Application of rice grain length regulation gene
By using the DMT1 gene and silencing the DMT1 gene in rice using RNAi technology, the grain length of rice grains was reduced, which solved the problem of insufficient application of rice grain shape regulation genes in existing technologies and achieved an increase in rice yield.
Patent Information
- Application Number
- CN202511374126.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-25
- Publication Date
- 2025-11-21
AI Technical Summary
In existing technologies, rice grain shape regulation genes are difficult to apply effectively to rice breeding, resulting in limited rice yield increases.
The DMT1 gene was used as a rice grain length regulator. The DMT1 gene was silenced by RNAi technology to reduce the grain length of rice grains without affecting the grain width and thickness.
It significantly reduces rice grain length, increases rice yield, provides new grain shape regulation gene resources, and supports rice genetic improvement.
Smart Images

Figure CN120989142A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present disclosure relates to the field of biotechnology, in particular to an application of a rice grain length control gene. BACKGROUND
[0002] Rice (Oryza sativa L.) is one of the most important food crops in the world, and improving rice yield has become the core issue of breeding research. The yield components of rice are complex, mainly regulated by three key factors: panicle number per plant, filled grain number per panicle, and 1000-grain weight. Among them, grain type traits including grain length, grain width, and grain thickness directly affect 1000-grain weight, which is an important agronomic trait determining yield.
[0003] In recent years, with the progress of molecular biology technology, researchers have successfully identified and isolated multiple key genes and quantitative trait loci (QTL) that regulate rice grain type. For example, grain length control genes GS3, GLW7, GL6, and GL10; grain width-related genes GW2, GW5, qSW5, and GS5; and grain thickness control genes TGW3, OsBZR1, and OsMADS56. However, most of these grain type control genes cannot be well applied to rice breeding. Therefore, systematic exploration of new grain type control genes will provide more gene resources and theoretical support for genetic improvement of rice.
[0004] SUMMARY
[0005] To solve the problems of the prior art, the present disclosure provides an application of a rice grain length control gene. The technical solution is as follows:
[0006] The present disclosure provides an application of a rice grain length control gene, which comprises: using the gene DMT1 as the rice grain length control gene to reduce the grain length of rice, wherein the sequence of the gene DMT1 is shown in SEQ ID NO: 1 in the sequence listing.
[0007] The application comprises: after silencing the gene DMT1 by RNAi technology, it is used to reduce the grain length of rice seeds.
[0008] The technical solution provided by the embodiments of the present disclosure has the beneficial effects that: the embodiments of the present disclosure provide an application of a rice grain length control gene, which can significantly reduce the grain length of rice seeds, and has very important applications in agricultural production. BRIEF DESCRIPTION OF DRAWINGS
[0009] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the drawings needed to be used in the embodiments will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present disclosure, and other drawings can be obtained by those skilled in the art without any creative effort based on these drawings.
[0010] Figure 1 is a statistical diagram of DMT1 expression in the control group R185 and the experimental group DMT1-RNAi plants provided by the embodiments of the present disclosure, and the data in the diagram represent the average value ± standard deviation, and the asterisk on the error line represents a significant difference compared with the control group (p value is calculated by one-way ANOVA, **p<0.01);
[0011] Figure 2 is a comparison diagram of grain length of mature grains of the control group R185 and mature grains of the experimental group DMT1-RNAi plants provided by the embodiments of the present disclosure;
[0012] Figure 3 is a comparison diagram of grain width of mature grains of the control group R185 and mature grains of the experimental group DMT1-RNAi plants provided by the embodiments of the present disclosure;
[0013] Figure 4 is a statistical diagram of grain length of mature grains of the control group R185 and mature grains of the experimental group DMT1-RNAi plants provided by the embodiments of the present disclosure, and the data in the diagram represent the average value ± standard deviation, and the asterisk on the error line represents a significant difference compared with the control group (p value is calculated by one-way ANOVA, **p<0.01);
[0014] Figure 5 is a statistical diagram of grain width of mature grains of the control group R185 and mature grains of the experimental group DMT1-RNAi plants provided by the embodiments of the present disclosure, and the data in the diagram represent the average value ± standard deviation, and the asterisk on the error line represents a significant difference compared with the control group (p value is calculated by one-way ANOVA);
[0015] Figure 6 is a statistical diagram of grain thickness of mature grains of the control group R185 and mature grains of the experimental group DMT1-RNAi plants provided by the embodiments of the present disclosure, and the data in the diagram represent the average value ± standard deviation, and the asterisk on the error line represents a significant difference compared with the control group (p value is calculated by one-way ANOVA). DETAILED DESCRIPTION
[0016] In order to make the objects, technical solutions and advantages of the present disclosure clearer, the embodiments of the present disclosure will be further described in detail below with reference to the drawings.
