Circular RNA (Ribonucleic Acid) expression framework as well as application and method thereof

By introducing upstream and downstream expression frameworks into the circular RNA expression vector, the problems of large vector size, unstable expression, and scar sequences in existing technologies are solved, achieving efficient, stable, and accurate expression of circular RNA.

CN120989112APending Publication Date: 2025-11-21KUNMING INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511135888.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-14
Publication Date
2025-11-21

AI Technical Summary

Technical Problem

Existing circular RNA expression vectors suffer from problems such as large vector size, unstable expression efficiency, dependence on spliceosome mechanisms affecting normal splicing, and the generation of scar sequences.

Method used

A circular RNA expression framework is provided, comprising upstream and downstream expression frameworks, which are constructed on an expression vector using restriction endonucleases to achieve efficient and stable expression of circular RNA, independent of the spliceosome mechanism and without scar sequences.

Benefits of technology

This approach achieves efficient expression of circular RNA, avoids vector size and scar sequence issues, reduces the impact on splicing of other genes in cells, and improves the accuracy and feasibility of experimental results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120989112A_ABST
    Figure CN120989112A_ABST
Patent Text Reader

Abstract

The invention provides a circular RNA (Ribonucleic Acid) expression framework as well as application and a method thereof, the expression framework comprises an upstream expression framework and a downstream expression framework, the upstream expression framework comprises a sequence Motif 1 and a complementary sequence thereof, or Motif 2 and a complementary sequence thereof; the downstream expression framework comprises a sequence Motif 3 and a complementary sequence thereof; the Motif 1 is HKDNNWHDHNHNDHNHNHNDHWNWWHDHAB, and the Motif 1 is The Motif 2 is NYBYTMYWTYBYHHVIAG, and the Motif 2 is The Motif 3 is DDKDKHH, and the Motif 3 is Wherein H is A or C or T, K is G or T, D is A or G or T, N is A or C or G or T, W is A or T, B is C or G or T, Y is C or T, M is A or C, and V is A or C or G; the circular RNA established by the circular RNA expression framework provided by the invention is higher in expression efficiency, can be accurately cyclized without generating a'scar sequence ', is low in immunogenicity, can realize the expression of circular RNA with various lengths, can construct a cell strain for stably expressing the target circular RNA, and provides a more advantageous tool for fundamental research and vaccine development of the circular RNA.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a circular RNA expression framework and its applications and methods, belonging to the field of biotechnology. Background Technology

[0002] Circular RNA (circRNA) is a class of covalently closed single-stranded RNA molecules. In recent years, an increasing number of studies have shown that circular RNAs are widely involved in vital activities such as embryonic development, spermatogenesis, neural differentiation and brain development, immune responses, and tumorigenesis.

[0003] Existing circular RNA expression vectors contain the target circular sequence and specific flanking sequences. The existing methods for constructing circular RNA are as follows.

[0004] The first method for constructing circular RNA involves extracting 1-2 kb flanking sequences upstream and downstream of an endogenous target circular sequence from the genome to achieve expression of the specific circular RNA. The advantage of this method is that it can usually achieve the expression of endogenously present target circular RNAs. However, this method has significant drawbacks: 1) the long sequence to be amplified results in a large vector that is difficult to transfect into cells; and 2) it introduces some uncertainties in the sequence, leading to inconsistent expression efficiency; 3) for artificially designed circular RNA sequences that do not exist in cells, this method cannot obtain the corresponding upstream and downstream sequences in the genome as flanking sequences.

[0005] The second method for constructing circular RNA involves adding cis-regulatory element sequences and trans-acting factor binding sequences, proven to mediate circular RNA production, to both sides of the multiple cloning site of the expression vector. Circular RNA is then generated via trans-splicing mediated by the intracellular spliceosome. This is a commonly used method in commercially available circular RNA overexpression vectors. Although this method can broadly express various endogenous or artificially designed circular RNAs, it can negatively impact linear RNA splicing because linear and circular RNAs share a common spliceosome mechanism. This can even significantly affect the normal splicing of other genes by the intracellular spliceosome, thus affecting the accuracy of experimental results and the feasibility of its applications.

[0006] The third method for constructing circular RNA involves inserting the target circular sequence into the sequence of the ribozyme Twister. Based on ribozyme self-cleavage and the intracellular RNA ligase Rtcb, this method enables intracellular expression of circular RNA, known as the Tornado system. This method does not rely on intracellular spliceosome mechanisms and can efficiently overexpress endogenous or artificially designed circular RNA. However, the resulting circular RNA contains residual ribozyme sequences, known as "scar sequences." These redundant sequences may alter the function of the circular RNA and potentially lead to stronger immunogenicity, causing damage to tissues and cells.

[0007] In summary, in the field of in vivo circular RNA expression vectors, there is an urgent need to develop a circular RNA expression framework that is short in sequence, accurately circularizes the target sequence (excluding "scar sequences"), has good universality, and is independent of intracellular spliceosome mechanisms. Summary of the Invention

[0008] This invention provides a circular RNA expression framework that is independent of intracellular spliceosome action, has stable and efficient expression, does not produce "scar sequences," and has a relatively short sequence. It can be constructed on any expression vector and used to circularize the target sequence into circular RNA in cells, or it can be used to synthesize circular RNA in vitro.

[0009] To achieve this objective, the present invention provides the following technical solution: In a first aspect, the present invention provides a circular RNA expression framework comprising an upstream expression framework and a downstream expression framework, wherein the upstream expression framework comprises a sequence Motif 1 and its complementary sequence, or a Motif 2 and its complementary sequence; and the downstream expression framework comprises a sequence Motif 3 and its complementary sequence. Motif 1 is: HKDNNWHDHNHNDHNHNHNDHWNWWHDHAB; Motif 2 is: NYBYTMYWTYBYHHVCAG; Motif 3 is: DDKDKHH; Where H is A, C, or T, K is G or T, D is A, G, or T, N is A, C, G, or T, W is A or T, B is C, G, or T, Y is C or T, M is A or C, and V is A, C, or G.

[0010] Preferably, the nucleotide sequence of the upstream expression framework includes: SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9, SEQ ID NO.11, SEQ ID NO.13, SEQ ID NO.15, SEQ ID NO.17, SEQ ID NO.19, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.33, SEQ ID NO.41, SEQ ID NO.42 and SEQ ID NO.43.

[0011] Preferably, the nucleotide sequence of the downstream expression framework includes: SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8, SEQ ID NO.10, SEQ ID NO.12, SEQ ID NO.14, SEQ ID NO.16, SEQ ID NO.18, SEQ ID NO.20, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.34, SEQ ID NO.35, SEQ ID NO.36, SEQ ID NO.37, SEQ ID NO.38, SEQ ID NO.39 and SEQ ID NO.40.

