Application of corn Zm00001eb045640 gene in regulation and control of plant grain development

Abstract

The invention relates to the field of molecular biology, in particular to application of a corn Zm00001eb045640 gene in regulation and control of plant grain development. The CDS sequence of the corn Zm00001eb045640 gene is as shown in SEQ ID NO. 1, and the sequence of the protein coded by the CDS sequence is as shown in SEQ ID NO. 2. According to the invention, the corn gene Zm00001eb045640 is cloned by using seedling leaves of a corn inbred line B73, the function of the gene is studied from the phenotypes of a corn EMS mutant and transgenic arabidopsis thaliana, and a new choice is provided for increasing the corn yield and improving the quality.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular biology, in particular to the application of a maize Zm00001eb045640 gene in regulating plant kernel development. BACKGROUND

[0002] Maize is an important food and feed source, and plays an important role in national production. Cultivating high-yield and high-quality maize hybrids is the main measure to improve maize yield and quality. The main traits affecting maize yield are 100-kernel weight and kernel size, and the main traits affecting maize kernel quality are starch types.

[0003] Currently, there are few reports on genes that can simultaneously regulate 100-kernel weight and starch types of maize. In recent years, single genes have been gradually improved to increase maize yield or quality, such as maize zmarf2 (Zm00001eb019130) mutants exhibit smaller kernels, and mutation of ARFTF17 gene in dent maize can reduce IAA content in seed coat, thereby producing hard kernel phenotype. In addition, knocking out ZmPEPL1 gene in maize reduces amylose content. However, there are relatively few studies on genes that can simultaneously affect 100-kernel weight and starch types of maize.

[0004] Maize is a major food and feed crop worldwide. Improving its yield per unit area is of great strategic significance to address population growth, climate change challenges, and ensure global food security and sustainable agricultural development. Kernel size is one of the key factors determining maize yield per unit area. Analyzing its regulatory gene network provides direct targets for breaking through yield bottlenecks. Identifying key genes and their excellent allelic variations can cultivate large-grain high-yield varieties and accelerate the breeding process. SUMMARY

[0005] Therefore, the present application aims to provide the application of a maize Zm00001eb045640 gene in regulating plant kernel development. The present application clones maize gene Zm00001eb045640 from maize inbred line B73 seedling leaves, and studies the function of the gene from the phenotype of maize EMS mutants and transgenic Arabidopsis, thereby providing a new choice for improving maize yield and quality.

[0006] To achieve the above-mentioned purpose, the present application provides the following technical solutions:

[0007] The present application provides the application of a maize Zm00001eb045640 gene or its related biological material in regulating any one of the following:

[0008] (a) regulating plant kernel starch type;

[0009] (b) regulating plant kernel weight;

[0010] (c) modulating grain length of a plant;

[0011] (d) modulating grain width of a plant;

[0012] (e) modulating grain development of a plant;

[0013] (f) modulating yield of a plant;

[0014] The CDS sequence of the corn Zm00001eb045640 gene is shown as SEQ ID NO. 1.

[0015] Preferably, the protein sequence encoded by the CDS sequence is shown as SEQ ID NO. 2.

[0016] Preferably, the related biological material includes an expression cassette, a recombinant vector, a recombinant bacterium or a transgenic cell line containing the corn Zm00001eb045640 gene.

[0017] Preferably, the modulation includes:

[0018] The expression amount and / or activity of the Zm00001eb045640 gene in the plant is reduced, which promotes the amylose content synthesis of the grain of the plant.

[0019] The expression amount and / or activity of the Zm00001eb045640 gene in the plant is reduced, which increases the grain weight and / or grain length and / or grain width and / or grain development and / or yield of the plant.

[0020] Preferably, the plant is corn.

[0021] The application also provides a method for cultivating high-yield and high-quality plants, which comprises genetically editing the corn Zm00001eb045640 gene to reduce its expression, so as to improve the yield and quality of the plants.

[0022] Preferably, the plant is corn.

