Application of rice OsNAR1 gene or protein coded thereby in regulating rice resistance to Magnaporthe grisea

Abstract

The application discloses a rice OsNAR1 application of the gene or the coded protein in regulating rice resistance to Magnaporthe oryzae, and relates to the technical field of rice Magnaporthe oryzae prevention and treatment. OsNAR1 The CDS nucleotide sequence of the gene is shown as SEQ ID No. 2. OsNAR1 The application finds that the rice gene OsNAR1 plays an important role in the process of rice resistance to Magnaporthe oryzae, the number of leaf spots on the gene deletion mutant is less, the gene can be used for screening rice strains resistant to Magnaporthe oryzae, the expression amount of a basic resistance marker gene in the gene deletion mutant is significantly up-regulated, and it is indicated that OsNAR1 negatively regulates the expression of the basic resistance gene and can be used for preventing and treating Magnaporthe oryzae.

Description

Technical Field

[0001] This invention relates to the field of rice blast control technology, and particularly to rice OsNAR1 Application of genes or their encoded proteins in regulating rice resistance to rice blast fungus. Background Technology

[0002] Rice is a staple food source for more than half the world's population, and its stable production is directly related to global food security. Rice blast is caused by a fungus. Magnaporthe oryzae Rice blast is a serious disease that can occur at different stages and parts of rice growth and development, mainly manifesting as leaf blast, neck blast, and grain blast. The rice blast fungus primarily reproduces asexually in the field and completes its infection cycle, impacting rice production worldwide.

[0003] Currently, little is known about novel agents for the effective control of rice blast. However, by utilizing disease-resistance genes, the resistance of rice varieties to this pathogen can be significantly enhanced, thereby reducing yield losses caused by rice blast. For example, patent applications with publication numbers CN115109797A and CN115109786A both utilize disease-resistance genes to improve rice's resistance to rice blast fungus. Discovering and applying disease-resistance genes to improve rice's resistance to rice blast has significant practical implications in agricultural production and is particularly important for addressing potential future challenges.

[0004] Iron-sulfur clusters (Fe-S clusters) are a class of important cofactors ubiquitous in organisms, participating in the function of key enzymes and proteins in various life processes. They mainly exist in two forms: [2Fe-2S] and [4Fe-4S], playing indispensable roles in multiple biological processes such as electron transport, gene expression regulation, and environmental sensing. The synthesis of iron-sulfur clusters is a complex and finely regulated process involving multiple steps and specific proteins. Nar1 is an iron / sulfur (Fe / S) protein, and cell biology and biochemistry studies have identified two magnetically coupled [4Fe–4S] clusters in Nar1 of yeast and plants. The assembly of the C-terminal Fe / S cluster in yeast Nar1 depends on the N-terminal cluster. The absence of Nar1 severely affects the maturation of all studied cytoplasmic and nuclear Fe / S proteins, while mitochondrial Fe / S proteins are unaffected. Similar results have recently been obtained in the human Nar1 homolog IOP1 and Chlamydomonas Nar1. In Arabidopsis thaliana, NAR1 is essential for the function of both the gametophyte and zygote. In the female gametophyte, NAR1 is essential for the transcriptional activation of certain imprinted genes and for appropriate abiotic stress responses in vegetative tissues. However, the biological function of NAR1 in rice remains unclear. Summary of the Invention

[0005] This invention has discovered that rice OsNAR1 The gene is associated with the immune response of rice to rice blast, and overexpression of it... OsNAR1 After gene deletion, rice's defense against rice blast fungus is reduced; while knockout or silencing... OsNAR1 Genes can enhance rice's resistance to rice blast fungus, and basic resistance marker genes... OsKS4 and OsPR1A The expression levels were significantly upregulated in knockout plants, and it can be used as a pesticide to control rice blast.

[0006] The technical solution of the present invention is as follows:

[0007] This invention provides rice OsNAR1 The application of genes or their encoded proteins in regulating resistance to rice blast fungus, wherein the rice OsNAR1 The CDS nucleotide sequence of the gene is shown in SEQ ID No. 2, rice. OsNAR1 The amino acid sequence of the gene or the protein it encodes is shown in SEQ ID No. 1.

[0008] This invention also provides rice OsNAR1 The application of genes or their encoded proteins in the preparation of drugs against rice blast fungus, rice OsNAR1 The nucleotide sequence of the gene CDS is shown in SEQ ID No. 2, rice. OsNAR1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No. 1.