[0012] In this invention, the nucleotide sequence of SEQ ID NO.1-43 is as follows: SEQ ID NO.1: CTTCAAATCTCTGTTTTTCTCTTTTATTTAG SEQ ID NO.2: GTGAGAAGAATTGCTTCATGGTTAATGTGTTTAATCTGTC SEQ ID NO.3: cttactcatgcagcgttatttctcacacag SEQ ID NO.4: gtatgttgcctgctacagagtgaagtggtttccaatcgca SEQ ID NO.5: atggttttcttgtaaatctttttttcttag SEQ ID NO.6:gtgagttattattttgatacctaatgtttataatagaatg SEQ ID NO.7:ttaacattatacaacaatcttttttcag SEQ ID NO.8:gtaatttagaaataggtttgggttacatgaaagctttatt SEQ ID NO.9:tttatactataatgtgtgtttttttaaag SEQ ID NO.10:gtaagtgttctgtttttgccagagatgagttttaaatgtt SEQ ID NO.11:aggaaaaccctccctttccttttgcccacag SEQ ID NO.12:gtaacactttccttggtcatattaatattgaattatacca SEQ ID NO.13:taatgccatgtgatcctctattctttgcag SEQ ID NO.14:gtaagtgtttccagatcttaacacagacacactcttag SEQ ID NO.15:aggactgttttttctctctctccaccag SEQ ID NO.16:gtgagtttatagattgcgtataataaccctctttcctacta SEQ ID NO.17:AGATTAAGCCATGCATGTCTAAGTACGCAC SEQ ID NO.18:CTCCCTCCCGGCTCCGGCCGGGGGTCGGGCGCCGGCGGCT SEQ ID NO.19:cctaaatgtaattaattctgcttattatag SEQ ID NO.20:gtgagttccccaagaaattagtgttttgatgcttacaggt SEQ ID NO.21:TTATATAAAGAAACTATTTTCTTAGAAG SEQ ID NO.22:TTAAATTAAAACAACCTCTAATTTGAAT SEQ ID NO.23:TTATGTAAATAAACATAAAAAATTTTCAT SEQ ID NO.24:ATTCTGATTTTCTCTCTCCTTCCCAACAG SEQ ID NO.25:CTAGAGTAAGTGGCTTTCCTTTGCCACCAG SEQ ID NO.26:AACAGCACTTCAGCTTTATTTTTCACCCAG SEQ ID NO.27:GTGGAAAGGAGCCAAAGTTGCATGAGTTATACTAGATAGG SEQ ID NO.28:GTCCATTTCCACCGGATCTGCGAGCTCCCGTGAGTTCTTT SEQ ID NO.29:GTGTGTTTTGTAAGATTTTATTTTACTTTTTATTTGTG SEQ ID NO.30:GTGGGTTACAAGGAAGGTTAAAGCATTTAAGAACCATCAT SEQ ID NO.31:GTTGCCTATGAGTTTCAGGATAGTTTTCACATTTTAAATTG SEQ ID NO.32:GTAGAATTAAGGGACTTCCACTTTCTTAATTAATGGGTT SEQ ID NO.33:CAGCCCCCCTTTCTTTTTTTTGACACGTTCCTTTTTAAAAAAAAAATTAATTTGTTTTATGTATATGACTGTAGCTGTCTTCAGACACTCCAGAAGGGCATCAGATCATCAGATGGTTGTGAGCCACCATGTGG TTGATGGGATTGGAACTCAGGATCTCTGGAAGAGTAGTAGATGCTCTTAACCATTGAGCCATCTCTCCAGCCCCTTAGCCCCATTTCTAACCCCTTGCACATAGCTTAAAAGTAAAAGCAACCTTCAAATCTCTGTTTTTCTCTTTATTTAG SEQ ID NO. 34: GTGAGAAGAATTGCTTCATGGTTAATGTGTTTAATCTGTCAAACACCTTAAAATAATGTGGTTAAAATACTGAATGGTCAGGGGCTAGAGAGATGGCTCAGCAGTTAAGAGCACTAACTGCTCTTCCAGAGATCTTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAAGCATCTGTAATGGGATCTGATGCCTTCTTCTGAAGACAGCGACAGTGTACTCATATACATAAAATAAATAAAATAAATCTTTTAAAAAGATACTGAATGGTCAGGTTAAGGATTTTATACACCACCTC SEQ ID NO. 35: GTGAGAAGAATTGCTTCATGGTTAATGTGTTTAATCTGTCAAACACCTTAAAATAATGTGGTTAAAATACTGAATGGTCAGATACTGAATGGTCAGGTTAAGGATTTTATACACCACCTC SEQ ID NO. 36: GTGAGAAGAATTGCTTCATGGTTAATGTGT SEQ ID NO.37:GTGAGAAGAATTGCTTCATG SEQ ID NO. 38: GTGAGAAGAA SEQ ID NO. 39: TTGCTTCATGGTTAATGTGTTTAATCTGTCAAACACCTTAAAATAATGTGGTTAAAATACTGAATGGTCAGGGGCTAGAGAGATGGCTCAGCAGTTAAGAGCACTAACTGCTCTTCCAGAGATCTTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAAGCATCTGTAATGGGATCTGATGCCTTCTTCTGAAGACAGCGACAGTGTACTCATATACATAAAATAAATAAATAAATCTTTTAAAAAGATACTGAATGGTCAGGTTAAGGATTTTATACACCACCTC SEQ ID NO. 40: GTGAGGGACATTGCTTCATGGTTAATGTGTTTAATCTGTCAAACACCTTAAAATAATGTGGTTAAAATACTGAATGGTCAGGGGCTAGAGAGATGGCTCAGCAGTTAAGAGCACTAACTGCTCTTCCAGAGATCTTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAAGCATCTGTAATGGGATCTGATGCCTTCTTCTGAAGACAGCGACAGTGTACTCATATACATAAAATAAATAAATAAATCTTTTAAAAAGATACTGAATGGTCAGGTTAAGGATTTTATACACCACCTC SEQ ID NO. 41: AAAAAATTAGTAATTTGTTTTATGTATATGAATACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGCATCAGATCTCATTACAGATGGTTGTGAGCCACCATGTGGTTGATGGGATTGGAACTCAGGATTCTCTGGAAGAGTAGTAGATGCTCTTAACCATTGAGCCATCTCTCCAGCCCCTTAGCCCCATTTCTAACCCCTTGCACATAGCTTAAAAAGTAAAAAGCAACCTTCAAATCTCTGTTTTTCTCTTTATTTAG SEQ ID NO. 42: TTAGCCCCATTTCTAACCCCTTGCACATAGCTTAAAAAGTAAAAAGCAACCTTCAAATCTCTGTTTTTCTCTTTATTTAG SEQ ID NO.43:AAAAAGCAACCTTCAAATCTCTGTTTTTCTCTTTATTTAG。