[0023] At least the following beneficial technical effects are included:

[0024] The application first provides a method for improving the yield and amylose content of corn by using the corn Zm00001eb045640 gene, which improves the yield and amylose content of corn by reducing the expression of the corn Zm00001eb045640 gene, and provides a new molecular breeding approach for cultivating high-yield and high-amylose varieties, which has a broad application prospect. The application can significantly increase the length, width, thickness, hundred-grain weight, bulk density and amylose content of corn kernels. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 Figure 4 is a bioinformatics analysis diagram of Zm00001eb045640, wherein A is domain analysis, B is tertiary structure prediction of protein, C is 2 kb sequence upstream of promoter, and D is phylogenetic tree.

[0026] Figure 2 Figure 5 is a comparison result of wild type and transgenic Arabidopsis seed and silique length; wherein A is a column chart of seed length comparison of each group, B-E are observation photos of seed length comparison of each group; F is a column chart of silique length comparison of each group, and G-J are observation photos of silique length comparison of each group.

[0027] Figure 3 Figure 6 is an identification diagram of EMS homozygous mutant of gene Zm00001eb045640 with B73 as background.

[0028] Figure 4 Figure 7 is a comparison diagram of kernels of corn mutant EMS3-0a1dd2 and inbred line B73, wherein A is kernel length, B is kernel width, C is average 100-kernel weight, and D is average bulk density.

[0029] Figure 5 Figure 8 is different types of starch content in corn mutant EMS3-0a1dd2 and inbred line B73. DETAILED DESCRIPTION

[0030] All other embodiments obtained by a person of ordinary skill in the art based on the embodiments in the present application without creative labor are within the scope of protection of the present application. The present application is described below with reference to specific embodiments, and it should be noted that these embodiments are merely descriptive and do not limit the present application in any way.

[0031] Example 1 Cloning of corn Zm00001eb045640 gene

[0032] Total RNA was extracted from the young leaves of maize inbred line B73 at the three-leaf stage using an RNA extraction kit (Chengdu Fuji Biological) according to the instructions. The cDNA was synthesized using a reverse transcription kit (Chengdu Fuji Biological) with total RNA as a template. The sequence number Zm00001eb045640 was queried on the Maize GDB (https: / / www.maizegdb.org / ) website. The primers were designed using the NCBI (Primer designing tool (nih.gov)) online tool as shown in Table 1. The cDNA of inbred line B73 was used as a template for PCR amplification using high-fidelity Taq polymerase (Beijing Thermo Fisher Scientific). The PCR amplification reaction system is shown in Table 2. The temperature cycle program is as follows: 98℃, 10s; 58℃, 15s; 72℃, 2.2min; 34 cycles; 72℃, 10min; 4℃, hold. Finally, the complete Zm00001eb045640 gene fragment was obtained.

[0033] The CDS sequence of the maize Zm00001eb045640 gene

[0034] The nucleotide sequence is shown in SEQ ID NO. 1:

[0035]

[0036] The protein encoded by the maize Zm00001eb045640 gene

[0037] The amino acid sequence is shown as SEQ ID NO. 2:

[0038] MKEVAEERCLDPQLWHACAGGMVQMPPVRSRVYYFPQGHAEHAHGGGAADLAGARALPSLVLCSVTGVRFLADPETDEVFAKIRLVPVAPGEVEFREPDEFSVDPADAREKLSSFAKTLTQSDANNGGGFSVPRYCAETIFPKLDYRADPPVQTVLAKDVHGEVWKFRHIYRGTPRRHLLTTGWSTFVNQKKLVAGDSIVFLRTEHGELCVGIRRVKRVSCGGMECMSGWNAPGYGALSAFLKDEEGKMMKSHGGYMRGRGKVKITDVVNAASLAASGQPFEVVYYPRASTPEFVVKAASVQNAMRNQWCPGMRFKMAFETEDSSRISWFMGTIASAQVADPIRWPNSPWRLLQVLLDHMFPILVAWDEPDLLQNVKCVNPWLVEIVSSIPPIHLGPFSPPRKKLRVPHHPDFPFDGQLLNPIFHGNPLGPSNGGGALRCFSDIAPAGIQGARHAQFGLPLTDRQLNKLHLGLFQGGGFKRRLDAITPPCPISRGFVIGSAPVDESVSCVLTIGTPRAAERSDDRKKPHLMLFGKPILTEQQMSSRGSRETLSPEATGNSSDGSVQKTGNVSDGSGSSICIGSSSRGREASRLGFEFEAGHCKVFVESEDVGRTIDLSVFGSYEELYGQLADMFGIEKAEVMSHLCYRDAAGAVKRTGDEPFCDFMKVARRLTIVESTEGRLQKPLVEYMA.

