Fluorescent protein marker assisted Tn5 transposase purification method

Abstract

The invention belongs to the technical field of biology, and relates to a fluorescent protein marker assisted Tn5 transposase purification method. According to the method, fluorescent protein and Tn5 transposase form fusion protein for expression and extraction, and Gly and Thr are added to the C terminal of the fusion protein. The fluorescent protein and the Tn5 transposase are subjected to fusion expression, and the purification effect is greatly improved by adding Gly and Thr at the C terminal of the fusion protein, so that the abundance of the purified Tn5 transposase is remarkably superior to that of the Tn5 transposase obtained by a traditional purification method, and the problem of protein activity loss in the traditional purification method is further solved. The real-time monitoring of the purification process is realized through fluorescence labeling, and the strict implementation of the purification process further ensures the high quality and stability of the Tn5 transposase. The purification efficiency of the Tn5 transposase is remarkably improved by combining the labeling characteristic of the fluorescent protein with the affinity chromatography technology.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a fluorescent protein labeling-assisted purification method for Tn5 transposase. Background Technology

[0002] The rapid development of next-generation sequencing (NGS) technology has made it possible to perform large-scale parallel analysis and high-throughput sequencing of multiple samples, while significantly reducing sequencing costs. This technology provides comprehensive insights into the study of genome structure, genetic variation, and gene expression regulation. However, as a key step in the NGS workflow, sequencing library preparation still faces challenges in increasing throughput and reducing costs, especially in the field of single-cell sequencing, where efficiently acquiring large amounts of single-cell expression profiling data has become a research hotspot.

[0003] As a highly efficient DNA fragmentation tool, the introduction of an overactivated version of Tn5 transposase has opened up new possibilities for rapid, cost-effective, and scalable NGS library preparation. The Tn5 transposon, one of the earliest discovered transposons, consists of two nearly identical insertion sequences (IS50L and IS50R), with IS50R encoding the Tn5 transposase (Reznikoff, WS Transposon Tn5). Annu Rev Genet. 42,269–286 (2008). Tn5 transposase interacts with a 19 bp inverted repeat sequence at the outer end of a transposable element via a "cut-and-paste" mechanism, catalyzing the translocation of DNA fragments. Currently, library preparation methods based on Tn5 transposase are widely used in fields such as genome sequencing, RNA sequencing, and chromatin accessibility sequencing (ATAC-seq). ATAC-seq, as an efficient method for studying chromatin accessibility, relies on Tn5 transposase fragmenting genomic DNA while simultaneously cleaving the sequencing adapter (Li, W). et al. Epigenetic application of ATAC-Seq based on Tn5 transposase purification technology. Genet Res . 2022,8429207 (2022). Therefore, the quality of ATAC-seq data is closely related to the activity of Tn5 transposase.

[0004] In summary, Tn5 transposases are key enzymes widely used in high-throughput sequencing library construction. They can insert specific sequence tags while fragmenting DNA, thereby simplifying the sequencing library construction process and improving efficiency. However, traditional Tn5 transposase purification methods suffer from poor purification results due to low purification efficiency, high risk of protein degradation, and complex operation, limiting their application in large-scale sequencing. Summary of the Invention

[0005] To address the problem of poor purification efficiency in existing Tn5 transposase preparation methods, this invention proposes a highly efficient purification method for Tn5 transposase based on fluorescent protein labeling. This method involves fusing a fluorescent protein with the Tn5 transposase for expression. By adding Gly and Thr to the C-terminus of the fusion protein, the purification efficiency of the Tn5 transposase is improved, resulting in a higher purity of the target protein.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: A fluorescent protein-labeled assisted purification method for Tn5 transposase involves expressing and purifying a fusion protein formed by fluorescent protein and Tn5 transposase, wherein the C-terminus of the fusion protein is augmented with Gly and Thr. The abundance of Tn5 transposase purified by this method is significantly superior to that obtained by traditional methods.

[0007] Furthermore, the fusion protein comprises a fluorescent protein and a Tn5 transposase linked in sequence. Even further, to assist protein translation and increase protein solubility, an elongation factor Ts is also linked between the fluorescent protein and the Tn5 transposase; that is, the fusion protein comprises a fluorescent protein, an elongation factor Ts, and a Tn5 transposase linked in sequence. The extraction is performed using a chitin column.