[0013] Preferably, the circular RNA expression framework comprises: FS1: the nucleotide sequence of the upstream expression framework is SEQ ID NO.1, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.2; FS2: the nucleotide sequence of the upstream expression framework is SEQ ID NO.3, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.4; FS3: the nucleotide sequence of the upstream expression framework is SEQ ID NO.5, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.6; FS4: the nucleotide sequence of the upstream expression framework is SEQ ID NO.7, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.8; FS5: the nucleotide sequence of the upstream expression framework is SEQ ID NO.9, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.10; FS6: the nucleotide sequence of the upstream expression framework is SEQ ID NO.11, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.12; FS7: the nucleotide sequence of the upstream expression framework is SEQ ID NO.13, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.14; FS8: the nucleotide sequence of the upstream expression framework is SEQ ID NO.15, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.16. NO.16; FS9: The nucleotide sequence of the upstream expression framework is SEQ ID NO.17, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.18; FS10: The nucleotide sequence of the upstream expression framework is SEQ ID NO.19, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.20; FS11: The nucleotide sequence of the upstream expression framework is SEQ ID NO.21, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.27; FS12: The nucleotide sequence of the upstream expression framework is SEQ ID NO.24, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.28; FS13: The nucleotide sequence of the upstream expression framework is SEQ ID NO.22, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.29; FS14: The nucleotide sequence of the upstream expression framework is SEQ ID NO.25, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.30; FS15: The nucleotide sequence of the upstream expression framework is SEQ ID NO.23, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.31; FS16: The nucleotide sequence of the upstream expression framework is SEQ ID NO. NO.26: The nucleotide sequence of the downstream expression framework is SEQ ID NO.32; FS17: The nucleotide sequence of the upstream expression framework is SEQ ID NO.33, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.34; FS18: The nucleotide sequence of the upstream expression framework is SEQ ID NO.33: The nucleotide sequence of the downstream expression framework is SEQ ID NO. 35; FS19: The nucleotide sequence of the upstream expression framework is SEQ ID NO. 33, and the nucleotide sequence of the downstream expression framework is SEQ ID NO. 2; FS20: The nucleotide sequence of the upstream expression framework is SEQ ID NO. 33, and the nucleotide sequence of the downstream expression framework is SEQ ID NO. 36; FS21: The nucleotide sequence of the upstream expression framework is SEQ ID NO. 33, and the nucleotide sequence of the downstream expression framework is SEQ ID NO. 37; FS22: The nucleotide sequence of the upstream expression framework is SEQ ID NO. 33, and the nucleotide sequence of the downstream expression framework is SEQ ID NO. 38; FS23: The nucleotide sequence of the upstream expression framework is SEQ ID NO. 33, and the nucleotide sequence of the downstream expression framework is SEQ ID NO. 39; FS24: The nucleotide sequence of the upstream expression framework is SEQ ID NO. 33, and the nucleotide sequence of the downstream expression framework is SEQ ID NO. 40; FS25: The nucleotide sequence of the upstream expression framework is SEQ ID NO. 41, and the nucleotide sequence of the downstream expression framework is SEQ ID NO. 40. NO.2; FS26: The nucleotide sequence of the upstream expression frame is SEQ ID NO.42, and the nucleotide sequence of the downstream expression frame is SEQ ID NO.2; FS27: The nucleotide sequence of the upstream expression frame is SEQ ID NO.43, and the nucleotide sequence of the downstream expression frame is SEQ ID NO.2.

[0014] A second aspect of the present invention provides the application of the circular RNA expression framework described herein in the preparation of expression vectors.

[0015] Preferably, the expression vector further includes a vector framework, the vector backbone comprising: pcDNA3.1-CMV-MCS, pCDH-CMV-MCS-EF1-puroR, and pEGFP-C1.

[0016] A third aspect of the present invention provides a method for constructing a circular RNA expression vector, comprising the following steps: S1. Synthesize the upstream expression framework sequence, the downstream expression framework sequence, and the insertion sequence of the target circular sequence; S2. The inserted sequence and vector backbone sequence obtained in step S1 are digested with restriction endonuclease; the digested products are recovered; the digested products are ligated to obtain ligation products, wherein the ligation products include: the inserted sequence of the expression framework sequence and the target circular sequence, and the vector backbone sequence; S3. Transform the obtained ligation product into competent bacteria; S4. The transformed competent bacteria obtained in S3 were cultured and single-clone screening was performed on agar plates containing antibiotics corresponding to the resistance genes on the vector backbone to confirm the acquisition of the circular RNA expression vector. The upstream expression framework contains sequence Motif 1 and its complementary sequence, or Motif 2 and its complementary sequence; the downstream expression framework contains sequence Motif 3 and its complementary sequence. Motif 1 is: HKDNNWHDHNHNDHNHNHNDHWNWWHDHAB; Motif 2 is: NYBYTMYWTYBYHHVCAG; Motif 3 is: DDKDKHH; Where H is A, C, or T, K is G or T, D is A, G, or T, N is A, C, G, or T, W is A or T, B is C, G, or T, Y is C or T, M is A or C, and V is A, C, or G.

[0017] Preferably, the nucleotide sequences of the upstream expression framework include: SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9, SEQ ID NO.11, SEQ ID NO.13, SEQ ID NO.15, SEQ ID NO.17, SEQ ID NO.19, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.33, SEQ ID NO.41, SEQ ID NO.42, and SEQ ID NO.43; the nucleotide sequences of the downstream expression framework include: SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8, SEQ ID NO.10, SEQ ID NO.12, SEQ ID NO.14, SEQ ID NO.16, SEQ ID NO.18, SEQ ID NO.20, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, and SEQ ID NO.43. NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.34, SEQ ID NO.35, SEQ ID NO.36, SEQ ID NO.37, SEQ ID NO.38, SEQ ID NO.39 and SEQ ID NO.40.

[0018] Preferably, the vector backbone comprises: pcDNA3.1-CMV-MCS, pCDH-CMV-MCS-EF1-puroR, and pEGFP-C1.

[0019] A fourth aspect of the present invention provides a method for synthesizing circular RNA in vitro, comprising the following steps: R1. Linearize the expression vector consisting of the vector backbone, expression framework and target circular sequence to obtain a linearized template; R2, RNA is obtained through in vitro transcription; R3. After performing a self-cleaving reaction on the RNA obtained in step R2, the self-cleaving product is subjected to urea denaturing PAGE gel electrophoresis. R4. Extract the band corresponding to the target sequence, crush it in a centrifuge tube, and then recover the RNA. R5. After obtaining the recovered RNA, incubate the RNA with Rtcb. R6. The incubation product is reverse transcribed to obtain circular target RNA.

[0020] Compared with the prior art, the beneficial effects and significant progress of applying the technical solution of the present invention are as follows: (1) The circular RNA expression framework sequence provided by this invention is relatively short. The upstream expression framework contains only 30 bp for Motif 1 and only 18 bp for Motif 2, and the downstream expression framework contains only 7 bp for Motif 3. Even if the expression framework sequences are different, as long as the corresponding motif sequence is included, the target sequence can be circularized. In addition, the expression framework sequence can be constructed on various vector backbones using restriction endonucleases, which facilitates vector construction and cell transfection. (2) The circular RNA expression framework sequence provided by the present invention has a better expression effect than the existing circular RNA expression vector pLO5. Compared with the circular RNA expression system Tornado, the expression framework sequence of the present invention will not form a "scar sequence" when it mediates the circularization of the target sequence. (3) The circular RNA expression framework sequence provided by the present invention mediates the formation of circular RNA independently of the spliceosome mechanism in the cell, so it will not affect the splicing of other genes in the cell. In actual scientific research applications, it can avoid false positive experimental results caused by changes in the splicing level of other unknown genes. (4) In terms of in vitro synthesis of circular RNA, the circular RNA provided by the present invention based on expression framework sequence self-splicing and Rtcb ligation has precise circularization sites and no “scar sequence” from self-splicing introns is retained in the circular RNA product. Attached Figure Description

[0021] To more clearly illustrate the technical solution of the present invention, the accompanying drawings used in the embodiments of the present invention will be briefly described below.