[0039] Table 1 Zm00001eb045640 cloning primers

[0040]

[0041] Table 2 PCR amplification reaction system

[0042] Materials Volume (μl) PrimeSTAR HS (Premix) 25 10 μL 1 Primer F 1 10 μL 1 ddH2O 22

[0043] The number of amino acids, relative molecular weight, and physicochemical properties of the theoretical isoelectric point encoded by Zm00001eb045640 (ZmARFTF2) were analyzed using the online tool ProtParam (https: / / web.expasy.org / protparam / ). The conserved domains of this gene Zm00001eb045640 were analyzed using NCBI's Identify Conserved Domains with CD-Search. SPOMA (https: / / npsa-prabi.ibcp.fr / cgi-bin / npsa_automat.pl?page= / NPSA / npsa_sopma.html) was further applied to predict the tertiary structure of the protein; TMHMM2.0 (http: / / www.cbs.dtu.dk / services / TMHMM-2.0 / ) was used for transmembrane analysis of the amino acid sequence; PlantCARE (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) was used to analyze the cis-acting elements of the 2kb sequence upstream of the gene promoter. The amino acid sequences of 40 ZmARF gene families from maize were downloaded from the NCBI website, and a phylogenetic tree was constructed using the neighbor-street method in MEGA11 software. The results showed that the ZmARFTF2 gene coding sequence was 2076 bp in length, encoding 691 amino acids. Domain analysis of ZmARFTF2 revealed that it possesses conserved domains specific to the B3 subfamily and the Auxin_resp subfamily. Primer R A). The tertiary structure of the ZmARFTF2 protein was predicted, showing an isoelectric point of 7.92, a relative molecular mass of 75.7 kDa, and an irregular coil proportion of 66% (A). 10 μL B). Analysis of the 2kb upstream sequence of the gene promoter revealed that this sequence contains elements related to the ABA synthesis pathway, drought induction, gibberellin response, and cis-regulatory elements involved in endosperm expression. cDNA C). Phylogenetic analysis of 40 genes in the maize ARF family showed that ZmARFTF2 and ZmARFTF17 are most closely related. 10 μL D).

[0044] Example 2: Vector construction, genetic transformation, and identification of the maize Zm00001eb045640 gene.

[0045] 1. Construction of Arabidopsis thaliana transformation vector 35S-Zm00001eb045640

[0046] According to the plant expression vector super1300 multiple cloning site, a Hind III restriction site was introduced into the upstream primer, and a Hind III site was introduced into the downstream primer. The vector primer specific sequences are shown in Table 3.

[0047] Table 3 Construction of vector primers

[0048]

[0049] According to the reaction system in Table 2, the amplification was performed. The temperature cycle program was: 98℃, 10s; 58℃, 15s; 72℃, 2.2min; 34 cycles; 72℃, 10min; 4℃ holding.

[0050] The PCR product was recovered, and the recovered product and super1300 plasmid were single-cut. The single-cut reaction system was added according to Table 4. The enzyme cutting system was mixed and the recovered product and super1300 plasmid vector were connected according to the connection system in Table 7.

