Application of promoter ProPIND in visualized tracing of regeneration of in-vitro leaf cells of Elatoneum palmatum
By fusing the promoter ProPIND with a fluorescent marker gene in detached leaves of *Sphagnum moss*, a homologous recombination expression vector was constructed, solving the high-throughput screening bottleneck and the uncontrollability of the regeneration pathway in the *Sphagnum moss* regeneration technology system, and achieving efficient and accurate visual tracing and regeneration detection.
Patent Information
- Application Number
- CN202511167321.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-20
- Publication Date
- 2025-11-21
AI Technical Summary
Existing cell regeneration technology systems suffer from bottlenecks in high-throughput screening, uncontrollable regeneration pathways, and unstable regeneration efficiency. Furthermore, the lack of effective visualization labeling methods limits the research and application of cell regeneration technology systems.
By fusing the promoter ProPIND with a fluorescently labeled gene, a homologous recombination expression vector was constructed, which was then transformed into protoplasts of *Bryum simonii* to obtain positive transformed plants. The regeneration of cells in detached leaves was then visualized and traced through fluorescence observation.
It achieves efficient, precise and visual tracing of cell regeneration from detached leaf leaves of *Moss sphaerocephala*, improving the level of regeneration detection and evaluation efficiency, and features convenient operation, high sensitivity and quantification.
Smart Images

Figure CN120989134A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of plant genetic engineering, and particularly relates to application of a promoter ProPIND in visual tracing of cell regeneration of Physcomitrium patens in vitro leaf. BACKGROUND
[0002] Regeneration is one of the important fields of plant cell totipotency or pluripotency research, and is an important strategy for plants to adapt to external damage. Plant regeneration is a process of self-repairing or replacing the damaged part, and is completed by the ordered cooperation of wound or stress signals, transcription factors, and hormone signals. This powerful regeneration ability has important application value in many aspects, including plant tissue culture and rapid propagation, genetic engineering operation, haploid breeding, etc. However, the regeneration abilities of different plants are quite different, which seriously restricts the application potential of breakthrough technologies such as transgenic in biological breeding. Therefore, how to improve the regeneration ability of plants through a simple and direct method has been a major issue in the field of modern life sciences.
[0003] As a representative of bryophytes, Physcomitrium patens has a simple structure and high regenerative characteristics, which provides a model system for studying the mechanism of leaf cell regeneration. Unlike Arabidopsis thaliana leaves, the in vitro leaves of Physcomitrium patens can undergo cell regeneration without the addition of exogenous plant growth regulators, which is very conducive to the regulation of cell-level regeneration research. The leaf regeneration process of Physcomitrium patens is very simple, starting from the fate transformation of cells at the wound site, forming a protonema apical stem cell, and then starting to divide and form new protonema cells. The use of Physcomitrium patens to study the regulation mechanism of plant regeneration can track the details of changes in specific cells during the regeneration process, and can observe regeneration phenomena that are difficult to monitor in seed plants and obtain new regulation mechanisms. However, the existing Physcomitrium patens regeneration technology system still has defects, such as high-throughput screening bottlenecks, uncontrollable regeneration pathways, and unstable regeneration efficiency. Therefore, it is necessary to provide a visual marker for the regeneration stage of Physcomitrium patens in vitro leaves, which has important significance for the study of cell regeneration technology system. SUMMARY
[0004] The purpose of the present application is to provide the application of the promoter ProPIND in visual tracing of cell regeneration of Physcomitrium patens in vitro leaf, which can be specifically highly expressed in the regenerated cells of Physcomitrium patens in vitro leaf, and can realize visual tracing of cell regeneration of Physcomitrium patens in vitro leaf by combining with fluorescent labeling.
[0005] The application provides an application of a promoter ProPIND in visual tracing of cell regeneration of a Physcomitrella patens in vitro leaf, and a nucleotide sequence of the promoter ProPIND is shown as SEQ ID NO:1.