[0008] Furthermore, the method includes: Step 1: Amplify the nucleic acid sequences of the extension factor Ts and the Tn5-in-peptide-CBD, respectively. The 3' end of the Tn5 fragment contains the nucleic acid sequences of Gly and Thr; further, the nucleic acid sequences of Gly and Thr are GGTACC. The nucleic acid sequence of the extension factor Ts is shown in SEQ ID NO:1; the nucleic acid sequence of the Tn5-in-peptide-CBD fragment is shown in SEQ ID NO:2.

[0009] Step 2: The nucleic acid sequences of elongation factor Ts and Tn5-in-peptide-CBD are cloned into a vector containing the coding sequence of a fluorescent protein to obtain a recombinant plasmid; wherein the nucleic acid sequences of elongation factor Ts and Tn5-in-peptide-CBD are located downstream of the fluorescent protein in the vector. The vector is the pET-30a vector, which contains the coding sequence of the fluorescent protein. The fluorescent protein is RFP.

[0010] Step 3: Transform the recombinant plasmid into competent E. coli cells and induce expression of fluorescent protein-TS-Tn5-intein-CBD; Step 4: Extract fluorescent protein-TS-Tn5 using a chitin column.

[0011] The technical solution of this invention is applicable to fields such as molecular biology, genomics, and epigenetics, and has broad application prospects, especially in cutting-edge technologies such as high-throughput sequencing library construction, genome sequencing, single-cell sequencing, spatial transcriptome analysis, and chromatin accessibility research (such as ATAC-seq).

[0012] Terminology Explanation: Fluorescent proteins: Fluorescent proteins are a class of proteins that can absorb light of specific wavelengths and emit fluorescence of different wavelengths.

[0013] Tn5 transposase: Tn5 transposase is an enzyme that catalyzes the insertion and excision of transposons (Tn5) in DNA molecules. It is commonly used in molecular biology to construct mutant libraries and gene sequencing libraries, especially in high-throughput sequencing, where Tn5 transposase can be used for the random cutting and tagging of DNA fragments.

[0014] Fusion proteins: Fusion proteins are single proteins that retain the functional properties of the original proteins, resulting from the genetic engineering process of linking the coding sequences of two or more different genes. Fusion proteins are commonly used to study protein function, increase protein stability, or simplify purification processes.

[0015] Peptide fusion domain: A peptide fusion domain is a part of a fusion protein, usually a short peptide sequence, used to introduce a specific functional module or enhance certain properties of the protein, such as stability, solubility, or ease of purification.

[0016] Purification tag: A purification tag is a short polypeptide or protein sequence that is usually fused to the target protein for expression. It facilitates the purification of the target protein by binding specifically to a particular ligand (such as a metal ion, antibody, or substrate) through methods such as affinity chromatography.

[0017] Elongation factor Ts (Tsf): Elongation factor Ts is a cofactor involved in protein synthesis. It is an accessory protein in the protein translation process of prokaryotes (such as Escherichia coli), and its main function is to help regenerate elongation factor Tu (EF-Tu). In some cases, Tsf is also used as a solubility tag.

[0018] Expression vectors: Expression vectors are modified DNA molecules, usually plasmids or viral vectors, used to express target genes in host cells. Expression vectors contain elements such as promoters, multiple cloning sites, and selection markers to facilitate the insertion, expression, and selection of target genes.

[0019] Host cell: A host cell is a cell used to express foreign genes. Common host cells include Escherichia coli (E. coli). E. coli )wait.

[0020] The beneficial effects of this invention are as follows: 1. This invention fuses fluorescent protein with Tn5 transposase for expression. By adding Gly and Thr to the C-terminus of the fusion protein, the purification effect is greatly improved, resulting in a significantly higher abundance of the purified Tn5 transposase compared to traditional purification methods. This further solves the problem of low protein activity in traditional purification methods.

[0021] 2. This invention also enables real-time monitoring of the purification process through fluorescent labeling, and the rigorous implementation of the purification process further ensures the high quality and stability of the Tn5 transposase. Utilizing the labeling properties of fluorescent proteins combined with affinity chromatography significantly improves the purification efficiency of the Tn5 transposase.

[0022] 3. This invention optimizes the purification reaction conditions of Tn5 transposase, further improving the application performance of Tn5 transposase. Attached Figure Description

[0023] Figure 1 This is the pTXB1-Tn5 plasmid map.

[0024] Figure 2 The plasmid map of pET30-RFP-TS-Tn5.

[0025] Figure 3 To monitor the entire purification process using visible fluorescence: A. Bacterial culture after induced expression. B. Precipitate after centrifugation with NaCl and PEI added to the lysis buffer. C. The purification column turns pink after packing the supernatant. D. Overnight DTT cleavage. E. After complete cleavage, elution from the column; the column returns to colorless, indicating complete cleavage.

