Application and method of uORFTaGGP1 element

Abstract

The invention belongs to the technical field of biology, and relates to application and a method of a uORFTaGGP1 element. The method comprises the following steps: destroying an endogenous uORFTaGGP1 element sequence of a receptor plant by utilizing gene editing to obtain a homozygous mutant which does not contain an exogenous gene; by taking a CRISPR / Cas9 system as an example, a homozygous uorfTaGGP1 without an exogenous gene is created, translation of a wild type uORFs in a target gene is destroyed, expression of the target gene is improved, and a mutant plant has higher yield than the wild type plant under a drought condition. Under normal growth conditions, growth phenotypes and yield-related indexes of mutant plants are not affected by comparison with those of a control group. In order to improve the expression of a target gene in polyploidy wheat and create a new wheat germplasm which is drought-resistant, does not influence plant growth and is free of exogenous gene integration, the invention plays an important role in molecular design breeding for regulating the balance between drought resistance and yield of wheat.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to... GGP1 Gene translation regulatory elements. Background Technology

[0002] wheat( Triticum aestivum Wheat (L.) is one of the most important staple crops for humans. Drought has become one of the most critical abiotic stress factors affecting wheat yield in agricultural production. Therefore, how to improve the drought resistance of wheat is an important research topic in agricultural breeding. Studies have reported that the drought resistance of plants can be enhanced through genome editing or overexpression of the protein-coding sequences (CDS) of drought-related genes. However, these strategies are subject to certain controls or may affect plant growth and development in practical applications.

[0003] uORFs are cis-acting elements located in the 5'UTR of mRNA. They regulate gene expression at the translational level and typically have the function of inhibiting downstream gene expression. Studies have shown that genome editing of endogenous uORFs in plants can regulate the expression of target genes to varying degrees, achieving in situ overexpression. Compared to overexpression mediated by traditional transgenic technology, this strategy can achieve heritable and varying degrees of regulation of target gene expression in offspring, thereby improving crop traits. For example, application CN112969791A discloses an experimental approach that uses gene editing technology to induce mutations in the uORF of SIRT, thereby increasing the sugar content of tomatoes.

[0004] Increasing the ascorbic acid (vitamin C) content in plants helps them scavenge excess reactive oxygen species (ROS), protects plants from oxidative damage caused by drought stress, and improves the drought resistance of plants.

[0005] Although research has shown that genome editing of uORF can be used... GGP1 It is possible to precisely increase the vitamin C content in plants; however, in allopolyploid wheat with a complex genetic background... GGP1 The function of uORFs in genes and their role in regulating plant drought have not yet been studied. In order to improve the expression of target genes in polyploid wheat and create new wheat germplasm that is drought-resistant and does not affect plant growth without the integration of foreign genes, our research group has conducted in-depth research. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention proposes a uORF... TaGGP1 Application and methods of components.

[0007] The technical solution of this invention is implemented as follows: This application research discovered TaGGP1 uORF elements in genes, uORF TaGGP1 The components are TaGGP1 Conserved uORFs in different subgenomes of a gene.

[0008] On the one hand, it requests protection, uORF TaGGP1 The application of the components, the above applications are selected from any of the following: (1) Regulating plant drought resistance; (2) Cultivate non-GMO plants with improved drought resistance; (3) Cultivate non-transgenic plants with improved drought resistance and no impact on plant yield.

[0009] Furthermore, the aforementioned uORF TaGGP1 The components are uORFs using ATCACG as the start codon. Preferably, the above uORFs... TaGGP1 The nucleotide sequence of the element is as described in uORF. TaGGP1 The nucleotide sequence of the element is shown in any one of SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3.

[0010] The above applications are achieved by disrupting or modifying uORF. TaGGP1 This is achieved through the nucleotide sequence of the element. The disruption refers to causing uORF... TaGGP1 The element produces substitutions, deletions, or additions of one or more nucleotides, thereby affecting uORF. TaGGP1 The function of the component; modified to be for uORF TaGGP1 The nucleotide sequence of the element is modified, thereby affecting the uORF. TaGGP1 The function of the component.

[0011] Furthermore, the aforementioned uORF TaGGP1 The component can also be uORF TaGGP1 The element encodes an amino acid sequence, said amino acid sequence being shown in any one of SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 6.