[0006] The application further provides a primer pair for amplifying the promoter ProPIND, wherein the primer pair comprises a forward primer and a reverse primer; a nucleotide sequence of the forward primer is shown as SEQ ID NO:2, and a nucleotide sequence of the reverse primer is shown as SEQ ID NO:3.
[0007] The nucleotide sequence of the promoter ProPIND is shown as SEQ ID NO:1.
[0008] The application further provides an application of the primer pair in visual tracing of cell regeneration of the Physcomitrella patens in vitro leaf.
[0009] The application further provides a visual tracing method for cell regeneration of the Physcomitrella patens in vitro leaf, comprising the following steps:
[0010] The promoter ProPIND is fused with a fluorescent marker gene, and then is constructed into a homologous recombination expression vector to obtain a ProPIND::fluorescent marker expression vector;
[0011] The ProPIND::fluorescent marker expression vector is transformed into a Physcomitrella patens protoplast to obtain a positive Physcomitrella patens transformed plant;
[0012] The in vitro leaf of the positive Physcomitrella patens transformed plant is observed by fluorescence to realize visual tracing of a cell regeneration process of the Physcomitrella patens in vitro leaf.
[0013] In an optimal mode of the application, the promoter ProPIND is obtained by PCR amplification using the above primer pair and taking a DNA genome of the Physcomitrella patens as a template.
[0014] In an optimal mode of the application, the fluorescent marker gene comprises a GFP gene.
[0015] In an optimal mode of the application, the homologous recombination expression vector comprises a pPOG1 vector.
[0016] In an optimal mode of the application, the preparation material of the Physcomitrella patens protoplast is a Physcomitrella patens protoplast filament cultured for 7-10 days.
[0017] In an optimal mode of the application, the obtaining method of the in vitro leaf is that a leaf with a length of 1.5-2.0 mm in a gametophyte is cut, and then is cultured for 2-4 days in vitro.
[0018] In a preferred mode of the present application, the fluorescence observation comprises observing GFP fluorescence under the condition that the excitation wavelength is 450-490 nm.
[0019] Beneficial effects: The present application clones the promoter of auxin transporter coding gene PIND from Physcomitrella patens genome, and names it as promoter ProPIND. It is found in the examples that the promoter ProPIND can be effectively and specifically highly expressed in the regenerated cells of the in vitro leaves of Physcomitrella patens. The present application constructs an expression vector by connecting the promoter ProPIND with a nucleotide sequence coding fluorescent marker, and uses homologous recombination technology to introduce the fusion fragment into the protoplasts of Physcomitrella patens, so that the stably inherited positive transgenic plants can be obtained, and the tissue or cell specific monitoring of the expression mode can be realized.
[0020] By using the method of the present application, the fluorescence tracing and quantitative analysis of the activity of ProPIND promoter in the regeneration process of in vitro leaf cells can greatly promote the detection level and evaluation efficiency of cell regeneration, and the method has the characteristics of convenient operation, in vivo detection, high sensitivity, quantification, etc., and has important significance for the research of cell regeneration technology system. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1 The results of the schematic diagram (A), positive transducer PCR identification (B) and positive transducer GFP stereoscopic fluorescence analysis (C) of the ProPIND::GFP expression vector of Example 1 are shown in the following figures;
[0022] Figure 2 The results of the in vitro leaf cell regeneration and GFP fluorescence visualization of Example 2 and Comparative Example 2 are shown in the following figures;
[0023] Figure 3 The results of the in vitro leaf cell regeneration and GFP fluorescence visualization of Example 2 and Comparative Example 2 are shown in the following figures; DETAILED DESCRIPTION
[0024] The present application provides the application of the promoter ProPIND in the visualization tracing of in vitro leaf cell regeneration of Physcomitrella patens, and the nucleotide sequence of the promoter ProPIND is shown in SEQ ID NO: 1.