[0009] Compared with the expression levels of markers in the wild type, the expression levels of basal resistance marker genes OsKS4 and OsPR1A Knocking out the plant ( Osnar1-3 , Osnar1-17 The expression levels of OsNAR1 were significantly upregulated, indicating that OsNAR1 negatively regulates the expression of basal resistance genes.

[0010] This invention also provides a method for regulating the resistance of rice to rice blast fungus. When it is necessary to reduce the resistance of rice to rice blast fungus, the method involves adjusting the concentration of certain components in the rice... OsNAR1 Gene overexpression; when it is necessary to improve the resistance of rice to rice blast fungus, the gene overexpression in rice is... OsNAR1 Gene silencing or knockout; rice OsNAR1 The nucleotide sequence of the gene CDS is shown in SEQ ID No. 2.

[0011] This invention also provides rice OsNAR1 The application of genes in rice breeding involves selecting silent or knockout rice varieties. OsNAR1 Rice plants that have been genetically modified to obtain rice lines resistant to rice blast fungus, rice OsNAR1The nucleotide sequence of the gene CDS is shown in SEQ ID No. 2.

[0012] and rice OsNAR1 The application of gene-encoded proteins in rice breeding, through screening rice varieties. OsNAR1 Rice plants with low or no expression of the gene-encoded protein obtained rice lines resistant to rice blast fungus. OsNAR1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No. 1.

[0013] The present invention also provides a drug for treating rice blast fungus, the active ingredient of which includes ingredients for knocking out or silencing rice. OsNAR1 A nucleic acid molecule of a gene having the nucleotide sequence shown in SEQ ID No. 3.

[0014] The present invention also provides the application of the aforementioned anti-rice blast fungus drug in the prevention and control of rice blast fungus infection.

[0015] This invention also provides a method for constructing transgenic rice resistant to rice blast fungus, by incorporating the rice... OsNAR1 Gene silencing or knockout, rice OsNAR1 The nucleotide sequence of the gene CDS is shown in SEQ ID No. 2.

[0016] The specific method for constructing transgenic rice resistant to rice blast fungus includes the following steps:

[0017] (1) Construct a gene silencing or knockout vector, wherein the gene silencing or knockout vector carries a gene silencing or knockout vector for the purpose of silencing or knocking out genes. OsNAR1 Plant expression vectors containing sequences for silencing or knocking out genes;

[0018] (2) Introduce the gene silencing or knockout vector from step (1) into rice cells. OsNAR1 Gene silencing or knockout, followed by the cultivation of transgenic rice plants.

[0019] Preferably, the target sequence for gene knockout is shown in SEQ ID No. 3.

[0020] This invention has discovered rice genes through research. OsNAR1 It plays an important role in the resistance of rice to rice blast. The gene deletion mutant has fewer lesions on the leaves. This gene can be used to screen for rice lines resistant to rice blast fungus. The expression levels of basic resistance marker genes in the gene deletion mutant are significantly upregulated, indicating that OsNAR1 negatively regulates the expression of basic resistance genes and can be used to control rice blast. Attached Figure Description

[0021] Figure 1 To detect the presence of [certain substances] in transformed plants using quantitative PCR OsNAR1 The amount of expression.

[0022] Figure 2 The results of the study on OsNAR1 resistance to rice blast are shown below; A represents the lesion condition on the leaves of plants under different treatments; B represents the lesion area on the leaves of plants under different treatments; and C represents the fungal biomass detection results in the leaves of plants under different treatments.

[0023] Figure 3 The results show that OsNAR1 negatively regulates basal resistance in rice; among them, A is a basal resistance marker gene. OsKS4 Expression levels in knockout-treated plants; B is a basic resistance marker gene. OsPR1A Expression levels in knockout-treated plants; where * indicates p<0.05. Detailed Implementation

[0024] Example 1

[0025] rice OsNAR1 Obtaining gene knockout mutants.

[0026] Using the amino acid sequence of Arabidopsis thaliana NAR1, its homologous protein OsNAR1 was identified through BLASTP in the rice genome database. The amino acid sequence of the rice OsNAR1 protein is shown in SEQ ID No. 1. OsNAR1 The gene sequence (CDS sequence) is shown in SEQ ID No. 2. We used CRISPR / Cas9 technology to perform targeted knockout of the target gene, thereby obtaining... OsNAR1 Gene knockout mutants.