[0012] On the other hand, the present invention provides a method for cultivating highly drought-resistant wheat, the steps of which are: using gene editing technology to destroy the uORF of the wheat plant to be improved. TaGGP1 By using the element, a homozygous variety without exogenous genes can be obtained, which is a highly drought-resistant wheat.

[0013] Furthermore, the gene editing systems employed in the aforementioned gene editing technologies are any one of the following: zinc finger nuclease systems (which bind to target DNA through the design of specific zinc finger proteins; after fusion with the FokI ribozyme domain, they are introduced into cells; the zinc finger proteins bind to both sides of the target DNA; FokI dimerizes and cleaves the DNA double strand; cell repair leads to gene mutation or editing), TALEN systems (which bind to target DNA through the design of specific TAL repeat modules; after fusion with the FokI ribozyme domain, they are introduced into cells; TALEN binds to both sides of the target DNA; FokI dimerizes and cleaves the DNA double strand; cell repair leads to gene mutation or editing), and CRISPR systems.

[0014] The above uORF TaGGP1 The nucleotide sequence of the element is shown in SEQ ID No. 1.

[0015] Thirdly, a method is provided for cultivating non-transgenic wheat with improved drought resistance but unaffected yield. The cultivated wheat mutant plants exhibit higher drought resistance under drought conditions than the recipient plants, while their yield under normal growth conditions is no different from the control.

[0016] The aforementioned genome editing disrupts the receptor plant's endogenous uORF TaGGP1 The component sequence is to enable uORF TaGGP1 The sequence undergoes a frameshift mutation; the mutation results in a decrease or absence of expression of the polypeptide encoded by the uORF, or the mutation results in a decrease or absence of activity of the polypeptide encoded by the uORF.

[0017] The aforementioned genome editing includes transient transformation into the gene editing system, thereby producing drought-resistant non-transgenic wheat. It also includes stable transformation into the gene editing system, whereby exogenous nucleotide sequences encoding components of the gene editing system are integrated into the plant genome, further comprising obtaining drought-resistant non-transgenic plants without the integrated exogenous nucleotide sequences through genetic isolation.

[0018] In any of the above-described applications or methods, the plant is a dicotyledonous plant or a monocotyledonous plant; further, the monocotyledonous plant is a grass; and even further, the grass is wheat. In a specific embodiment of the present invention, the wheat variety is specifically Fielder.

[0019] The invention has the following beneficial effects: This invention utilizes gene editing to disrupt the recipient plant's endogenous uORF TaGGP1 Element sequences were obtained to produce homozygous mutants without exogenous genes; taking the CRISPR / Cas9 system as an example, homologous genes encoding the rate-limiting enzyme in the vitamin C synthesis pathway in wheat were analyzed based on the CRISPR / Cas9 system. TaGGP1Knockout mutations were performed on conserved uORFs to create homozygous genes without foreign gene integration. uorf TaGGP1 The mutant disrupts the translation of wild-type uORFs in the target gene, increases the expression of the target gene, and increases the vitamin C content in the mutant plants. Drought experiments also showed this. uorf TaGGP1 The mutant plants exhibited improved drought tolerance, and their thousand-grain weight was higher than the control after drought treatment. However, yield-related indicators of the mutant plants were not affected under normal growth conditions compared to the control. This invention plays an important role in molecular design breeding for regulating the balance between drought resistance and yield in wheat. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 uORF for artificially mutated start codons TaGGP1 Statistical analysis results of the protein expression effect of the LUC reporter gene.

[0022] Figure 2 artificially mutated uORF TaGGP1 The impact on the abundance of LUC reporter gene transcripts.

[0023] Figure 3 The obtained homozygous genome was free of foreign gene integration. uorf TaGGP1 Sequencing results of the mutant.

[0024] Figure 4 uORF generated by CRISPR / Cas9 mutation TaGGP1 The effect of sequence on LUC protein.

[0025] Figure 5 Homozygous and without foreign gene integration uorf TaGGP1 In mutants TaGGP1 Transcription levels.

[0026] Figure 6 It is homozygous and has no foreign gene integration. uorf TaGGP1 Determination of vitamin C content in mutant plants.