[0025] The ProPIND in the application is a promoter of auxin transport gene PIND (Phytozome database retrieval number Pp6c14_4770), and the full sequence length is 2001 bp, and the specific nucleotide sequence is shown as SEQ ID NO: 1. The ProPIND promoter in the application is derived from the auxin transport gene PIND of Physcomitrella patens, and the encoded protein precisely coordinates key processes such as plant embryo development, auxin polarity transport, tropic response, callus formation and organ regeneration.
[0026] The cells of Physcomitrella patens have a very active homologous recombination repair pathway, which is one of the main mechanisms for repairing DNA double-strand breaks. When a fusion DNA fragment (containing sequences homologous to both sides of the target locus) is introduced into the cells, the cell's own repair mechanism will tend to use this homologous DNA as a template for repair, thereby achieving precise replacement, insertion or deletion of exogenous DNA at a specific location in the genome. The high homologous recombination efficiency of Physcomitrella patens provides a powerful ability to perform efficient, precise and predictable genome editing in plants, including gene knockout, endogenous gene tagging (such as promoter fusion reporter gene) and precise gene replacement / modification. This ability makes Physcomitrella patens unique and irreplaceable in studying basic biological processes of plants (such as development, evolution), functional genomics, and as a platform for plant synthetic biology and biotechnology.
[0027] In the embodiments of the application, using the homologous recombination technology of Physcomitrella patens, using an expression vector containing the ProPIND promoter and a fluorescent marker gene for genetic transformation, a stable genetic plant with tissue or cell-specific expression of the ProPIND fluorescent marker can be obtained, and more precise and efficient visualization tracing of the in vitro leaf cell regeneration process can be achieved.
[0028] The homologous recombination replacement sites PIG1bL and PIG1bR in Physcomitrella patens in the application can be retrieved in the Phytozome genome database (https: / / phytozome-next.jgi.doe.gov / info / Ppatens_v6_1), and the positions of the genomes where they are located are: Chr05:11948570..11949598 and Chr05:11949599..11950547, specifically, the sequences of the replaced homologous arms are shown as SEQ ID NO: 4, and in the sequence shown as SEQ ID NO: 4, 96bp-1124bp is PIG1bL, 1159bp-3159bp is ProPIND promoter, 3193bp-3909bp is GFP, 3946bp-4406bp is Ter, 4460bp-6070bp is Hyg expression cassette, and 6564bp-7512bp is PIG1bR.
[0029] The application also provides a primer pair for amplifying the promoter ProPIND, which comprises a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown as SEQ ID NO: 2, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO: 3.
[0030] The nucleotide sequence of the promoter ProPIND is shown as SEQ ID NO: 1.
[0031] The ProPIND promoter fragment is obtained by PCR amplification with the Physcomitrella patens genomic DNA as a template, and the primer pair comprises ProPIND-F and ProPIND-R, and the primer sequences are as follows:
[0032] ProPIND-F (SEQ ID NO: 2): TTGCGAGGGACGGGG;
[0033] ProPIND-R (SEQ ID NO: 3): TGACGATAACGTTGATTGTCC.
[0034] In the amplification of the ProPIND promoter, the PCR amplification adopts a high-fidelity DNA polymerase, and the reaction procedure is as follows: 95℃ pre-denaturation for 3-5 min; 95℃ denaturation for 15-30 s, 54℃ annealing for 15-30 s, 72℃ extension for 120 s, 35-45 cycles; 72℃ extension for 5-10 min; and 4℃ preservation.
[0035] The application also provides an application of the primer pair in the visual tracing of cell regeneration of the Physcomitrella patens in vitro.
[0036] In the embodiment of the application, the Physcomitrella patens stable genetic material with the ProPIND promoter fused with the GFP fluorescent reporter gene is successfully constructed, the accurate site marking of the ProPIND in the gene locus is realized, and the more accurate and efficient visual tracing application of the promoter in the cell regeneration of the in vitro leaf is effectively promoted by using the high expression characteristics of the ProPIND in the in vitro leaf new protonema.