[0022] Figure 1 The map shows the backbones of the three vectors in this invention: pEGFP-C1, pCDH-CMV-MCS-EF1-puroR, and pcDNA3.1-CMV-MCS. Figure 2 Figure 1 shows the detection results of the FS1 expression framework mediating the circularization of multiple target sequences in Example 1 of this invention (wherein, Figure A is a schematic diagram of the FS1 expression framework with different target sequences inserted; Figure B is the detection result of the circular RNA expression level after transiently transfecting HEK-293T cell line with the FS1 expression framework and target sequences constructed on the pEGFP-C1 vector backbone; Figure C is the detection result of the circular RNA expression level after establishing a stable cell line by infecting HCC1806 cell line with lentivirus with the FS1 expression framework and target sequences constructed on the pCDH-CMV-MCS-EF1-puroR vector backbone). Figure 3 The results of the detection show that the FS1 expression framework in Example 2 of this invention has better performance than existing circular RNA expression methods (where A is the detection result that the efficiency of the FS1 expression framework in mediating the circularization of the target sequence is higher than that of the commercial circular RNA expression vector pLO5-ciR; B is the first-generation sequencing result that the FS1 expression framework mediates the circularization of the target sequence without the generation of "scarred sequences"). Figure 4 The results of the detection of FS1 expression framework-mediated target sequence circularization independent of spliceosome action in Example 2 of the present invention are as follows: (wherein, A is the result of semi-quantitative PCR primers for four example mRNAs to detect the inhibitory effect of spliceosome inhibitors on splicing; B is the result of treatment of HEK-293T cells with the spliceosome inhibitor PlaB, showing that FS1 expression framework-mediated target sequence circularization is unaffected while the expression level of circular RNA formed by the commercial circular RNA expression vector pLO5 is significantly reduced; C is the result of treatment of HEK-293T cells with the spliceosome inhibitor Madrasin, showing that FS1 expression framework-mediated target sequence circularization is unaffected while the expression level of circular RNA formed by the commercial circular RNA expression vector pLO5 is significantly reduced). Figure 5 This is the result of detecting the expression level of intracellular innate immune factors after the FS1 expression framework-mediated circularization of the target sequence in Example 2 of the present invention; Figure 6The figures show the detection results of FS2 expression framework mediating the circularization of multiple target sequences in Examples 3 and 4 of this invention (where A is a schematic diagram of FS2 expression frameworks with different target sequences inserted; B is the detection result of circular RNA expression level after transiently transfecting HEK-293T cell lines with FS2 expression framework and target sequences constructed on the pEGFP-C1 vector backbone; C is the detection result that the expression level of circChd2 generated by FS2 expression framework is not affected after treating HEK-293T cell lines with spliceosome inhibitors PlaB and Madrasin). Figure 7 The results of screening genomic sequences containing Motif1-3 from multiple species in Example 5 of this invention to achieve circularization of the target sequence are shown in Figure 5. (Where A is a schematic diagram of inserting the target sequence Egfr between an upstream expression framework sequence containing Motif1 or Motif2 obtained from Arabidopsis thaliana, mice, and humans and a downstream expression framework sequence containing Motif3; B is the result of detecting the circEgfr expression level after transiently transfecting HEK-293T cells with the sequence in A constructed on the pEGFP-C1 vector backbone). Figure 8 The detection results of the target sequence Acc1 looping achieved by different length expression frames in Embodiment 6 of the present invention; Figure 9 The image shows the results of in vitro synthesis of circAcc1 based on the pcDNA3.1-FS1-Acc1 expression vector in Example 7 of the present invention (where A is the result of the FS1-Acc1 RNA transcribed in vitro undergoing self-cleavage to produce multiple bands under incubation with metal ions such as Mn2+; B is the result of Divergent PCR and Sanger sequencing of cDNA obtained by reverse transcription after incubation of the self-cleavage product with Rtcb). Detailed Implementation

[0023] The present invention will be further described below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading this invention, those skilled in the art can make various alterations and modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0024] The present invention will be further described in detail below with reference to specific embodiments.

[0025] In this invention, Actin is a common actin protein in cells, and due to its stable expression, it is often used as an internal reference gene or protein in molecular biology experiments. The inventors used it as an example target sequence to test whether the expression framework sequence could be concatenated end-to-end to form a circular RNA. In this invention, Egfr is the epidermal growth factor receptor gene, which has been extensively studied and is a star molecule in many research studies. The inventors used it as an example target sequence to test whether the expression framework sequence could be concatenated end-to-end to form a circular RNA. In this invention, Pan3 is a polyA-specific ribonuclease subunit, a circular RNA that has been reported to have biological functions. The inventors used it as an example target sequence to test whether the expression framework sequence could be joined end-to-end to form a circular RNA. In this invention, Fam228b1 is member B1 of sequence-similar family 228. Sequence-similar families are a class of genes with similar sequences that have been discovered so far; however, specific research on them is still relatively scarce, and the biological functions of this family and its specific members are unclear. The inventors used it as an example target sequence to test whether the expression framework sequence could be concatenated end-to-end to form a circular RNA. In this invention, Fam228b2 is member B2 of sequence-similar family 228. Similar to Fam228b1, the inventors used it as an example target sequence to test whether the expression framework sequence can be connected end to end to form a circular RNA. In this invention, Cdr1 (cerebellar degeneration-associated protein 1) is the first star circular RNA to be discovered and whose biological function has been elucidated. The inventors used it as an example target sequence to test whether the expression framework sequence can be connected end to end to form a circular RNA. In this invention, Chd2 is cadherin 2, which plays an important role in the extracellular matrix. The inventors used it as an example target sequence to test whether the expression framework sequence can be connected end to end to form a circular RNA. In this invention, pcDNA3.1-CMV-MCS is a commonly used eukaryotic expression vector in molecular biology, where pcDNA3.1 is the backbone name, CMV is the promoter, and MCS is the multiple cloning site. In this invention, pCDH-CMV-MCS-EF1-puroR is a commonly used eukaryotic expression vector in molecular biology, where pCDH is the backbone name, CMV and EF1 are promoters, MCS is the multiple cloning site, and puroR is the puromycin resistance gene. In this invention, pEGFP-C1 is a commonly used eukaryotic expression vector in molecular biology, and pEGFP-C1 is the name of the vector.

[0026] The methods for carrier construction and other processes in the embodiments of this invention are as follows.

[0027] I. Carrier Construction (1) Obtain the linearized sequence of the target circular RNA: Method ①: Total RNA was extracted from cell or tissue samples expressing the target circular RNA and subjected to reverse transcription PCR (according to the Novizan reverse transcription kit instructions). After obtaining cDNA, it was used as a template for PCR amplification to obtain the linearized sequence of the target circular RNA. The PCR system is as follows: The 5' end of the upstream primer used in PCR experiments contains an NheI restriction site and the upstream expression frame sequence of the expression framework; the 5' end of the downstream primer contains a BamH I restriction site and the reverse complementary sequence of the downstream expression frame sequence. It is important to note that the complete upstream and downstream PCR primers used to amplify the linearized sequence of the target circular RNA are determined by the sequence of the target circular RNA. For example, the complete sequences of the primers used for PCR amplification of the linearized sequences of circActin and circEgfr are different. Complete upstream and downstream primers should include 20-22 bp sequences from both ends of the linearized sequence of the target circular RNA.

[0028] The PCR conditions are as follows: Method ②: Directly synthesize a linearized sequence of the target circular RNA. The 5' end of the linearized sequence contains an NheI restriction site and an upstream expression frame sequence of the expression frame; the 3' end contains a downstream expression frame sequence of the expression frame and a BamH I restriction site.

[0029] (2) The sequences obtained by PCR or artificially synthesized by double digestion with Nhe I and BamH I in (1), and the pEGFP-C1 vector backbone sequence. The vector backbones involved in this invention include pcDNA3.1-CMV-MCS, pCDH-CMV-MCS-EF1-puroR, and pEGFP-C1 (see diagram). Figure 1 It should be noted that the expression framework sequence involved in this invention can be constructed on any eukaryotic expression vector backbone containing the restriction site using other restriction endonucleases, and is not limited to the vector backbone and restriction endonucleases used in this invention.