[0017] EMBODIMENT
[0018] The application of the rice grain length control gene provided by the embodiments of the present disclosure includes: using the gene DMT1 as a rice grain length control gene to reduce the grain length of rice, and the sequence of the gene DMT1 is shown in SEQ ID NO: 1 in the sequence listing.
[0019] Specifically, after silencing the gene DMT1 by the RNAi technology, the grain length of the rice seed can be significantly reduced. However, the grain width and the grain thickness of the rice are not affected.
[0020] Further, the rice material used in the embodiments is R185.
[0021] The PDK intron is amplified from the pKANNIBAL plasmid by PCR (Polymerase Chain Reaction) using KOD-plus high-fidelity enzyme.
[0022] The PDK intron is amplified by the first amplification reaction using the forward primer PdkP3F (as shown in SEQ ID NO: 2 in the sequence listing, specifically: CTCGAGGAATTCGGTACCCC) and the reverse primer PdkP4R (as shown in SEQ ID NO: 3 in the sequence listing, specifically: TTCGAACCCAATTTCCCAACTG), and the template is the pKANNIBAL plasmid.
[0023] The DMT1 target fragment 1 is amplified from the vector DMT1-WM036 containing the DMT1 coding region by PCR using KOD-plus high-fidelity enzyme.
[0024] The cDNA of R185 rice is extracted to obtain the cDNA of R185 rice.
[0025] The DMT1 target fragment 1 is amplified by the second amplification reaction using the forward primer R1F (as shown in SEQ ID NO: 4 in the sequence listing, specifically: GATGGCACGTACCTGAGGAACG) and the reverse primer P3RR2R (as shown in SEQ ID NO: 5 in the sequence listing, specifically: GGGGTACCGAATTCCTCGAGAATCTTGCCGCTGGCCTTGCA), and the template is the cDNA of R185 rice.
[0026] The DMT1 target fragment 2 is amplified from the vector DMT1-WM036 containing the DMT1 coding region by PCR using KOD-plus high-fidelity enzyme.
[0027] DMT1 target fragment 2 was amplified by the third amplification reaction using forward primer R1F (as shown in SEQ ID NO: 4 in the sequence listing, specifically GATGGCACGTACCTGAGGAACG) and reverse primer P4FR2R (as shown in SEQ ID NO: 6 in the sequence listing, specifically AATCTTGCCGCTGGCCTTGCAAATCTTGCCGCTGGCCTTGCA), and the template was the cDNA of R185 rice;
[0028] The amplification system of each 50 μL of the first amplification reaction, the second amplification reaction and the third amplification reaction included: 10×buffer 5 μL; 2 mM dNTP 5 μL; forward primer 1.5 μL at a concentration of 10 μM; reverse primer 1.5 μL at a concentration of 10 μM; template 1 μL; KOD-Plus-Neo polymerase 1 μL at a concentration of 1 U / μL; and ddH2O 35 μL.
[0029] The amplification procedure of the first amplification reaction, the second amplification reaction and the third amplification reaction was as follows: 98 ℃ pre-denaturation for 2 min; then 30 cycles, each cycle including: 98 ℃ denaturation for 10 s, 55 ℃ annealing for 15 s, and 68 ℃ extension for 40 s.
[0030] The amplification products were recovered and purified to obtain purified PDK intron, DMT1 target fragment 1 and DMT1 target fragment 2.