[0027] Figure 7Under normal growth and drought stress, the cells are homozygous and without foreign gene integration. uorf TaGGP1 Identification of mutants and wild drought phenotypes.

[0028] Figure 8 Under normal growth and drought stress, the cells are homozygous and without foreign gene integration. uorf TaGGP1 Determination of drought-related physiological indicators in mutant and wild-type plants.

[0029] Figure 9 It is homozygous and has no foreign gene integration. uorf TaGGP1 Statistical analysis of effective tiller number, total number of grains per plant, thousand-grain weight (a), and seed phenotype (b) of wheat strains with different mutants under normal conditions.

[0030] Figure 10 This is a plasmid map of the pBUE413 vector.

[0031] Figure 11 uORF TaGGP1 With uORF AtGGP1 Amino acid homologous sequence alignment diagram.

[0032] Figure 12 This is a P-gel electrophoresis image of Agrobacterium bacteria containing the correct sgRNA1 and sgRNA2. Detailed Implementation

[0033] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0034] Unless otherwise specified, all experimental materials used in the following examples were purchased from conventional biochemical reagent stores. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0035] The biomaterials used in the following examples are as follows: The pBUE413 vector was a plasmid independently modified in this experiment, and its spectrum is as follows: Figure 10As shown. The Agrobacterium tumefaciens strain EHA105 is described in the literature "Qu LQ, Xing YP, Liu WX, Xu XP, Song YR. (2008) Expression pattern and activity of six glutelingene promoters in transgenic rice. Journal of Experimental Botany 59: 2417–2424.", and is available to the public from the College of Agriculture, Henan University; The wild-type wheat material is the variety "Fielder" ( Triticum aestivum L. cv. Fielder) is described in the document "Xing, HL et al. (2014) A CRISPR / Cas9 toolkit for multiplex genomeediting in plants. BMC Plant Biology 14: 327-335. The public can obtain it from the College of Agriculture, Henan University.

[0036] Example 1: TaGGP1 Acquisition of conserved translational regulatory elements uORFs in homologous genes and the 5'UTR region 1. Arabidopsis thaliana was identified in the hexaploid wheat Fielder genome by comparing its DNA and amino acid sequences. AtGGP (AtVTC2) Homologous genes in wheat TaGGP1 .

[0037] 2. According to reports AtGGP1 uORFs in TaGGP1 The amino acid sequence comparison diagram of the 5'UTR region of the gene is shown below. Figure 11 As shown, copies of this gene in different subgenomes were found to contain conserved uORFs with ATCACG as the start codon.

[0038] Example 2: Transient experimental detection of conservative uORF TaGGP Effects on LUC transcripts and protein activity 1. Take wheat Fielder seeds, soak them in water at room temperature until they swell for 48 hours, then place them in a 4°C refrigerator to germinate for 24 hours. Transfer the germinated wheat seeds to nutrient soil and cultivate for two weeks. Take the whole plant, quick-freeze it in liquid nitrogen, grind it to extract total RNA, perform reverse transcription, and obtain cDNA.

[0039] 2. Using the cDNA obtained in step 1 as a template, design specific primers (as shown in Table 1) to amplify and obtain... TaGGP1The wild-type sequences of -A / B / D-uORFs were obtained, and then the start codons were artificially mutated to AAA using seamless cloning. The 5' UTR sequences containing wild-type uORFs and artificially mutated inactivated uORFs were constructed into dual-luciferase reporter vectors, respectively. The successfully modified vectors were transformed into wheat protoplasts for transient expression. After 48 hours of culture in the dark, LUC / REN protein activity was detected. The results showed that the artificially mutated... TaGGP1 uORFs in different subgenomes can significantly increase the activity of LUC / REN protein compared to wild-type sequences. Figure 1 ).

[0040] Table 1. PCR primer sequences used in this study 3. Two dual-luciferase reporter system vectors of wild-type and artificially mutant uORFs were transformed into wheat protoplasts. After culturing in the dark for 48 h, the cells were collected, lysed, and total RNA was extracted and reverse transcribed into cDNA for real-time quantitative PCR. The results showed that compared with wild-type uORFs, the artificially mutant... TaGGP1 uORFs on different subgenomes did not significantly alter the transcript levels of the LUC reporter gene. Figure 2 Preliminary explanation TaGGP1 uORFs present in genes regulate the expression of downstream genes at the translational level rather than the transcriptomic level.