[0027] The steps for constructing the knockout vector are as follows:

[0028] (1) First, according to OsNAR1 The gene ID was obtained, and its reference sequence in Nipponbare was downloaded (https: / / rice.uga.edu / cgi-bin / ORF_infopage.cgi?orf=LOC_Os03g53750). The target site (coding sequence AGTGAGCACAAATCCTCCAGAGG) was determined, and adapter primers OsNAR1cas9-F / R were designed. The primer sequences are as follows:

[0029] OsNAR1cas9-F:GTGAGCACAAATCCTCCAGGTTTTAGAGCTAGAAAT;

[0030] OsNAR1cas9-R: CTGGAGGATTTGTGCTCACTGCCACGGATCATCTG;

[0031] (2) gRNA expression cassette amplification (two rounds of nested PCR amplification):

[0032] The PCR reaction system is as follows:

[0033]

[0034] The UF / gRNA-R sequence of the primers for the first round of PCR amplification is:

[0035] UF: 5'-CTCCGTTTTACCTGTGGAATCG-3';

[0036] gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3'.

[0037] The conditions for the first round of PCR amplification are shown in Table 1:

[0038] Table 1

[0039]

[0040] After amplification, the product obtained from the first round of amplification was diluted 10 times and used as a template for the second round of amplification.

[0041] The reaction system for the second round of PCR amplification is as follows:

[0042]

[0043] The primer sequences for the second round of PCR amplification are:

[0044] Uctcg-B1':5'-TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG-3';

[0045] gRcggt-BL: 5'-AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC-3'.

[0046] The conditions for the second round of PCR amplification are shown in Table 2:

[0047] Table 2

[0048]

[0049] After amplification, the product was subjected to electrophoresis to purify the second-round amplification product and determine its concentration.

[0050] (3) Cutting and connecting simultaneously:

[0051] Take approximately 20 ng of the purified product from step (2) and add uncut pYLCRISPR / Cas9Approximately 20 ng of -MH plasmid was used in a 15 μL reaction system with 10 U Bsa I enzyme was digested at 37℃ for 10 min.

[0052] After enzyme digestion, 1.5 μL of 10×T4 ligase buffer and 35 U of T4 ligase were added to the system. The PCR reaction system is shown in Table 3.

[0053] Table 3

[0054]

[0055] The ligated plasmid was transformed into E. coli using a heat shock method. E. coli Positive clones were selected for testing. After successful sequencing, the plasmid was sent to Wuhan Boyuan Biotechnology Co., Ltd. for callus transformation. Using the TP309 line as a background, rice was obtained. OsNAR1 Gene knockout mutant Osnar1 DNA sequences surrounding the target site in transformed plants were amplified by PCR and confirmed to be knockout mutants after sequencing. Osnar1 -3 and Osnar1 -17.

[0056] Example 2

[0057] rice OsNAR1 Obtaining overexpressing plants.

[0058] Amplification via primers OsNAR1 The genomic sequence from the start codon to the stop codon was ligated into the pCAMBIA1390 vector, and OsNAR1 overexpression was driven using the Ubi promoter. The constructed vector was transformed into wild-type rice TP309, and total RNA was extracted from the transformed plants and reverse transcribed. Quantitative PCR was then used to detect RNA in the transformed plants. OsNAR1 The expression levels were determined, and OsNAR1-OE-4 and OsNAR1-OE-12 were identified as overexpressing plants. Figure 1 ).

[0059] The primer sequences are as follows:

[0060] OsNAR1-OX-F: gttacttctgcactaggtaccATGGCGTCGTCGTCGTCG,

[0061] OsNAR1-OX-R:tcttagaattcccggggatccTCACCAATTCTGCAACTGCG.

[0062] Example 3

[0063] spray-inoculated rice OsNAR1 Knockout mutants and overexpression mutants of plants.

[0064] To clarify the role of OsNAR1 in rice blast resistance, we inoculated wild-type rice TP309 with a gene deletion mutant via spray inoculation. Osnar1 And the OsNAR1-OE overexpression plant.

[0065] The specific steps are as follows: Culture the rice blast fungus on tomato-oat medium for 7 days, collect the conidia of the rice blast fungus, and adjust the concentration to 1×10⁻⁶. 6 The spores were sprayed onto rice seedlings at the 4-leaf stage. After 2 days of darkness treatment, the seedlings were placed in an incubator with alternating 12-hour darkness and 12-hour light cycles. The lesions on the leaves were observed after 5 days of treatment.