[0031] The purified PDK intron was connected with the purified DMT1 target fragment 1 and DMT1 target fragment 2 by overlap extension PCR technology.
[0032] The amplification system of the overlap extension PCR included: first round of reaction amplification and second round of reaction amplification.
[0033] The amplification system of the first round of reaction amplification included: 10×buffer 5 μL; 25 mM MgSO4 3 μL; 2 mM dNTPs 5 μL; PDK intron 50 ng; DMT1 target fragment 1 50 ng; DMT1 target fragment 2; and ddH2O to a total volume of 50 μL.
[0034] The amplification procedure of the first round of reaction amplification was as follows: 94 ℃, pre-denaturation for 2 min; then 10 cycles, each cycle including: 98 ℃ for 10 s, 50 ℃ for 60 s, and 68 ℃ for 45 s, to obtain the first round of amplification product.
[0035] The amplification system for the second round of reaction amplification comprises: 50 μL of the first amplification product; 5 μL of 10×buffer; 3 μL of 25 mM MgSO4; 5 μL of 2 mM dNTPs; 3 μL of forward primer R1F; 2 μL of KOD Plus Neo; and 27 μL of ddH2O.
[0036] The amplification procedure for the second round of reaction amplification is: 94°C, pre-denaturation for 2 min; then 18 cycles, each cycle comprising: 98°C for 10 s, 55°C for 30 s, 68°C for 1 min, to obtain the second round of amplification product.
[0037] After the overlap extension PCR reaction is completed, the amplification product is obtained, 2 μL of the amplification product is taken for agarose gel electrophoresis detection, and the target product is about 2300 bp. After adding A, it is connected with the PCXU N vector digested by Xcm I at 16°C overnight. Escherichia coli TOP10 is transformed, single colonies are picked, and a fragment with a size of about 2.3 kb is selected for company sequencing.
[0038] The DMT1-RNAi vector with correct sequencing is transformed into Agrobacterium competent cells EH105 (purchased from Shanghai Uptide Biotechnology Co., Ltd.) by using the electroporation method, and then is transformed into the recipient material R185 rice by using the Agrobacterium-mediated method, so as to obtain the DMT1-RNAi rice plant, and the specific method is as follows:
[0039] 1. Induction of callus:
[0040] 15 g of mature, full, and hull-removed R185 seeds are weighed and placed in a 50 mL centrifuge tube.
[0041] The seeds are first rinsed with distilled water for 4 times, then treated with 75% ethanol for 2-5 min, finally rinsed with distilled water for 4 times, 0.15% mercury nitrate is added, and the seeds are treated by a shaker at 130 rpm for 12 min. A alcohol lamp is lit, a spoon and tweezers are burned, and are ready for use. The mercury-treated seeds are transferred to a clean bench, and are continuously washed with sterilized distilled water to remove the residual mercury on the seeds. The treated seeds are transferred to filter paper and dried on the clean bench for two hours.
[0042] The dried seeds are transferred to N6 induction medium with tweezers, and are sealed with parafilm after being labeled. The seeds are cultured in a 28°C dark incubator for about 4 weeks.
[0043] 2. Subculture:
[0044] The newly generated compact callus around the callus is picked to new N6 induction medium, and is cultured in a 28°C dark incubator for 10 days.
[0045] 3. Infection:
[0046] 50 mL centrifuge tube is added with 30 mL of 1 / 2N6 liquid medium (1 / 1000 AS is added), and the Agrobacterium containing DMT1-RNAi vector is scraped with a sterile spoon, and the concentration is adjusted to OD 600 = 0.8-1.0.
[0047] The callus is carefully transferred to the bacterial solution with a spoon, and the bacterial solution is uniformly mixed with the callus. After 15 minutes, the callus is transferred to a new sterilized filter paper. After drying, the infected callus is transferred to 1 / 2N6 solid medium (1 / 1000 AS is added). The culture is incubated in a 20°C dark incubator for two days.