[0041] Example 3: uORF TaGGP1 Application of components in regulating wheat drought resistance I. Obtaining Targeted Modified Conserved uORF TaGGP1 CRISPR / Cas9 vector 1. Targeting uORF TaGGP1 sgRNA design Through the TaGGP1 Sequence analysis revealed that the uORFs of this gene are highly conserved across different copies, but certain SNPs still exist between different subgroups. Therefore, we designed two sgRNA sequences for the uORFs of each gene. Figure 3 ): sgRNA1:TGGGCCGTTGAAAGTCATCA; sgRNA2: TGGACCGTTGAAAGTCATCA.

[0042] These two sgRNA sequences can target and cover the translation initiation regions of uORFs in the three subgenomes A, B, and D. The aim is to induce base deletions or insertions in the uORF translation initiation structures, disrupting uORF translation and thus relieving the repressive effect of wild-type uORFs on the expression of downstream genes.

[0043] 2. Targeting uORF TaGGP1 Construction of CRISPR / Cas9 vectors The above design is targeted to uORF using the Gibson Assembly method. TaGGP1 The sgRNAs were constructed into the pBUE413 dual-target gene editing system vector, and then transformed into Agrobacterium tumefaciens strain EHA105 via chemical transformation. After PCR detection, recombinant Agrobacterium uORF containing the correct sgRNAs was obtained. TaGGP1 -sgRNAs, electrophoresis results are as follows Figure 12 As shown.

[0044] 3. uorf TaGGP1 Creation of wheat mutants Recombinant Agrobacterium uORF TaGGP1 -sgRNAs were transformed into wild-type wheat Fielder using embryogenic callus infection to obtain T0 generation transgenic wheat plants. These T0 generation mutants were then subjected to next-generation sequencing in uORF. TaGGP1 Among the transgenic plants with -sgRNAs sites, there were 2 wild-type and 11 mutant plants (any subgenomic mutation is considered a mutant).

[0045] The specific steps of the Agrobacterium-mediated wheat genetic transformation process described above are as follows: (1) Obtaining callus induced from mature wheat embryos: After wheat matured and dried, the seeds were dehulled and placed in a sterile 100mL Erlenmeyer flask. 70% alcohol was added to the flask for surface sterilization for 45 seconds, during which the flask was continuously shaken. The seeds were then transferred to a 2.5% sodium hypochlorite solution, and one drop of Triton X-100 was added. The seeds were then placed in a shaker at 28℃ and shaken at 200rpm for 15 minutes for sterilization. The seeds were then transferred to another 2.5% sodium hypochlorite solution and shaken at 28℃ and 200rpm for 15 minutes for sterilization. After discarding the sterilizing solution, the seeds were repeatedly rinsed with sterile distilled water until the rinsed solution was clear and free of foreign matter. The seeds were poured out onto a petri dish lined with sterile filter paper and air-dried in a lap hood for 45 minutes. The seeds were then placed on N6D solid culture medium and incubated in a 28℃ incubator for 4 weeks. Select tender, smooth, embryogenic callus and subculture it on fresh N6D solid medium. After culturing for 5 days, it can be used for Agrobacterium transformation.

[0046] (2) Culture of Agrobacterium: Agrobacterium, which has been transformed and stored at -80℃, is streaked onto YEB solid medium containing the corresponding antibiotic for activation. Then, Agrobacterium is incubated at 28℃ for 3 days. Well-grown single clones are picked and streaked again on YEB solid medium containing the corresponding antibiotic for activation. After incubation at 28℃ for 1 day, a match head-sized piece of solid strain is scraped off with a sterile spatula and suspended in 30 mL of AAM (acetylsyleugenol final concentration of 40 mg / L) liquid medium for transformation.

[0047] (3) Transformation and co-culture of Agrobacterium: After subculture, vigorously growing small callus tissue was scraped from N6D medium and placed in a 100 mL Erlenmeyer flask. The callus was suspended in AAM medium containing Agrobacterium strain and soaked for 20 min, then the AAM medium was discarded. The callus was placed on a culture dish lined with sterile filter paper and air-dried in a laminar flow hood for 30 min. Then it was placed on 2N6AS co-culture medium lined with a layer of filter paper. The callus was placed in an incubator at 23℃ and cultured in the dark for 4 days.

