 12-16 h at 37°C. The LB solid culture medium contained kanamycin. The kanamycin used in this invention was purchased from Phyto Technology, and Escherichia coli DH5α was purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0037] Screening, purification, and sequencing of the overexpression vector 35S:MsGWAS1: Single colonies containing the ligation product were picked and subjected to PCR detection. Gel electrophoresis showed a single band at approximately 885 bp, indicating the presence of the MsGWAS1 gene in the recombinant vector. Positive clones were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The results showed that the inserted fragment sequence was completely identical to the MsGWAS1 coding region, and the restriction enzyme sites were also correct, thus confirming the successful construction of the overexpression vector, which was named 35S:MsGWAS1.

[0038] Example 4: Screening and Phenotypic Observation of Arabidopsis thaliana Overexpression Arabidopsis thaliana was infected using the pollen inoculation method. The Arabidopsis thaliana was of the Colombian wild type. 10 mL of LB solution was placed in a 50 mL centrifuge tube, kanamycin was added, and then Agrobacterium GV3101 overexpressed with the 35S:MsGWAS1 vector was introduced. The mixture was incubated overnight at 28°C. The overnight culture was then transferred to a conical flask containing 200 mL of LB solution containing antibiotics and incubated at 28°C until OD500 reached. 600 =1.2. The Agrobacterium GV3101 used in this invention was purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0039] Centrifuge at 8000×g for 8 min, then resuspend in 5% sucrose solution to OD. 600 =0.8, with 0.03% Silwet L-77 added by volume. The Silwet L-77 used in this invention was purchased from Beijing Coolplay Technology Co., Ltd.

[0040] Four-week-old flowering Arabidopsis thaliana buds were placed in a resuspension solution for 30 seconds, kept in darkness for 24 hours, and then grown under light until the seeds matured. The harvested seeds were then inoculated with pollen using the pollen-infection method and spread on MS medium containing PPT. Plants that grew normally were considered successfully infected, while wild-type plants turned yellow and wilted. Functional verification was performed on the phenotyped T1 generation lines, and the qRT-PCR results are shown below. Figure 5 As shown, the expression levels in all three overexpression lines were significantly higher than those in the wild-type (WT). Figure 6 The three transgenic Arabidopsis lines shown (GWAS1-1, GWAS1-5, GWAS1-9) grew for 1 week ( Figure 6 A) and growth for 3 weeks ( Figure 6In step B), three replicates of each overexpression line (GWAS1-1, GWAS1-5, GWAS1-9) were compared with the wild-type in the first row as a control. The leaves were significantly larger than the wild-type, and the number of leaves increased. MS medium containing PPT was purchased from Huasai Biotechnology Co., Ltd.

[0041] It should be noted that the specific embodiments are merely representative examples of the present invention, and the technical solution of the present invention is obviously not limited to the above embodiments, and there can be many variations. Those skilled in the art who obtain the present invention based on its explicit disclosure or without objection from the written description should consider it to be within the scope of protection of this patent.

Claims

1. A MsGWAS1 encoding gene, characterized in that, The nucleotide sequence of the MsGWAS1 encoding gene is shown in SEQ ID NO.

3.

2. The application of the MsGWAS1 encoding gene as described in claim 1 in promoting leaf development, characterized in that, The nucleotide sequence of the MsGWAS1 encoding gene is shown in SEQ ID NO.

3.

3. The application according to claim 2, characterized in that, Leaf development is characterized by an increase in plant leaf area.

4. The application according to claim 2, characterized in that, The leaf development is characterized by an increase in the number of plant leaves.

5. The application according to claim 2 or 3, characterized in that, The expression vector is pFGC-eYFP, and the nucleotide sequence of pFGC-eYFP is shown in SEQ ID NO.

27.

6. The application according to claim 5, characterized in that, The method for overexpressing the MsGWAS1 gene includes the following steps: The cDNA of plant leaves containing the MsGWAS1 encoding gene was used as a template for PCR amplification. The amplification product was ligated into the expression vector pFGC-eYFP to obtain an overexpression vector; the overexpression vector was transformed into Agrobacterium to upregulate the expression level of the MsGWAS1 gene.

7. The application according to claim 5, characterized in that, The pFGC-eYFP expression vector was digested with the restriction endonuclease BamHI, and the amplification product and expression vector were ligated at a molar ratio of 1:

2.

8. The application according to any one of claims 2-7, characterized in that, The plant in question is either alfalfa or Arabidopsis thaliana.

9. A method for promoting plant leaf development, characterized in that, Transgenic plants were obtained by overexpressing the MsGWAS1 encoding gene as described in claim 1 to enhance the promotion of plant leaf development.

10. A method for promoting plant leaf development according to claim 9, characterized in that, The leaf development refers to an increase in the leaf area or an increase in the number of leaves in a plant.

Images