[0048] 4. Bacteria removal
[0049] The culture dish is taken out of the dark incubator and placed on a clean bench to dry for 15 minutes. The callus is placed in a sterilized bottle and washed four times with sterilized water.
[0050] 250 mL of sterilized water containing 1 / 1000 cefotaxime is added to the bottle, and the bottle is shaken at 100 rpm for 10 minutes. The sterilized water is poured out, and the operation is repeated once.
[0051] 250 mL of sterilized water containing 1 / 500 cefotaxime is added to the bottle, and the bottle is shaken at 100 rpm for 10 minutes. The sterilized water is poured out, and the operation is repeated once.
[0052] The callus is transferred to a new sterilized filter paper with a spoon and dried for 3 hours.
[0053] 5. Screening
[0054] The dried callus is transferred to N6 solid medium containing 250 mg / L cefotaxime and 50 mg / L hygromycin (screening medium), and incubated in a 28°C dark incubator for 30 days.
[0055] 6. Differentiation
[0056] The well-grown compact callus obtained after screening is transferred to MS medium (differentiation medium) and incubated in a 28°C incubator under light for 40 days.
[0057] 7. Rooting and seedling raising
[0058] The green seedlings grown on the differentiation medium are transferred to 1 / 2MS medium (rooting medium), and incubated in a 28°C incubator under light for 15 days. After 15 days, the seedlings are taken out of the 1 / 2MS medium and placed in a centrifuge tube containing sterilized water, and the sterilized water is replaced frequently. After 1 week, the seedlings are planted in the field, and T1 generation seeds can be obtained after the seedlings mature.
[0059] In this embodiment, a homozygous DMT1-RNAi strain was selected for subsequent experiments.
[0060] After soaking and germinating seeds of the control material R185 and the experimental material DMT1-RNAi homozygous line, 50 seeds from each line with normal germination and consistent growth rate were selected and sown in seedling trays. When the seedlings reached 25 days of age, the expression level of DMT1 in the control group R185 and the experimental group DMT1-RNAi plants was measured. The results are shown below. Figure 1 As shown. By Figure 1 It can be seen that the expression level of DMT1 in the control group R185 was significantly higher than that in the experimental group DMT1-RNAi plants.
[0061] When the seedlings reached 25 days of age, they were transplanted to the field at a spacing of 16.7 cm between plants and 26.7 cm between rows. A plot-based experimental design was used, with 10 plants per plot and 5 rows per plot. Standardized field water and fertilizer management was implemented for all experimental materials. After seed maturity, the grain shape of mature seeds from the control material R185 and the experimental material DMT1-RNAi was examined and photographed. The photographic results are shown below. Figures 2-3 As shown. By Figure 2 It can be seen that the grain length of the control material R185 is significantly longer than that of the experimental material DMT1-RNAi plants. Figure 3 It can be seen that there is no significant difference in grain width and grain thickness in rice.
[0062] The length, width, and thickness of seeds from the control material R185 and the experimental material DMT1-RNAi were measured, with 15 replicates per group. The measurement results were statistically analyzed, and photographs were taken as follows: Figures 4-6 As shown. Figures 4-6 It can be seen that, compared with the control material R185, the mature grain length of the experimental material DMT1-RNAi plants was significantly reduced, while the grain width and thickness were not significantly different.
[0063] The above description is merely an optional embodiment of this disclosure and is not intended to limit this disclosure. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the protection scope of this disclosure.
Claims
1. The application of a rice grain length regulating gene, characterized in that, The application includes using the gene DMT1 as the rice grain length regulating gene to reduce rice grain length, wherein the sequence of the gene DMT1 is shown in SEQ ID NO: 1 in the sequence listing.
2. The application according to claim 1, characterized in that, The application includes: silencing the DMT1 gene using RNAi technology to reduce the grain length of rice.
Citation Information
Patent Citations
Rice dwarfing multi-tillering mutant dmt1 and application thereof
CN112852832A
Carotenoid cleavage dioxygenase related gene in mulberry and prokaryotic expression of carotenoid cleavage dioxygenase related gene
CN112899293A
Application of rice grain type gene
CN118703555A