[0026] Figure 4 This is a comparison of the purification effects of Tn-5. Lanes 1, 2, and 3 in the figure represent the protein marker, TS-Tn5 obtained using existing techniques, and RFP-TS-Tn5 obtained using the method of this invention, respectively. Detailed Implementation

[0027] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of the embodiments of this invention will be clearly described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0028] Example 1 1. Construction of TS-Tn5 transposons (1) Obtaining the extension factor Ts With Escherichia coli ( E . coli Using DNA as a template, the full-length sequence of extension factor Ts was obtained by PCR amplification. The primers used for PCR amplification are as follows: The upstream primer for amplifying Ts is: 5'-ATGGCTGAAATTACCGCATCCCT-3' (SEQ ID NO:3); The downstream primer for amplifying Ts is 5'-AGACTGCTTGGACATCGCAGC-3' (SEQ ID NO:4).

[0029] The full-length sequence of the amplified elongation factor Ts is (SEQ ID NO:1): ATGGCTGAAATTACCGCATCCCTGGTAAAAGAGCTGCGTGAGCGTACTGGCGCAGGCATGATGGATTGCAAAAAAGCACTGACTGAAGCTAACGGCGACATCGAGCTGGCAATCGAAAACATGCGTAAGTCCGGTGCTATTAAAGCAGCGAAAAAAGCAGGCAACGTTGCTGCTGACGGCGTGATCAAAACCAAAATCGACGGCAACTACGGCATCATTCTGGAAGTTAACTGCCAGACTGACTTCGTTGCAAAAGACGCTGGTTTCCAGGCGTTCGCAGACAAAGTTCTGGACGCAGCTGTTGCTGGCAAAATCACTGACGTTGAAGTTCTGAAAGCACAGTTCGAAGAAGAACGTGTTGCGCTGGTAGCGAAAATTGGTGAAAACATCAACATTCGCCGCGTTGCTGCGCTGGAAGGCGACGTTCTGGGTTCTTATCAGCACGGTGCGCGTATCGGCGTTCTGGTTGCTGCTAAAGGCGCTGACGAAGAGCTGGTTAAACACATCGCTATGCACGTTGCTGCAAGCAAGCCAGAATTCATCAAACCGGAAGACGTATCCGCTGAAGTGGTAGAAAAAGAATACCAGGTACAGCTGGATATCGCGATGCAGTCTGGTAAGCCGAAAGAAATCGCAGAGAAAATGGTTGAAGGCCGCATGAAGAAATTCACCGGCGAAGTTTCTCTGACCGGTCAGCCGTTCGTTATGGAACCAAGCAAAACTGTTGGTCAGCTGCTGAAAGAGCATAACGCTGAAGTGACTGGCTTCATCCGCTTCGAAGTGGGTGAAGGCATCGAGAAAGTTGAGACTGACTTTGCAGCAGAAGTTGCTGCGATGTCCAAGCAGTCT。

[0030] (2)Obtaining Tn5-Intein-CBD In the pTXB1-Tn5 plasmid (purchased from Addgene plasmid, #60240, Figure 1Add the coding sequences for Gly and Thr (GGT and ACC, see the underlined part in the Tn5-integral-CBD fragment) to the end of the Tn5 fragment. Specifically, first use the upstream of the Tn5 transposase fragment in the pTXB1-Tn5 plasmid. Nde I and downstream Spe The Tn5 transposase fragment was removed at site I. Primers were then designed, and PCR was performed using the pTXB1-Tn5 plasmid as a template. The designed primers introduced a 6-base sequence, GGTACC, into the PCR product. The PCR product was then seamlessly cloned into the pTXB1-Tn5 plasmid with the Tn5 transposase fragment removed. Single colonies were sequenced to identify the presence of the 6-base GGTACC. The forward and reverse primer sequences used to modify the pTXB1-Tn5 plasmid are as follows: Forward primer: 5'-aaggagatatacatatgATTACCAGTGCACTGCATCGTGCG-3' (SEQ ID NO:5); Reverse primer: 5'-gggtagggcaactagtGGTACCGATTTTAATGCCCTGCGCCATCAGGTCT-3' (SEQ ID NO:6).