[0037] The application also provides a visual tracing method for cell regeneration of the Physcomitrella patens in vitro, which comprises the following steps:
[0038] After the promoter ProPIND is fused with the fluorescent marker gene, the ProPIND:: fluorescent marker expression vector is obtained by being constructed into a homologous recombination expression vector.
[0039] The ProPIND:: fluorescent marker expression vector is transformed into the Physcomitrella patens protoplast to obtain a positive Physcomitrella patens transformed plant.
[0040] The fluorescence observation is carried out on the in-vitro leaf of the positive Physcomitrella patens transformation plant, and the visualization tracing of the cell regeneration process of the in-vitro leaf of Physcomitrella patens is realized.
[0041] The present application takes the DNA genome of Physcomitrella patens as a template, and the promoter ProPIND is obtained by PCR amplification of the primer pair ProPIND-F and ProPIND-R. The promoter ProPIND is fused with a fluorescent marker gene, and in an embodiment, the GFP is taken as an example for illustration. In the specific operation, firstly, the pPOG1 vector is double enzyme cut by using endonuclease EcoRI and SalI to obtain a linearized vector, and the amplified promoter ProPIND is connected to the linearized pPOG1 vector to obtain a ProPIND::GFP expression vector.
[0042] The ProPIND::GFP expression vector constructed by the homologous recombination technology is transformed into protoplasts, the preparation material of the protoplasts is the Physcomitrella patens protoplast cultured for 7-10 days, and the positive transformation plant is obtained, so that the fluorescent tracing of the regenerated cells in the in-vitro leaf of Physcomitrella patens is realized. The plasmid mass concentration of the ProPIND::GFP expression vector for genetic transformation is 10-12 μg / μL, 30 μL of plasmid is used for 300 μL of protoplast suspension, and the number of cells in 300 μL of protoplast suspension is about 5×10 5The leaf of the gametophyte is cut to a length of 1.5-2.0 mm, and the in-vitro regeneration time is 2-4 days. After the genetic transformation, the plant can be cultured in an intelligent artificial climate chamber, and the temperature is set to 23-25℃, such as 23℃, 24℃ or 25℃, the light intensity is 60-80 lx, such as 60 lx, 61 lx, 62 lx, 63 lx, 64 lx, 65 lx, 66 lx, 67 lx, 68 lx, 69 lx, 70 lx, 71 lx, 71 lx, 73 lx, 74 lx, 75 lx, 76 lx, 77 lx, 78 lx, 79 lx or 80 lx; the humidity is 40-50%, such as 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49% or 50%; the light and dark intervals are 15-17 h and 7-9 h, respectively, and the culture time is 2-21 days. In an embodiment of the present application, in order to promote the growth and development of Physcomitrella patens, the culture conditions can be determined as a light and dark cycle with a light interval of 16 h and a dark interval of 8 h, and preferably the culture environment has a light intensity of 80 lx, a humidity of 45% and a temperature of 25℃. In an embodiment of the present application, the fluorescent marker used is GFP, so when observing fluorescence, the GFP fluorescence is observed under the condition that the excitation wavelength is 450-490 nm, such as 450 nm, 460 nm, 470 nm, 480 nm or 490 nm.
[0043] After the genetic transformation, the present application further comprises PCR identification, and the primers used in the PCR identification are shown as T-F1, T-R1, T-F2, T-R2, Ubi-F and Ubi-R, wherein the sequences of the primers are as follows:
[0044] T-F1 (SEQ ID NO: 5): AGCCTCGAGTGGATGA;
[0045] T-R1 (SEQ ID NO: 6): GATATCCAAAATGTGATCTAGAGC;
[0046] T-F2 (SEQ ID NO: 7): CCAGACACGAGACGAC;
[0047] T-R2 (SEQ ID NO: 8): CAGATTAGCAAAGCCACC;
[0048] Ubi-F (SEQ ID NO: 9): GTACGTTGGCCGACTAC;
[0049] Ubi-R (SEQ ID NO: 10): CTCCGTCCACGAAAAGA.