[0030] The double digestion conditions were 37℃ for 2 hours. The double digestion system was as follows: (3) Perform 1% agarose gel electrophoresis on the enzyme digestion products from (2) at 120 V for 40 min. According to the length of the expression framework sequence containing the enzyme digestion sites and the vector backbone map ( Figure 1 The band sizes shown indicate the size of the synthetic expression framework and vector backbone containing restriction enzyme sites. The gel recovery procedure was performed according to the instructions of the Tiangen Agarose Gel DNA Recovery Kit. (4) The DNA fragments recovered in (3) are ligated, including the expression framework containing restriction enzyme sites and the vector backbone. The ligation system is as follows: The connection conditions are as follows: (5) Transform the ligation product obtained in (4) into competent Escherichia coli. The transformation steps are as follows: ① Freeze-thaw 50 μL of competent Escherichia coli on ice; ② Add 10 μL of the ligation product to 50 μL of the frozen and thawed competent Escherichia coli; ③ Heat shock at 42℃ for 45 s, then place on ice for 2 min; ④ Spread evenly on agarose plates containing 100 μg / mL ampicillin, and incubate upside down in a 37℃ incubator overnight; (6) After overnight culture on agarose plates in (5) until single colonies grow, pick single colonies and culture them in LB medium with 100 μg / mL ampicillin for 12 h-16 h at 220 rpm and 37℃. (7) After the bacterial culture becomes turbid, perform plasmid extraction. Refer to the instructions of the Tiangen plasmid mini-extraction / intermediate extraction kit for specific steps. After obtaining the plasmid, which is the expression vector containing the expression framework and the target sequence, take 10 μL of the plasmid sample for first-generation sequencing (Shanghai Sangon Biotech) to confirm that the obtained expression vector sequence is correct.

[0031] II. Instantaneous transfection (1) Replace the cell culture supernatant with serum-free culture medium Opti-MEM in advance, which is about 80% confluence in the 6-well plate, to starve the cells. Divide the 1.5 mL centrifuge tube into plasmid tube A and transfection reagent tube B. The plasmids are pEGFP-expression framework-Actin, pEGFP-expression framework-Egfr and pEGFP-expression framework-Pan3 expression vectors. The transfection reagent is lipofectamine2000. (2) Add 4 μg of expression vector and 500 μL of Opti-MEM serum-free culture medium to plasmid tube A; add 8 μL of lipofectamine 2000 and 500 μL of Opti-MEM serum-free culture medium to transfection reagent tube B; (3) After letting plasmid tube A and transfection reagent tube B stand at room temperature for 5 min, mix them, let stand for another 20 min, and then add them to the cell culture supernatant; (4) After adding the AB mixture for 5 h, replace the cell culture supernatant with ordinary culture medium and continue cell culture. Collect the cells for subsequent experiments after 48 h.

[0032] The transfection system for each well in a 6-well plate is as follows: After collecting cells and performing RNA extraction and reverse transcription PCR to obtain cDNA, the inventors detected the expression levels of circActin, circEgfr, and circPan3 using RT-qPCR. The reaction system and conditions are as follows: The RT-qPCR reaction system is as follows: The RT-qPCR reaction conditions are as follows: III. Construction of stable cell lines (1) As described above, linearized target sequences of circFam228b1, circFam228b2 and circCdr1 containing restriction endonuclease sites and expression framework sequences are obtained by PCR amplification or artificial synthesis. (2) After obtaining the linearized sequence of the target circular RNA as described in (1), the pCDH-CMV-MCS-EF1-puroR vector backbone is used to perform the vector construction method as described above to obtain pCDH-expression framework-Fam228b1, pCDH-expression framework-Fam228b2 and pCDH-expression framework-Cdr1 expression vectors. (3) Use the expression vector obtained in (2) and the two lentiviral packaging vectors pMD2.G and pSPAx2 to package lentiviruses. The specific steps are as follows: ① Replace the culture medium of HEK-293T cells that have grown to about 80% confluence with serum-free DMEM-Basic medium to starve the cells. Prepare 1.5 mL centrifuge tubes labeled as plasmid tube A and transfection reagent tube B. ② Add 500 μL of Opti-MEM culture medium, 3.37 μg of pMD2.G plasmid, 6.20 μg of pSPAx2 plasmid, and 4.41 μg of pCDH-expression framework-circRNA expression vector to plasmid tube A; ③ Add 500 μL of Opti-MEM culture medium and 28 μL of PEI (linearized polyacetylimide) to transfection reagent tube B; ④ Let tubes A and B stand at room temperature for 5 min each. Then mix tube A with tube B and let stand at room temperature for 20 min. Add the mixture to the serum-free culture supernatant of starved HEK-293T cells. After 4-6 h, replace with HEK-293T culture medium containing 5% serum and continue culturing. ⑤ After adding the AB mixture to the cells for 48 h, collect the HEK-293T culture supernatant, filter it through a 0.45 μm filter and temporarily store it at 4℃. Then add fresh HEK-293T culture medium containing 5% serum and continue culturing. ⑥ After adding the AB mixture to the cells for 72 h, collect the HEK-293T culture supernatant again, filter it through a 0.45 μm filter, mix it with the filtrate collected at 48 h, aliquot it into 1 mL / tube and store it at -80℃ to obtain the lentivirus solution.

[0033] (4) Infect the target cells with the lentivirus solution obtained in (3). The specific steps are as follows: Taking HCC1806 as an example, digest the HCC1806 cells that have been passaged to the 3rd-5th generation and count the cells, and take 1×10 6 One cell line was seeded into a 10 cm cell culture dish, and 3 mL of the lentivirus solution collected in (3) was added. The total volume was then increased to 10 mL with cell culture medium. 20 μL of polybreen (final concentration of 2 μg / mL) was added for cell infection. After 24 h, the medium was changed to ordinary culture medium and cultured for another 24 h. It should be noted that the initial cell number and lentivirus solution volume selected for lentivirus infection are different for different cell lines. The specific cell number and amount of lentivirus solution used need to be determined through preliminary experiments. (5) 48 h after infecting the target cells, puromycin was used to screen the target cells to obtain a cell line stably expressing the target circular RNA. The specific steps are as follows: Taking HCC1806 as an example, a cell culture medium with a final puromycin concentration of 1 μg / mL was prepared. After 48 h of lentiviral infection of HCC1806, the medium was changed, and the HCC1806 cells were screened. After 3-5 passages, a stable HCC1806 cell line expressing the target circular RNA was obtained. It should be noted that the working concentration of puromycin needs to be determined through preliminary experiments for different cell lines.

[0034] Example 1: Construction of the FS1 expression framework including Motif1 and Motif3 The inventors obtained the FS1 expression framework sequence from the colostrum circular RNA sequencing results of female C57B / 6J strain mice. The FS1 expression framework sequence consists of the upstream expression framework sequence SEQ ID NO.1 and the downstream expression framework sequence SEQ ID NO.2.

[0035] To verify that the FS1 expression framework has a universal effect in mediating the circularization of target sequences, the inventors constructed circActin, circEgfr, and circPan3 expression vectors based on the FS1 expression framework and the pEGFP-C1 vector backbone. Figure 2 A).

[0036] Subsequently, the inventors transiently transfected these vectors (pEGFP-FS1-Actin, pEGFP-FS1-Egfr, and pEGFP-FS1-Pan3) into the HEK-293T cell line.

[0037] The results showed that all three circular RNA expression vectors significantly expressed circActin, circEgfr, and circPan3 compared to the control group (pEGFP-C1), indicating that the FS1 expression framework can broadly mediate the circularization of target sequences. Figure 2 B).

[0038] In addition, in order to construct a stable cell line based on lentivirus transfection, the inventors used the pCDH-CMV-MCS-EF1-puroR vector backbone and FS1 expression framework to construct a stable cell line.

[0039] After obtaining stable cell lines, cells were collected and RNA was extracted and cDNA was obtained by reverse transcription PCR. The inventors then used RT-qPCR to detect the expression levels of circFam228b1, circFam228b2, and circCdr1, with the reaction system and conditions described above.