[0031] Next, the Tn5-intein-CBD fragment was obtained by PCR amplification from the modified pTXB1-Tn5 plasmid. CBD stands for Chitin-Binding Domain; the intein is a protein sequence with self-cleavage activity, intended to initiate the self-cleavage reaction during subsequent purification to release the Tn5 transposase from the column. The primers used for PCR amplification are as follows: Upstream primer for amplifying Tn5-in-CBD: 5'-ATTACCAGTGCACTGCATCGTGC-3' (SEQ ID NO: 7); The downstream primer for amplifying Tn5-in-CBD is: 5'-TTGAAGCTGCCACAAGGCAGGAA-3' (SEQ ID NO: 8).

[0032] GGTACC The underlined part represents the six bases added after the Tn5 transposase fragment.

[0033] (3) Obtaining recombinant plasmids Subsequently, the Ts and Tn5-in-peptide-CBD fragments were cloned into the pET-30a vector using the Gibson assembly method to construct the recombinant plasmid pET30-RFP-TS-Tn5. Figure 2 ).

[0034] 2. Tn5-induced expression pET30-RFP-TS-Tn5 was transformed into Rosetta (DE3) Escherichia coli competent cells. Single colonies were selected and inoculated into 10 mL LB medium (containing 1% glucose and 50 μg / mL kanamycin) and cultured overnight at 37°C with shaking (200 rpm). The next day, 1 mL of the overnight culture was inoculated into 100 mL LB medium (containing 50 μg / mL kanamycin) and cultured at 37°C with shaking (200 rpm) until OD. 600 The target concentration was reached at 0.5–0.6. Cells were then transferred to a 20°C shaker, and IPTG and 0.5×PMSF were added to a final concentration of 0.2 mM to induce Tn5 expression. After 4 hours of induction, OD... 600 The value was approximately twice the initial value (1~1.2), and the bacterial culture after induction of expression was as follows: Figure 3 As shown in A. The cells were centrifuged at 3,000×g for 10 minutes at 4°C, the cell pellet was washed with 1×PBS containing 1×PMSF, 10% glycerol and 1×protease inhibitor, and the pellet was aliquoted and stored at -80°C.

[0035] 3. Tn5 extraction The cell pellet (from 100 mL of culture) was resuspended in approximately 3 mL of pre-chilled Tn5 lysis buffer (20 mM MEPES-NaOH pH 7.2, 10 mM NaCl, 1 mM EDTA, 10% glycerol, 1× protease inhibitor, 1× PMSF, 0.1% (w / v) Tween-20, 0.1% (w / v) CHAPS, and 100 μg lysozyme) and incubated at 4°C on a rotary mixer for 5 minutes. Subsequently, bacterial genomic DNA was sheared using an ultrasonic sonicator (1-2 cycles, 30 / 30 sec on / off, low power). NaCl and 0.25% polyethyleneimine (PEI) were added to the lysis buffer (i.e., the liquid after ultrasonic shearing), and the mixture was centrifuged at 20,000×g for 15 minutes at 4°C. The centrifuged pellet is shown below. Figure 3 As shown in B.

[0036] The supernatant obtained after centrifugation was filtered through a 0.45 μm nylon syringe filter and loaded three times onto a 1.5 mL chitin column (purchased from NEB). After the supernatant was packed into the column, the purification column turned pink. Figure 3As shown in C. The chitin column was pre-washed with 10 mL of pre-chilled wash buffer (20 mM HEPES-NaOH pH 7.2, 800 mM NaCl, 1 mM EDTA, 10% glycerol, 1×PMSF, 0.02% (w / v) CHAPS). After loading the supernatant, the chitin column was washed sequentially with 5 mL of pre-chilled wash buffer, 2 mL of high-salt wash buffer (20 mM HEPES-NaOH pH 7.2, 2 M NaCl, 1 mM EDTA, 10% glycerol, 1×PMSF, 0.02% (w / v) CHAPS), and 20 mL of pre-chilled wash buffer containing Tn5-bound chitin. To cleave the intipeptide between the Tn5 transposon and the chitin-binding domain, the column was first washed with 1.5 mL of pre-chilled cleavage buffer (50 mM MEPES-NaOH pH 7.2, 10 mM Tris-HCl pH 8.0, 800 mM NaCl, 1 mM EDTA, 10% glycerol, 1×PMSF, 1×protease inhibitor, 100 mM DTT). Then, 500 μL of pre-chilled cleavage buffer was added to seal the column, and it was incubated overnight at 4°C. After collecting the eluent, another 500 μL of pre-chilled cleavage buffer was added to the chitin column, and it was incubated overnight at 4°C.