[0050] The PCR identification described in the present application can be carried out using a general DNA polymerase, and the reaction procedure is as follows: pre-denaturation at 95°C for 3-5 min; denaturation at 95°C for 15-30 s, annealing at 50°C for 15-30 s, extension at 72°C for 30-120 s, 35-45 cycles; extension at 72°C for 5-10 min; and preservation at 4°C. The PCR product is used for agarose gel electrophoresis.
[0051] In order to further illustrate the present application, the application of the promoter ProPIND provided by the present application in the visual tracing of cell regeneration in the in vitro leaf of Physcomitrella patens is described in detail below in combination with examples, but they should not be understood as limiting the protection scope of the present application.
[0052] Unless otherwise specified, the raw materials used in the present application have no special requirements, and commercially available products well known to those skilled in the art can be used. The reagents, consumables and instruments used in the present application can all use conventional products, among which those used for Physcomitrella patens culture or protoplast transformation need to be sterilized by high-temperature high-pressure sterilization pot or filter. The selected Physcomitrella patens materials in each example and comparative example are in good growth state and have no diseases.
[0053] In the examples of the present application, the number of newly formed protonema attachment points in the in vitro leaf and the GFP fluorescence intensity are statistically processed using software GraphPad prism 8.0 and ImageJ 1.8.0, respectively, and are represented by Means±SEM values. Student's t-test is used to analyze the data differences, and the significance is indicated by asterisks, and *** corresponds to p<0.001.
[0054] Example 1
[0055] The genomic DNA of Physcomitrella patens is extracted, and primers (ProPIND-F and ProPIND-R) are used for PCR amplification. High-fidelity DNA polymerase (item number P112-01, Novozyme) is used for PCR to amplify the ProPIND promoter.
[0056] The PCR reaction procedure is as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 54°C for 15 s, extension at 72°C for 2 min, 35 cycles; extension at 72°C for 5 min; and preservation at 4°C, to obtain the fragment of the ProPIND promoter.
[0057] The pPOG1 vector was double-digested with high-fidelity restriction enzymes EcoRI (Cat. No. R3101V, NEB) and Sail (Cat. No. R3138V, NEB) (digestion reaction temperature was 37°C, and the time was 15 min), and the ProPIND promoter was connected to the double-digested pPOG1 vector using a one-step cloning kit (Cat. No. C112-01, Qiagen) (ligation reaction temperature was 37°C, and the time was 30 min) to obtain the ProPIND::GFP expression vector. The structure of the ProPIND::GFP expression vector is as follows: Figure 1 A.
[0058] Fresh protonema material grown for 7 days was collected and ground in a mortar for polyethylene glycol (PEG)-mediated protoplast transformation. The protonema was prepared into protoplasts, and the cell wall-degrading enzymes involved were a combination of cellulase (Cat. No. C1794, Sigma), hemicellulase (Cat. No. H2125, Sigma), and pectinase (Cat. No. P4716, Sigma) (mass ratio of 1:1:1). The working solution was prepared using an 8% mannitol solution, and the total mass concentration of the cell wall-degrading enzymes in the working solution was 20 mg / mL.
[0059] 10-12 μg of the expression vector containing the ProPIND::GFP fusion fragment (carrying a hygromycin resistance gene expression cassette) was used for Physcomitrella patens protoplast transformation (protoplast preparation and PEG-mediated DNA homologous recombination transformation method refer to the Moss Research Manual published by the National Institute of Basic Biology of Japan (https: / / moss.nibb.ac.jp / )).