[0040] The results showed that all three circular RNA expression vectors significantly expressed circFam228b1, circFam228b2, and circCdr1 compared to the control group (pCDH-CMV-MCS-EF1-puroR), indicating that vectors containing the FS1 expression framework can be used to establish stable cell lines. Figure 2 C).

[0041] Example 2: Validation of the effectiveness of the FS1 expression framework 1. Comparison experiment between the FS1 expression framework and the commercial circular RNA expression vector pLO5-ciR Based on this, the inventors used the commercially available circular RNA expression vector pLO5-ciR (purchased from Guangzhou Gise Biotechnology Co., Ltd.) to construct pLO5-Actin and pLO5-Pan3 expression vectors containing the target sequences Actin and Pan3 using the aforementioned circular RNA expression vector construction method. These vectors were then transfected into the HEK-293T cell line according to the aforementioned transient transfection steps. The expression effects of circActin and circPan3 were compared with those based on the FS1 expression framework using RT-qPCR. The results showed that the expression of circActin and circPan3 mediated by the FS1 expression framework was more significant. Figure 3 (A) This indicates that expression vectors containing the FS1 expression framework are superior to existing commercial circular RNA expression vectors, such as pLO5, in mediating circularization.

[0042] 2. Comparative Experiment between the FS1 Expression Framework and the Tornado Expression System Furthermore, the inventors also established Tornado expression systems for circActin, circEgfr, and circPan3 using the aforementioned vector construction method. After transient transfection into HEK-293T cells, cDNA was analyzed by PCR and Sanger sequencing (Shanghai Sangon Biotech) to determine the circularization site sequences of the three circular RNAs. The results showed that the circularization sites of the three circular RNAs expressed by the Tornado expression system contained "scar sequences," while the circularization sites of the three circular RNAs generated by the FS1 expression framework did not contain "scar sequences." Figure 3 (B) This result indicates that, compared to the Tornado expression system, circular RNA expression vectors containing the FS1 expression framework can achieve precise circularization of the target sequence.

[0043] 3. The FS1 expression framework mediates the production of circular RNA independently of intracellular spliceosomes. To demonstrate that the production of circular RNA mediated by the FS1 expression framework is independent of intracellular spliceosomes, the inventors first treated HEK-293T cells with the spliceosome inhibitor PlaB (final PlaB concentration 5 mM). The splicing levels of four functional genes (Brd2, Klf2, Atf3, and Dab2) were then detected by semi-quantitative PCR to demonstrate the inhibitory effect of the spliceosome inhibitor on the splicing response. Figure 4 A).

[0044] The semi-quantitative PCR reaction system is as follows: The semi-quantitative PCR reaction conditions are as follows: Subsequently, the inventors used the aforementioned vector construction method to establish a pEGFP-FS1-Acc1 vector containing the FS1 expression framework sequence and the target sequence Acc1. After transient transfection of the HEK-293T cell line (transient transfection steps and system were the same as before), PlaB was then applied. Figure 4 B) and treatment with another spliceosome inhibitor, Madrasin ( Figure 4C), the expression level of circAcc1 was detected by RT-qPCR (steps as before). The results showed that the expression of circAcc1 generated by the pEGFP-FS1-Acc1 vector was not affected by spliceosome inhibition. In contrast, the expression level of pLO5-Acc1 constructed based on the commercial circular RNA expression vector (purchased from Guangzhou Gise Biotechnology Co., Ltd., which relies on spliceosome circularization) pLO5-ciR was significantly reduced after treatment with spliceosome inhibitors on HEK-293T. Figure 4 (B and C). Therefore, the FS1 expression framework mediates looping independently of spliceosome action.

[0045] 4. Immunogenicity of the FS1 expression framework In addition, the inventors also used RT-qPCR (steps as described above) to detect the expression levels of cellular innate immune factors TNFα, IL6, RIG-I, and IFNβ in HeLa cells after transient transfection with circActin, circEgfr, and circPan3 expressed by the FS1 expression framework. The transient transfection steps were as described above. The results showed that transfection with the three circular RNA expression vectors did not activate intracellular innate immunity. Figure 5 Therefore, circular RNA expressed in the FS1 expression framework has low immunogenicity.

[0046] Example 3: Verification of the cyclization effect of the FS2 expression framework The inventors obtained the FS2 expression framework sequence from the colostrum circular RNA sequencing results of female C57B / 6J mice. The FS2 expression framework sequence consists of the upstream expression framework sequence SEQ ID NO.3 and the downstream expression framework sequence SEQ ID NO.4.

[0047] To verify that the FS2 expression framework also has the effect of universally mediating the circularization of target sequences, the inventors constructed circActin, circEgfr, and circPan3 expression vectors based on the FS2 expression framework and the pEGFP-C1 vector backbone. Figure 6 A), the carrier construction method is as described above.

[0048] Subsequently, the inventors transiently transfected these vectors into the HEK-293T cell line, following the transient transfection steps described above. After obtaining cDNA, the inventors detected the expression levels of circActin, circEgfr, and circPan3 using RT-qPCR, with the reaction system and conditions described above. The results showed that the circular RNA expression vector containing the FS2 expression framework could also achieve significant expression of the three circular RNAs. Figure 6 B) indicates that the FS2 expression framework can also mediate the circularization of the target sequence.

[0049] Example 4: FS2 expression framework mediates the production of circular RNA independent of intracellular spliceosomes To demonstrate that FS2 expression framework-mediated circularization is independent of the spliceosome, the inventors inserted Chd2 as the target circularization sequence into the FS2 expression framework sequence, constructing it within the pEGFP-C1 vector backbone to form the pEGFP-FS2-Chd2 expression vector, as described above. Subsequently, HEK-293T cells transfected with pEGFP-FS2-Chd2 were treated with the spliceosome inhibitors PlaB and Madrasin, and the expression level of circChd2 was detected by RT-qPCR. The results showed that circChd2 expression was not affected by spliceosome inhibition (Figure 6C), indicating that FS2 expression framework-mediated circularization is also independent of spliceosome action.

[0050] Example 5: Verification of the cycloforming effect of expression framework sequences composed of arbitrary sequences containing Motif1 or Motif2 and arbitrary sequences containing Motif3. To demonstrate that any sequence containing Motif1 or Motif2 as an upstream expression frame sequence and any sequence containing Motif3 as a downstream expression frame sequence can be combined to mediate the circularization of the target sequence.

[0051] 1. Upstream expression framework sequence design Using the Blast function on the NCBI website (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), sequences containing Motif1 were screened from the genomes of Arabidopsis thaliana (ath), mouse (mmu), and human (hsa) by sequence alignment. The sequences ath_Motif1 (SEQ ID NO.21) in Arabidopsis thaliana, mmu_Motif1 (SEQ ID NO.22) in mouse, and hsa_Motif1 (SEQ ID NO.23) in human, as well as sequences containing Motif2 in Arabidopsis thaliana (ath_Motif2 (SEQ ID NO.24), mmu_Motif2 (SEQ ID NO.25) in mouse, and hsa_Motif2 (SEQ ID NO.26) in human, were selected as upstream expression framework sequences.

[0052] 2. Downstream expression framework sequence design The sequences containing Motif3 in Arabidopsis thaliana (SEQ ID NO.27 and SEQ ID NO.28), in mice (SEQ ID NO.29 and SEQ ID NO.30), and in humans (SEQ ID NO.31 and SEQ ID NO.32) were used as downstream expression framework sequences.