[0037] After two overnight cuts, the column was flushed twice and the eluent was collected. Before elution, the fluorescent protein appeared pink in the purification column; after complete elution, the column turned white, indicating complete DTT cutting. Figure 3 (D, E). Additionally, the Tn5 concentration can be increased by concentrating 1 mL of the eluent. Rapid centrifugation at 3,000 × g (approximately 5 minutes) using a concentration column can reduce the total volume to <200 μL. For further removal of low molecular weight proteins, the concentrated Tn5 is centrifuged using a Zeba™ desalting column (40K MWCO, 0.5 mL) pre-equilibrated with storage buffer. This is followed by nanodrop via OD... 280 The concentration of Tn5 was measured. To ensure long-term storage at -20°C, an equal volume of glycerol was added to the Tn5 solution, followed by the addition of DTT (purchased from NEB) to a final concentration of 1 mM.

[0038] The results showed that this example could purify approximately 0.25 mL of OD from the cell pellet obtained from 50 mL of culture. 280 RFP-TS-Tn5 is version 1.0, while existing technology (Tu) et al .Reconstructing the maize leafregulatory network Using ChIP-seq data of 104 transcription factors. Nat Commun. 2020 Oct9;11(1):5089. doi:10.1038 / s41467-020-18832-8) Approximately 100 mL of culture is needed to obtain the same amount of TS-Tn5.

[0039] In this invention, we present an improved method for Tn5 purification, which, compared with existing technologies (Tu... et al Reconstructing the maize leaf regulatory network using ChIP-seq data of 104 transcription factors. Nat Commun. 2020 Oct 9;11(1):5089. doi:10.1038 / s41467-020-18832-8), the method of this invention (right) significantly improves purification efficiency. According to the appendix Figure 4 The SDS-PAGE gel image shown indicates that, after inducing the same volume of E. coli, the sample purified using the method of this invention exhibits more distinct and clear bands within a specific molecular weight range. This is direct evidence that the purification effect is superior to existing technologies. The method of this invention effectively removes impurities, improves the purity of the target protein, reduces background signal, and ensures high activity in downstream applications (such as transposition reactions).

[0040] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for purifying Tn5 transposase using fluorescent protein labeling, characterized in that, A fusion protein was formed by fusing fluorescent protein with Tn5 transposase, which was then expressed and extracted. The C-terminus of the fusion protein was augmented with Gly and Thr.

2. The method for purifying Tn5 transposase with fluorescent protein labeling according to claim 1, characterized in that, The fusion protein comprises a fluorescent protein and a Tn5 transposase connected in sequence.

3. The method for purifying Tn5 transposase with fluorescent protein labeling according to claim 1, characterized in that, The fusion protein comprises a fluorescent protein, an elongation factor Ts, and a Tn5 transposase connected in sequence.

4. The method for purifying Tn5 transposase with fluorescent protein labeling according to claim 1, characterized in that, The extraction was performed using a chitin column.

5. The method for purifying Tn5 transposase with fluorescent protein labeling according to claim 3, characterized in that, The method includes: Step 1: Amplify the nucleic acid sequences of extension factor Ts and Tn5-in-peptide-CBD, respectively, wherein the 3' end of Tn5 is provided with nucleic acid sequences of Gly and Thr; Step 2: The nucleic acid sequences of extension factor Ts and Tn5-in-peptide-CBD were cloned into a vector containing a fluorescent protein coding sequence to obtain a recombinant plasmid; Step 3: Transform the recombinant plasmid into competent E. coli cells and induce expression of fluorescent protein-TS-Tn5-intein-CBD; Step 4: Extract fluorescent protein-TS-Tn5 using a chitin column.

6. The method for purifying Tn5 transposase with fluorescent protein labeling according to claim 5, characterized in that, In step 1, the nucleic acid sequences of Gly and Thr are GGTACC.

7. The method for purifying Tn5 transposase with fluorescent protein labeling according to claim 5, characterized in that, In step 1, the nucleic acid sequence of the extension factor Ts is shown in SEQ ID NO:1; the nucleic acid sequence of the Tn5-in-peptide-CBD fragment is shown in SEQ ID NO:

2.

8. The method for purifying Tn5 transposase with fluorescent protein labeling according to claim 5, characterized in that, In step 2, the nucleic acid sequences of the extension factor Ts and Tn5-inteptide-CBD are located downstream of the fluorescent protein in the vector.

9. The method for purifying Tn5 transposase with fluorescent protein labeling according to claim 5, characterized in that, In step 2, the vector is the pET-30a vector, which contains the coding sequence of a fluorescent protein.

10. The method for purifying Tn5 transposase with fluorescent protein labeling according to claim 9, characterized in that, In step 2, the fluorescent protein is RFP.

Images