[0060] After the transformants were screened on a resistance medium containing 20-40 mg / L hygromycin, genomic DNA was extracted and subjected to PCR amplification and agarose gel electrophoresis at the recombinant gene locus site. Since primers T-R1 and T-F2 were designed on the pPOG1 vector, when primer pair T-F1 / T-R1 was used for amplification, the wild type had no band, and the positive strain had a 2048 bp band; when primer pair T-F2 / T-R2 was used for amplification, the wild type had no band, and the positive strain had a 2030 bp band; primer pair Ubi-F / Ubi-R was used for detecting DNA quality, and both the wild type and the positive strain had a 417 bp band, indicating that the extracted DNA was usable.
[0061] The primer pairs used in the PCR identification were T-F1 / T-R1, T-F2 / T-R2, and Ubi-F / Ubi-R, and the reaction program was 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 50°C annealing for 15 s, 72°C extension for 2 min, 35 cycles; 72°C extension for 5 min; and 4°C storage.
[0062] The results of the identification are as follows Figure 1 As shown in Figure B, after comparison with the wild type, the plants that underwent homologous recombination were identified as positive transgenic plants, resulting in different ProPIND::GFP positive transformants (#1, #2, #3).
[0063] The ProPIND::GFP-positive transformed plant #1 of *Sphaerocarpus spp.* was observed using a stereofluorescence microscope, with a GFP excitation wavelength of 488 nm selected. Results are shown below. Figure 1 In the study, observations using bright-field, GFP detection channels, and the overlap of GFP fluorescence with chloroplast autofluorescence revealed that ProPIND::GFP positive transformant #1 was successfully transformed into the ProPIND::GFP construct and drove the expression of GFP protein. Furthermore, the ProPIND promoter exhibited a specific spatial expression pattern in *Sphaerocarpus septemlobus*, meaning it was not universally expressed in all cells but rather limited to certain specific tissues or cell types, such as high activity in protonemata, rhizoids, and stems, while its activity was lower in leaves.
[0064] Example 2
[0065] Cell regeneration of ProPIND::GFP-positive transformed plant #1 of *Sphagnum moss* was observed using a laser confocal microscope after 2 and 4 days of in vitro leaf treatment, with GFP excitation wavelength of 488 nm selected.
[0066] The results are as follows Figure 2 As shown, observations of bright field, GFP detection channel, and overlap of GFP fluorescence with chloroplast autofluorescence revealed that the expression dynamics of the ProPIND promoter are closely related to the leaf cell regeneration process. This is mainly reflected in: (1) Compared to undamaged leaves, the GFP signal significantly increased in the regeneration region (new protonema cells) of the detached leaf after 2 days, indicating that the ProPIND promoter was specifically activated in the early stages of regeneration; (2) Compared to the GFP signal at 2 days after leaf detachment, the signal at 4 days after leaf detachment continued to increase (quantitative data are shown in the figure). Figure 3 (as shown in the figure), indicating that the ProPIND promoter is continuously involved in the regeneration regulation of isolated leaf cells; (3) Regardless of whether the in vitro treatment was 2d or 4d, the GFP signal was enriched in the regenerated protonema cells, indicating that the ProPIND promoter can be used as a molecular marker for the protonema regeneration capacity in isolated leaves.
[0067] Comparative Example 1
[0068] Genomic DNA was extracted from well-grown WT protonema materials after mortar grinding using the CTAB method and then used for PCR amplification and agarose gel electrophoresis detection.
[0069] Wild-type PCR amplification results are as follows Figure 1As shown in the middle B, the primer pair Ubi-F / Ubi-R detects a 417 bp band, proving that the DNA is of good quality and can be amplified by PCR and detected by agarose gel electrophoresis, but there is no band when the primer pair T-F1 / T-R1 and T-F2 / T-R2 is used for amplification.
[0070] Comparative Example 2
[0071] The only difference between Example 2 and the present example is that the cut leaves in step (1) are not cultured in vitro, but are directly used for laser confocal microscope GFP fluorescence observation.