[0048] (4) Removal and screening culture of Agrobacterium: After co-culture, the callus tissue was scraped into a sterile Erlenmeyer flask using a sterile spatula and rinsed several times with sterile distilled water until the water was clear. A certain volume of sterile distilled water was added again, and the flask was left to stand in a laminar flow hood for 15 min. Then, the callus tissue was soaked twice with sterile distilled water containing a final concentration of 400 mg / L carbenicillin, 15 min each time. The soaked callus tissue was poured into a culture dish lined with sterile filter paper, and air-dried in a laminar flow hood for 3 h. The callus tissue was then placed on N+ medium containing the corresponding antibiotic. The culture was carried out in the dark at 30℃, and subcultured twice every two weeks.

[0049] (5) Redifferentiation of resistant callus after infection: The selected subcultured callus tissues were sequentially transferred to hypertonic medium according to different transgenic lines and placed in a 30℃ light incubator for 2 weeks until the callus turned green. The green callus was then transferred to hypotonic medium until new shoots emerged. The new shoots were sequentially transferred to rooting medium in Erlenmeyer flasks according to different clones and placed in a 30℃ light incubator for 2 weeks to obtain resistant seedlings.

[0050] (6) Hydroponics and transplanting of resistant seedlings: When the resistant seedlings reach the top of the Erlenmeyer flask, remove the filter membrane at the top and place the seedlings in the air. At the same time, add sterile distilled water to the Erlenmeyer flask and acclimate them in a light incubator. After the seedling leaves straighten, remove the seedlings from the Erlenmeyer flask, wash away the culture medium from the roots, and transplant them into a greenhouse for cultivation and management. After the plants flower and pollinate under normal greenhouse conditions, harvest the seeds.

[0051] The culture medium formulation used in Agrobacterium-mediated wheat callus transformation: 1L N6D solid medium: sucrose, 30g; NB Basal Medium, 4.1g; Casein, 0.3g; L-Proline, 2.875g; 2,4-D, 0.2g; Gelrite, 4g; pH=5.8.

[0052] AAM Agrobacterium activating medium 1 L: AA-1, 1 mL; AA-2, 1 mL; AA-3, 1 mL; AA-4, 10 mL; AA-5, 1 mL; AA-6, 5 mL; AA-Sol, 10 mL; Casein, 0.5 g; Glucose, 36 g; Sucrose, 68.5 g; Aspartic acid, 0.3 g; L-glutamine, 0.9 g; Inositol, 0.1 g; KCl, 3 g; Acetyleugenol, 40 mg; pH=5.2.

[0053] AA-1 100 mL: MnSO4·6H2O, 1 g; H3BO4, 300 mg; ZnSO4·7H2O, 200 mg; KI, 75 mg; NaMoO4·2H2O, 25 mg; CuSO4·5H2O, 2.5 mg; CoCl2·6H2O, 2.5 mg.

[0054] AA-2 100 mL: CaCl2·2H2O, 15 g.

[0055] AA-3 100 mL: MgSO4·7H2O, 25 g.

[0056] AA-4 100 mL: FeSO4·7H2O, 278 mg; Na2EDTA, 373 mg.

[0057] AA-5 100 mL: NaH2PO4·2H2O, 15 g.

[0058] AA-6 100 mL: Niacin, 20 mg; Vitamin B1, 20 mg; Vitamin B6, 20 mg; Inositol, 2 g.

[0059] AA-sol 100 mL: Arginine, 176.67 mg; Glycine, 75 mg.

[0060] N6D screening medium 1L: sucrose, 30g; NB Basal Medium, 4.1g; Casein, 0.3g; L-Proline, 2.875g; 2,4-D, 0.2g; Gelrite, 4g; pH=5.8; hygromycin 50mg or dipropionylphosphine 2mg; carbenicillin 200mg; cephalosporin 250mg.

[0061] Hypertonic differentiation medium 1 L: sucrose, 30 g; sorbitol, 30 g; MS Medium, 4.43 g; casein, 0.5 g; gelrite, 4 g; pH=5.8; hygromycin, 50 mg or dipropylamine, 2 mg; carbenicillin, 200 mg; cephalosporin, 250 mg; NAA, 0.3 mg; 6-BA, 3 mg.