[0053] 3. The expression framework consists of FS11 (SEQ ID NO.21 and SEQ ID NO.27), FS12 (SEQ ID NO.24 and SEQ ID NO.28), FS13 (SEQ ID NO.22 and SEQ ID NO.29), FS14 (SEQ ID NO.25 and SEQ ID NO.30), FS15 (SEQ ID NO.23 and SEQ ID NO.31), and FS16 (SEQ ID NO.26 and SEQ ID NO.32).

[0054] 4. The inventors inserted the target sequence Egfr into the aforementioned upstream and downstream expression framework sequences. For example... Figure 7 As shown in Figure A, 1E-6E were constructed on the pEGFP-C1 vector backbone and transfected into the HEK-293T cell line to detect the expression level of circEgfr (vector construction and transient transfection steps are as shown above).

[0055] The results showed that the expression framework sequence consisting of an upstream expression framework containing Motif1 or Motif2 and a downstream expression framework containing Motif3 mediated circEgfr circulation. Figure 7 B). These results indicate that any sequence containing Motif1 or Motif2 can serve as an upstream expression framework sequence, while any sequence containing Motif3 can serve as a downstream expression framework sequence, and the expression framework sequence formed by the combination of the two can mediate circular RNA expression.

[0056] In addition, the inventors constructed upstream expression framework sequences: SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9, SEQ ID NO.11, SEQ ID NO.13, SEQ ID NO.15, SEQ ID NO.17 and SEQ ID NO.19, and downstream expression framework sequences: SEQ ID NO.6, SEQ ID NO.8, SEQ ID NO.10, SEQ ID NO.12, SEQ ID NO.14, SEQ ID NO.16, SEQ ID NO.18 and SEQ ID NO.20. Expression frames FS3 (SEQ ID NO.5 and SEQ ID NO.6), FS4 (SEQ ID NO.7 and SEQ ID NO.8), FS5 (SEQ ID NO.9 and SEQ ID NO.10), FS6 (SEQ ID NO.11 and SEQ ID NO.12), FS7 (SEQ ID NO.13 and SEQ ID NO.14), FS8 (SEQ ID NO.15 and SEQ ID NO.16), FS9 (SEQ ID NO.17 and SEQ ID NO.18), and FS10 (SEQ ID NO.19 and SEQ ID NO.20) were constructed, and all of them confirmed that these expression frame sequences can mediate circular RNA expression.

[0057] Example 6: Verification of the cyclization effect of expression framework sequences of different lengths containing either Motif1 or Motif2, and any sequence containing Motif3. To demonstrate that circularization of the target sequence can be achieved as long as the upstream expression frame contains Motif1 or Motif2 and the downstream expression frame contains Motif3, even if the sequences are of different lengths, the inventors constructed a series of expression frame sequences of different lengths (SEQ ID NO.33 to SEQ ID NO.43). The upstream expression frame sequences are: SEQ ID NO.33 (302 nt), SEQ ID NO.41 (262 nt), SEQ ID NO.42 (80 nt), and SEQ ID NO.43 (40 bp), respectively. The downstream expression frame sequences are: SEQ ID NO.34 (299 nt), SEQ ID NO.35 (120 nt), SEQ ID NO.36 (30 nt), SEQ ID NO.37 (20 nt), SEQ ID NO.38 (10 nt), SEQ ID NO.39 (289 nt), and SEQ ID NO.40 (299 nt). The following expression frameworks were formed: FS17 (SEQ ID NO.33 and SEQ ID NO.34), FS18 (SEQ ID NO.33 and SEQ ID NO.35), FS19 (SEQ ID NO.33 and SEQ ID NO.2), FS20 (SEQ ID NO.33 and SEQ ID NO.36), FS21 (SEQ ID NO.33 and SEQ ID NO.37), FS22 (SEQ ID NO.33 and SEQ ID NO.38), FS23 (SEQ ID NO.33 and SEQ ID NO.39), FS24 (SEQ ID NO.33 and SEQ ID NO.40), FS25 (SEQ ID NO.41 and SEQ ID NO.2), FS26 (SEQ ID NO.42 and SEQ ID NO.2), and FS27 (SEQ ID NO.43 and SEQ ID NO.2).

[0058] Subsequently, the inventors inserted Acc1 as the target sequence into these expression framework sequences and constructed them into the pcDNA3.1-CMV-MCS vector backbone. They then transfected HEK-293T cells to detect the expression level of circAcc1 (vector construction and transient transfection steps are shown above). The results showed that despite the different lengths of the various expression frameworks, these frameworks were still able to mediate circadian formation of circAcc1. Figure 8 ).

[0059] Example 7: Method for In Vitro Synthesis of Circular RNA To demonstrate that the expression framework of this invention can be applied to the in vitro synthesis of circular RNA, the inventors used the synthesis of circAcc1 as an example. They linearized the pcDNA3.1-FS1-Acc1 expression vector to obtain a linearized template, followed by in vitro transcription. The in vitro transcription conditions were: 37℃, 2 h. The in vitro transcription system is as follows: After obtaining FS1-Acc1 RNA through in vitro transcription, the inventors incubated the purified RNA with in vitro self-cleavage buffer. The purification of the in vitro transcription product was performed according to the MEGAclear kit instructions.

[0060] Self-shearing reaction conditions: 37℃, overnight. The self-shearing reaction system is as follows: After the FS1-Acc1 RNA underwent a self-cleavage reaction, the self-cleavage products were subjected to urea-denaturing PAGE gel electrophoresis. The PAGE gel preparation system is as follows: PAGE gel results ( Figure 9 A) indicates that Mn 2+ Under incubation conditions, FS1-Acc1 RNA underwent a significant autocleavage reaction. Subsequently, the inventors extracted a 297 bp band corresponding to circAcc1, crushed it in a centrifuge tube, and then recovered the RNA. PAGE gel RNA recovery buffer system: PAGE RNA recovery conditions: 37°C, 220 rpm, overnight.

[0061] After obtaining the recovered RNA, the inventors incubated the RNA with Rtcb under the following conditions: 37°C, overnight. The incubation system was as follows: Subsequently, the incubation product was reverse transcribed to obtain cDNA, which was then used as a template for Divergent PCR (experimental steps as before). The results showed that the method successfully synthesized circAcc1, and Sanger sequencing results also indicated that the circAcc1 synthesized by this method had accurate circularization sites. Figure 9(B) Furthermore, after adding PNK to the Rtcb incubation system to disrupt the 5' cyclic phosphate group and 3' hydroxyl group of the FS1-Acc1 RNA self-cleavage product, Rtcb was unable to perform the ligation reaction, further confirming that the self-cleavage reaction of FS1-Acc1 RNA and ligation with Rtcb can be used for the in vitro synthesis of circAcc1. These results indicate that the expression framework of this invention can be used for the in vitro synthesis of circular RNA. Moreover, this embodiment can generate correctly circularized circAcc1 without the insertion of a "scarred sequence".

[0062] The applicant declares that, in the process of describing the above-mentioned specification: The terms "this embodiment," "an embodiment of the present invention," "as shown," "further," and "further improved technical solutions," etc., indicate that the specific features, structures, materials, or characteristics described in the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms are not necessarily directed at the same embodiment or example, and the specific features, structures, materials, or characteristics described can be combined or combined in any suitable manner in one or more embodiments or examples. Furthermore, without causing contradiction, those skilled in the art can combine or combine the different embodiments or examples described in this specification and the features of the different embodiments or examples.

[0063] Finally, it should be noted that: The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them; Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention. Non-essential improvements, adjustments or substitutions made by those skilled in the art based on the content of this specification are all within the scope of protection claimed by the present invention.