[0072] The GFP signal is consistent with that in Figure 1 The middle C, the ProPIND promoter has weak activity in the leaves not treated in vitro, and has low expression background in the resting state, so that the expression of GFP is low (Table 1, Table 2, Figure 2 and Figure 3 ). Table 1 shows the number of newly formed protonema attachment points of the in vitro leaves of Example 2 and Comparative Example 2 after being cultured in the growth medium for 2 days and 4 days
[0073]
[0074] Table 2 shows the GFP fluorescence intensity statistics of the in vitro leaves of Example 2 and Comparative Example 2 after being cultured in the growth medium for 2 days and 4 days
[0075]
[0076]
[0077] According to Figure 1 Compared with Comparative Example 1, the ProPIND::GFP positive transformant in Example 1 is a site-specific integration at the PIG1bL and PIG1bR gene loci, and the GFP fluorescence observation result shows that the ProPIND promoter has high expression characteristics in protonema, rhizoid and stem tissues. According to Table 1, Table 2, Figure 2 and Figure 3 According to Table 1, Table 2,
[0078] In summary, the present application successfully constructs a stable genetic material of Physcomitrella patens with ProPIND promoter fused GFP fluorescence reporter gene, realizes accurate site-specific labeling of ProPIND in the gene locus, and effectively promotes more accurate and efficient visual tracing application of the promoter in the cell regeneration process of the in vitro leaves by using the high expression characteristics of ProPIND in the newly formed protonema of the in vitro leaves.
[0079] Although the above embodiments have been described in detail, they are only some embodiments of the present application, not all embodiments. Other embodiments can be obtained on the basis of the above embodiments without creativity, which are within the protection scope of the present application.
Claims
1. The application of the ProPIND promoter in the visualization and tracing of cell regeneration in isolated leaf cells of *Moss sclerotium*, characterized in that... The nucleotide sequence of the promoter ProPIND is shown in SEQ ID NO:
1.
2. Primer pairs for amplifying the promoter ProPIND, characterized in that, The primer pair includes a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown in SEQ ID NO:2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:3; The nucleotide sequence of the promoter ProPIND is shown in SEQ ID NO:
1.
3. The application of the primer pair according to claim 2 in the visualization and tracing of cell regeneration in isolated leaf cells of *Moss sphaerocephala*.
4. A visual tracing method for cell regeneration in detached leaves of *Moss sphaerocephala*, characterized in that, Includes the following steps: After fusing the promoter ProPIND with the fluorescently labeled gene, the expression vector was constructed into a homologous recombination expression vector to obtain the ProPIND::fluorescently labeled expression vector. The ProPIND:: fluorescently labeled expression vector was transformed into the protoplasts of *Bryum simonii* to obtain positive *Bryum simonii* transformed plants; Fluorescence observation was performed on detached leaves of positive *Sclerotium spp.* to visualize and trace the cell regeneration process of detached leaves.
5. The visual tracing method according to claim 4, characterized in that, The promoter ProPIND is obtained by PCR amplification using the DNA genome of *Styrax styrax* as a template and the primer pair described in claim 2.
6. The visual tracing method according to claim 4, characterized in that, The fluorescently labeled gene includes the GFP gene.
7. The visual tracing method according to claim 4 or 6, characterized in that, The homologous recombination expression vector includes the pPOG1 vector.
8. The visual tracing method according to claim 4, characterized in that, The material used to prepare the protoplasts of *Bryum simonii* was *Bryum simonii* protoplasts cultured for 7–10 days.
9. The visual tracing method according to claim 4, characterized in that, The method for obtaining the detached leaf is as follows: cut a leaf with a length of 1.5 to 2.0 mm from the gametophyte and culture it in vitro for 2 to 4 days.
10. The visual tracing method according to claim 4, characterized in that, The fluorescence observation includes observing GFP fluorescence under an excitation wavelength of 450–490 nm.