[0062] Hypotonic differentiation medium 1 L: sucrose, 30 g; MS Medium, 4.43 g; casein, 0.5 g; gelrite, 4 g; pH=5.8; hygromycin, 50 mg or dipropylamine, 2 mg; carbenicillin, 200 mg; cephalosporin, 250 mg; NAA, 0.3 mg; 6-BA, 3 mg.

[0063] Rooting medium 1L: sucrose, 10g; MS Medium, 2.215g; Gelrite, 4g; pH=5.8.

[0064] II. Passage and identification to obtain homozygous individuals without foreign gene integration uorf TaGGP mutant lines Since the sequence mutation types generated by the same vector are relatively consistent, uORF was selected in the T0 generation. TaGGP1 Mutations have been found at sgRNA sites A, B, and D in the genome. uorf TaGGP1 -8-2 strain was used for subculturing and screening to select genotype-stable plants for further research. uorf TaGGP1 After self-crossing and propagation of the -8-2 line, genotyping of the harvested seeds was performed using Sanger sequencing. In the T2 generation, two lines, 8-2-7-1, were obtained, exhibiting homozygous subgenomes of A, B, and D, different mutation types, and stable genotypes. uorf TaGGP1 -1 ) and 8-2-7-11 ( uorf TaGGP1 -2 () Figure 3 ).

[0065] T0 generation represents the current generation of plants transformed from T0 generation, T1 generation represents the seeds produced by self-pollination of T0 generation and the plants that grow from them, and T2 generation represents the seeds produced by self-pollination of T1 generation and the plants that grow from them.

[0066] III. Transient experimental detection of genome editing mutations uorf The effect of sequence on target gene expression 1. uORF TaGGP1 right LUC Effects of reporter gene expression To initially verify the effects of CRISPR / Cas9 editing... uorf Whether the repression effect on downstream gene expression has been lifted, we will... uorf TaGGP1 Four mutations were found in the homozygous offspring of the -8-2 mutant. uorf The 5'UTR was cloned and constructed into a dual-luciferase reporter system vector using a seamless cloning method. Wild-type uORFs were used as a negative control and transfected into wheat protoplasts for transient expression. By detecting the protein activity of LUC / REN, it was found that compared with the control, except for... uorf TaGGP1 -1 Insertion of an A base into the homozygous progeny of the mutant does not affect the expression of downstream LUC protein, while other mutation types can significantly increase the expression level of downstream LUC protein. Figure 4 ).

[0067] uorf TaGGP1 Four types of mutations occurred in the homozygous offspring of the -8-2 mutant: insertion of an A and a T base, deletion of an A base, and deletion of 17 bp bases.

[0068] 2. uorf TaGGP1 Transcript level analysis of the target gene in mutants In order to investigate uorf TaGGP1 We extracted the endogenous transcript variation of the target gene mORF in mutant plants using TRIzol. uorf TaGGP1 Total RNA from leaves of two mutant lines was reverse transcribed into cDNA, which then affected the target gene. TaGGP1 Transcripts were quantitatively analyzed using real-time fluorescence, with the Actin gene in wheat as an internal control. qRT-PCR results showed that these... uorf In mutants TaGGP1 The mRNA expression level of the mutant uORF was not significantly different from that of the wild-type plant, indicating that the mutant uORF TaGGP It will not affect the transcription level of the target gene. Figure 5 ).

[0069] IV. Homozygous uorf TaGGP1 Determination of drought resistance and growth and development phenotypes 1. uorf TaGGP1 Determination of Vitamin C Content in Mutants Wild wheat (Fielder) and uorf TaGGP1 The mutant materials were simultaneously grown in a greenhouse. When they reached the 5-leaf stage, samples were taken from the second leaf from the top of the main tiller. The vitamin C content of the samples was determined using a vitamin C content assay kit. Figure 6 ).

[0070] The results showed that, compared with wild-type plants, uorf TaGGP1 The vitamin C content in the mutant material was significantly increased.