[0066] The experimental results showed that, compared with wild-type TP309, the gene deletion mutant... Osnar1 Fewer lesions were observed on the leaves of plants expressing OsNAR1-OE, while more lesions were observed on the leaves of plants expressing OsNAR1-OE. The lesion area statistics were consistent with the observations. Figure 2 A). Further analysis of fungal biomass in the leaves yielded results consistent with the lesion statistics. Figure 2 B), the above results indicate that OsNAR1 negatively regulates rice blast resistance.

[0067] Example 4

[0068] OsNAR1 Negative regulation of basic resistance in rice.

[0069] To investigate the genes that negatively regulate rice blast resistance using OsNAR1, we compared wild-type plants TP309 and... OsNAR1 Expression of disease resistance genes in gene deletion mutant plants.

[0070] The specific experimental steps are as follows: First, inoculate with TP309 rice seedlings that are four weeks old. Osnar1 -3 and Osnar1 -17 plants were inoculated, and total RNA was extracted from leaves 12 hours later and reverse transcribed. Genes of basic resistance markers were detected by qPCR. OsKS4 (LOC_Os04g10060) and OsPR1A The expression level of (LOC_Os07g03710) in rice OsUbiquitin Gene expression levels are used as internal controls.

[0071] The primer sequences are as follows:

[0072] OsKS4-F:TTTGAGGTCTTTAGCGACAGAT,

[0073] OsKS4-R: TATAGTTGGTCCCAATGCGAAT;

[0074] OsPR1A-F: GGCCAATCTCCCTACTGATTAA,

[0075] OsPR1A-R:GCATAAACACGTAGCATAGCAT;

[0076] OsUbiquitin-F:AAGAAGCTGAAGCATCCAGC,

[0077] OsUbiquitin-R:CCAGGACAAGATGATCTGCC.

[0078] Analysis of the experimental results revealed that, compared with the expression levels of markers in the wild type, the expression levels of basal resistance marker genes were significantly lower. OsKS4 and OsPR1A exist Osnar1 -3 and Osnar1 The expression level was significantly upregulated in all -17 plants. Figure 3 This indicates that OsNAR1 negatively regulates the expression of basal resistance genes.

Claims

1. Silencing or knocking out rice OsNAR1 The application of genes or their encoded proteins in improving rice resistance to rice blast fungus, wherein the rice OsNAR1 The CDS nucleotide sequence of the gene is shown in SEQ ID No. 2, rice. OsNAR1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No.

1.

2. A method for regulating rice resistance to rice blast fungus, characterized in that, When it is necessary to improve the resistance of rice to rice blast fungus, the rice... OsNAR1 Gene silencing or knockout can be used to improve rice resistance to rice blast fungus. rice OsNAR1 The nucleotide sequence of the gene CDS is shown in SEQ ID No.

2.

3. Rice OsNAR1 The application of genes in rice breeding involves selecting silent or knockout rice varieties. OsNAR1 Rice plants that have been genetically modified to obtain rice lines resistant to rice blast fungus, rice OsNAR1 The nucleotide sequence of the gene CDS is shown in SEQ ID No.

2.

4. Rice OsNAR1 The application of gene-encoded proteins in rice breeding, through screening rice varieties. OsNAR1 Rice plants that do not express the gene-encoded protein obtained rice lines resistant to rice blast fungus. OsNAR1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No.

1.

5. A method for constructing transgenic rice resistant to rice blast fungus, characterized in that, In rice OsNAR1 Gene silencing or knockout, rice OsNAR1 The nucleotide sequence of the gene CDS is shown in SEQ ID No.

2.

6. The method for constructing transgenic rice resistant to rice blast fungus as described in claim 5, characterized in that, Includes the following steps: (1) Construct a gene silencing or knockout vector, wherein the gene silencing or knockout vector carries a gene silencing or knockout vector for silencing or knocking out genes. OsNAR1 Plant expression vectors containing sequences for silencing or knocking out genes; (2) Introduce the gene silencing or knockout vector from step (1) into rice cells. OsNAR1 Gene silencing or knockout, followed by the cultivation of transgenic rice plants.

7. The method for constructing transgenic rice resistant to rice blast fungus as described in claim 6, characterized in that, The target sequence for gene knockout is shown in SEQ ID No. 3.

Images