[0051] Table 4 Single-cut reaction system

[0052] Figure 1 Figure 1 Figure 1 Figure 1 Reagents Volume 2 x Buffer 10 μL ddH2O Hind III

[0053] Table 5 Connection system

[0054] 1 μL super1300 1 μL Upto 20.0 μL Components Volume Linearized vector super1300 2.0 μL Zm00001eb045640-Hind III 2.0 μL ddH2O 5 x CE II Buffer

[0055] The recombinant plasmid was transformed into E. coli, and the colonies were subjected to PCR detection. After the plasmid was extracted and subjected to enzyme digestion identification, it was sent to a sequencing company for sequencing identification. The plasmid with correct sequencing was used for Arabidopsis transformation.

[0056] 2. Arabidopsis positive identification

[0057] 2.1 Transformation of Arabidopsis by inflorescence infection method

[0058] To explore the function of the Zm00001eb045640 gene, the 35S-Zm00001eb045640 recombinant vector was transformed into Arabidopsis wild type Col (Columbia) by Agrobacterium-mediated inflorescence infection method.

[0059] 2.1.1 Transformation by inflorescence infection method

[0060] The Agrobacterium GV3101 containing the recombinant plasmid was streaked on YEP solid medium containing KANA and Rif antibiotics, and cultured at 28℃ for 3 days.

[0061] The monoclonal Agrobacterium colony was inoculated in liquid medium containing KANA and Rif antibiotics, and cultured at 28℃, 200r / min, and shaking overnight.

[0062] After amplifying the Agrobacterium tumefaciens bacterial suspension, wait for the OD of the bacterial suspension to reach a certain value. 600 When the bacterial cell concentration reaches between 1.0 and 1.2, centrifuge at 4500 rpm for 10 minutes to collect the cells. Then, quickly suspend the cells in an equal volume of osmotic medium (5% sucrose solution) for later use. Add 0.01% Silwet L-77 to the suspension, then pour the infection solution into a large-mouthed petri dish. Cut off any open flowers and pods of Arabidopsis thaliana, and place healthy, unopened flower buds in the suspension for 2 minutes. Cover the dish with a black plastic bag and incubate in the dark for 12 hours. After removing the plastic bag, expose the dish to light for 16 hours, then incubate in the dark for 8 hours. Incubate normally at 28°C until harvesting, and proceed to the next screening step.

[0063] 2.1.2 Screening of transgenic Arabidopsis thaliana lines

[0064] Harvested Arabidopsis thaliana T0 generation seeds were placed in 2 mL EP tubes and screened on 1 / 2 MS medium containing 50 mM KANA antibiotic in a sterile operating table. After sealing, the tubes were placed in a 4°C refrigerator for vernalization for 3 days. Green, suspected positive seedlings at the 4-leaf stage were planted in the soil. At the 8-leaf stage, DNA was extracted from each Arabidopsis thaliana plant, with wild-type Col DNA used as a negative control. PCR was performed on the seedlings, and positive seedlings were marked. At maturity, positive plants were harvested and named OE1, OE6, and OE7 for further propagation. Seedling leaves were used for PCR detection, ultimately yielding T3 generation positive Arabidopsis thaliana seeds transformed with the Zm00001eb045640 gene, representing three transformation events: OE1, OE6, and OE7.

[0065] 3.1 Phenotypic identification of Arabidopsis thaliana seeds

[0066] The expression levels of T3 generation plants were analyzed by qPCR (qPCR detection primers are shown in Table 6). The average size of five pods from wild Arabidopsis thaliana Col and transgenic T3 generation homozygous lines was measured 20 days after flowering. After the seeds matured, they were photographed using a stereomicroscope, and the average length of 10 Arabidopsis thaliana seeds was measured using ImageJ software.

[0067] Overexpression of Zm00001eb045640 in Arabidopsis thaliana resulted in three independent transformation events: OE-1, OE-6, and OE-7. The Zm00001eb045640 gene was expressed to varying degrees in all three transformation events. These transformation events will be used for subsequent phenotypic analysis. To evaluate the effect of Zm00001eb045640 on seed size, homozygous seeds of wild-type Col and transgenic T3 generations (OE-1, OE-6, OE-7) were observed and photographed under a stereomicroscope. It was found that the length of T3 generation transgenic seeds was significantly smaller than that of Col. Measurements of pod size showed that the pods of T3 generation transgenic Arabidopsis thaliana were significantly shorter than those of wild-type Col. 4.0 μL ).