[0071] 2. uorf TaGGP1 Identification of drought-resistant phenotypes and determination of physiological indicators in mutants Wild-type wheat (Fielder) and T3 generation were taken respectively. uorf TaGGP1 The mutant material was cultured in a greenhouse after seed germination. Watering was stopped after 30 days of growth under normal conditions, and the phenotypic characteristics were statistically analyzed after 19 days of drought treatment and after rehydration.

[0072] The results show that the T3 generation uorf TaGGP1 mutant materials ( uorf TaGGP1 -1 and uorf TaGGP1 -2 Under drought conditions, its growth was superior to that of the wild type (Fielder), specifically in terms of less leaf wilting and lodging, and significantly lower levels of malondialdehyde in the leaves compared to the control, while significantly higher levels of catalase, soluble sugar, and proline compared to the control. Figure 7 and 8 The above results indicate that when genome editing technology is used... TaGGP1 Modifying the uORF initiation translation sequence can increase the vitamin C content in cells and enhance the drought tolerance of mutant plants.

[0073] 4. uorf TaGGP1 Agronomic traits analysis of mutant plants Studies have reported that increased vitamin C levels in plants can lead to smaller fruits and reduced yield (Sean Bulley et al., 2012). Therefore, homozygous vitamin C levels were compared... uorf TaGGP1 Mutant materials and wild-type wheat (Fielder) were grown in a greenhouse under normal conditions until maturity. During this period, the effective tiller number, grain number per plant, and thousand-grain weight of the wild-type and mutant materials were recorded. Figure 9 The results showed that wild-type wheat Fielder and uorf TaGGP1 The number of effective tillers and the total weight of thousands of grains remained basically consistent in the mutant materials under normal growth conditions. This indicates that the CRISPR / Cas9 system can effectively target genes in wheat. TaGGP1 Knockout mutations were performed on conserved uORFs to create uorf TaGGP1 The mutant does not affect plant yield under normal growth conditions.

[0074] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. uORF TaGGP1 The application of the component is characterized by: The uORF TaGGP1 The components are TaGGP1 Conserved uORFs of genes.

2. The uORF according to claim 1 TaGGP1 The application of the component is characterized by, The application is selected from any of the following: (1) Regulating plant drought resistance; (2) Cultivating non-GMO plants with improved drought resistance; (3) Cultivate non-transgenic plants with improved drought resistance and no impact on plant yield.

3. The uORF according to claim 1 TaGGP1 The application of the component is characterized by: The uORF TaGGP1 The components are uORFs with ATCACG as the start codon.

4. The uORF according to claim 1 TaGGP1 The application of the component is characterized by: The uORF TaGGP1 The nucleotide sequence of the element is shown in any one of SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No.

3.

5. The uORF according to any one of claims 2-4 TaGGP1 The application of the component is characterized by: The application is achieved by disrupting or modifying uORF. TaGGP1 This is achieved through the nucleotide sequence of the element.

6. The uORF according to claim 5 TaGGP1 The application of the component is characterized by: The damage refers to the destruction of uORF. TaGGP1 The element produces substitutions, deletions, or additions of one or more nucleotides, thereby affecting uORF. TaGGP1 The function of the component; modified to be for uORF TaGGP1 The nucleotide sequence of the element is modified, thereby affecting the uORF. TaGGP1 The function of the component.

7. The uORF according to claim 6 TaGGP1 The application of the component is characterized by: The plant is a grass (Poaceae); the uORF TaGGP The component can also be uORF TaGGP1 The element encodes an amino acid sequence, said amino acid sequence being shown in any one of SEQ ID No. 4, SEQ ID No. 5, and SEQ ID No.

6.

8. A method for cultivating highly drought-resistant wheat, characterized in that, The steps are as follows: using gene editing technology to disrupt the uORF of the wheat plants to be improved. TaGGP1 By using the element, a homozygous variety without exogenous genes can be obtained, which is a highly drought-resistant wheat.

9. The method for cultivating highly drought-resistant wheat according to claim 8, characterized in that: The gene editing technology employs any one of the following gene editing systems: zinc finger nuclease system, TALEN system, and CRISPR system.

10. The method for cultivating highly drought-resistant wheat according to claim 9, characterized in that: The uORF TaGGP1 The nucleotide sequence of the element is shown in any one of SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3.

Images