Claims

1. A circular RNA expression framework, characterized in that, The circular RNA expression framework includes an upstream expression framework and a downstream expression framework. The upstream expression framework contains either Motif 1 and its complementary sequence, or Motif 2 and its complementary sequence. The downstream expression framework contains Motif 3 and its complementary sequence. Motif 1 is: HKDNNWHDHNHNDHNHNHNDHWNWWHDHAB; Motif 2 is: NYBYTMYWTYBYHHVCAG; Motif 3 is: DDKDKHH; Where H is A, C, or T, K is G or T, D is A, G, or T, N is A, C, G, or T, W is A or T, B is C, G, or T, Y is C or T, M is A or C, and V is A, C, or G.

2. The circular RNA expression framework as described in claim 1, characterized in that, The nucleotide sequences of the upstream expression framework include: SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9, SEQ ID NO.11, SEQ ID NO.13, SEQ ID NO.15, SEQ ID NO.17, SEQ ID NO.19, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.33, SEQ ID NO.41, SEQ ID NO.42, and SEQ ID NO.

43.

3. A circular RNA expression framework as described in claim 1, characterized in that, The nucleotide sequences of the downstream expression framework include: SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8, SEQ ID NO.10, SEQ ID NO.12, SEQ ID NO.14, SEQ ID NO.16, SEQ ID NO.18, SEQ ID NO.20, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.34, SEQ ID NO.35, SEQ ID NO.36, SEQ ID NO.37, SEQ ID NO.38, SEQ ID NO.39, and SEQ ID NO.

40.

4. A circular RNA expression framework as described in claim 1, 2, or 3, characterized in that, The circular RNA expression framework includes: FS1: The nucleotide sequence of the upstream expression framework is SEQ ID NO.1, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.2; FS2: The nucleotide sequence of the upstream expression framework is SEQ ID NO.3, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.4; FS3: The nucleotide sequence of the upstream expression framework is SEQ ID NO.5, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.6; FS4: The nucleotide sequence of the upstream expression framework is SEQ ID NO.7, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.8; FS5: The nucleotide sequence of the upstream expression framework is SEQ ID NO.9, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.10; FS6: The nucleotide sequence of the upstream expression framework is SEQ ID NO.11, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.12; FS7: The nucleotide sequence of the upstream expression frame is SEQ ID NO.13, and the nucleotide sequence of the downstream expression frame is SEQ ID NO.14; FS8: The nucleotide sequence of the upstream expression framework is SEQ ID NO.15, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.16; FS9: The nucleotide sequence of the upstream expression framework is SEQ ID NO.17, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.18; FS10: The nucleotide sequence of the upstream expression framework is SEQ ID NO.19, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.20; FS11: The nucleotide sequence of the upstream expression framework is SEQ ID NO.21, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.27; FS12: The nucleotide sequence of the upstream expression framework is SEQ ID NO.24, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.28; FS13: The nucleotide sequence of the upstream expression framework is SEQ ID NO.22, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.29; FS14: The nucleotide sequence of the upstream expression framework is SEQ ID NO.25, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.30; FS15: The nucleotide sequence of the upstream expression framework is SEQ ID NO.23, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.31; FS16: The nucleotide sequence of the upstream expression framework is SEQ ID NO.26, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.32; FS17: The nucleotide sequence of the upstream expression frame is SEQ ID NO.33, and the nucleotide sequence of the downstream expression frame is SEQ ID NO.34; FS18: The nucleotide sequence of the upstream expression frame is SEQ ID NO.33, and the nucleotide sequence of the downstream expression frame is SEQ ID NO.35; FS19: The nucleotide sequence of the upstream expression framework is SEQ ID NO.33, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.2; FS20: The nucleotide sequence of the upstream expression framework is SEQ ID NO.33, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.36; FS21: The nucleotide sequence of the upstream expression framework is SEQ ID NO.33, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.37; FS22: The nucleotide sequence of the upstream expression framework is SEQ ID NO.33, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.38; FS23: The nucleotide sequence of the upstream expression framework is SEQ ID NO.33, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.39; FS24: The nucleotide sequence of the upstream expression framework is SEQ ID NO.33, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.40; FS25: The nucleotide sequence of the upstream expression framework is SEQ ID NO.41, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.2; FS26: The nucleotide sequence of the upstream expression framework is SEQ ID NO.42, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.2; FS27: The nucleotide sequence of the upstream expression framework is SEQ ID NO.43, and the nucleotide sequence of the downstream expression framework is SEQ ID NO.

2.

5. The use of the circular RNA expression framework according to any one of claims 1-4 in the preparation of expression vectors.

6. The application as described in claim 5, characterized in that, The expression vector also includes a vector framework, the vector backbone comprising: pcDNA3.1-CMV-MCS, pCDH-CMV-MCS-EF1-puroR, and pEGFP-C1.

7. A method for constructing a circular RNA expression vector, characterized in that, Includes the following steps: S1. Synthesize the upstream expression framework sequence, the downstream expression framework sequence, and the insertion sequence of the target circular sequence; S2. The inserted sequence and vector backbone sequence obtained in step S1 are digested with restriction endonucleases. The recovered enzyme digestion products; The ligation digestion products yield ligation products, which include: the expression framework sequence and the insertion sequence of the target circular sequence, as well as the vector backbone sequence; S3. Transform the obtained ligation product into competent bacteria; S4. The transformed competent bacteria obtained in step S3 were cultured and single-clone screening was performed on agar plates containing antibiotics corresponding to the resistance genes on the vector backbone to confirm the acquisition of the circular RNA expression vector. The upstream expression framework contains sequence Motif 1 and its complementary sequence, or Motif 2 and its complementary sequence; the downstream expression framework contains sequence Motif 3 and its complementary sequence. Motif 1 is: HKDNNWHDHNHNDHNHNHNDHWNWWHDHAB; Motif 2 is: NYBYTMYWTYBYHHVCAG; Motif 3 is: DDKDKHH; Where H is A, C, or T, K is G or T, D is A, G, or T, N is A, C, G, or T, W is A or T, B is C, G, or T, Y is C or T, M is A or C, and V is A, C, or G.

8. The method for constructing a circular RNA expression vector as described in claim 7, characterized in that, The nucleotide sequences of the upstream expression framework include: SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9, SEQ ID NO.11, SEQ ID NO.13, SEQ ID NO.15, SEQ ID NO.17, SEQ ID NO.19, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.33, SEQ ID NO.41, SEQ ID NO.42 and SEQ ID NO.43; The nucleotide sequences of the downstream expression framework include: SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8, SEQ ID NO.10, SEQ ID NO.12, SEQ ID NO.14, SEQ ID NO.16, SEQ ID NO.18, SEQ ID NO.20, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.34, SEQ ID NO.35, SEQ ID NO.36, SEQ ID NO.37, SEQ ID NO.38, SEQ ID NO.39, and SEQ ID NO.

40.

9. The method for constructing a circular RNA expression vector as described in claim 7, characterized in that, The vector backbone includes: pcDNA3.1-CMV-MCS, pCDH-CMV-MCS-EF1-puroR, and pEGFP-C1.

10. A method for synthesizing circular RNA in vitro, characterized in that, Includes the following steps: R1. Linearize the expression vector consisting of the vector backbone, expression framework and target circular sequence to obtain a linearized template; R2, RNA is obtained through in vitro transcription; R3. After performing a self-cleaving reaction on the RNA obtained in step R2, the self-cleaving product is subjected to urea denaturing PAGE gel electrophoresis. R4. Extract the band of the size corresponding to the target circular sequence, crush it in a centrifuge tube, and then recover the RNA. R5. After obtaining the recovered RNA, incubate the RNA with Rtcb. R6. The incubation product is reverse transcribed to obtain circular target RNA.