[0068] Table 6 qPCR detection primers

[0069] Exnase II 2.0 μL Upto 20.0 μL Figure 2

[0070] 4. Screening of homozygous EMS mutants of corn

[0071] An EMS mutant of gene Zm00001eb045640 with B73 as background is obtained from a maize EMS induced mutant library maizeEMSDB (maizeEMSmutant (qlnu.edu.cn)), and the mutant is named EMS3-0a1dd2, which is sold by Qilu Normal College and can be obtained by the public. After sequencing (see Table 7 for sequencing primers), it is found that the EMS mutant EMS3-0a1dd2 of Zm00001eb045640 (ZmARFTF2) has a single base mutation from C to T at a physical position (Chr 1 Pos: 230779561), the encoded amino acid is changed from glutamine to a stop codon, which causes a premature stop codon, resulting in loss of function of the gene. ARFTF2-dF The F2 progeny seed phenotypes constructed by using the homozygous mutant EMS3-0a1dd2 and B73 are statistically analyzed, and it is found that the proportion of dent type: hard type = 228:63, χ2test shows that the dent type and hard type corn ear are in accordance with the segregation ratio of 3:1 (χ2=1.6503, P<0.05), indicating that the hard type of corn seed is controlled by a single recessive gene Zm00001eb045640.

[0072] Table 7 Sequencing primers of mutant EMS3-0a1dd2:

[0073] AACAGACCGCCAGCTTAACA (SED ID NO. 7) ARFTF2-dR AAGCCCCTGGATATAGGGCA (SED ID NO. 8) Figure 3

[0074] 5. Function verification of gene Zm00001eb045640

[0075] Compared with inbred line B73, the grain length and grain width of corn mutant EMS3-0a1dd2 are obviously larger, and the hundred-grain weight and volume weight, amylose content are obviously increased. EMS-F CTTCCCCAAGCTCGACTACC (SED ID NO. 9) EMS-R CGCATCAGCTCACAATGCAG (SED ID NO. 10) Figure 4-5

[0076] Based on the above research results, it can be known that the Zm00001eb045640 gene provided by the application is a gene for controlling the size of corn kernels and starch type, and the mutation thereof can cause the kernels to become larger and the hundred-grain weight to increase, which can be utilized in the process of corn seed production.

[0077] The above only describes the preferred embodiments of the application, and it should be noted that those skilled in the art can make several improvements and refinements without departing from the principles of the application, and these improvements and refinements should also be regarded as the protection scope of the application.​

Claims

1. A use of a maize Zm00001eb045640 gene or a related biological material thereof in regulating any of the following: (a) regulating starch type of a plant grain; (b) regulating grain weight of a plant; (c) regulating grain length of a plant; (d) regulating grain width of a plant; (e) regulating grain development of a plant; (f) regulating yield of a plant; a CDS sequence of the maize Zm00001eb045640 gene is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, a protein sequence encoded by the CDS sequence is shown as SEQ ID NO.

2.

3. Use according to claim 2, characterized in that, the related biological material comprises an expression cassette, a recombinant vector, a recombinant bacterium or a transgenic cell line containing the maize Zm00001eb045640 gene.

4. Use according to claim 1, characterized in that, the regulation comprises: a decreased expression amount and / or activity of the Zm00001eb045640 gene in the plant, which promotes amylose content synthesis of a grain of the plant; a decreased expression amount and / or activity of the Zm00001eb045640 gene in the plant, which increases grain weight and / or grain length and / or grain width and / or grain development and / or yield of the plant.

5. Use according to claim 4, characterized in that, the plant is maize.

6. A method of breeding a high yield, high quality plant, comprising, the method comprises gene editing the maize Zm00001eb045640 gene to be lowly expressed, so as to improve yield and quality of a plant.

7. A method for cultivating high-yield, high-quality plants, characterized in that, the plant is maize.

Images