Application of Camellia oleifera CoSPX-MFS3 gene in improvement of phosphorus absorption of plants
By cloning and overexpressing the CoSPX-MFS3 gene in Camellia oleifera, the plant's phosphorus uptake capacity was enhanced, solving the problem of low phosphorus uptake efficiency in low-phosphorus soils and achieving the effects of efficient phosphorus utilization and environmental protection.
Patent Information
- Application Number
- CN202511407397.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-29
- Publication Date
- 2025-11-21
AI Technical Summary
In existing technologies, Camellia oleifera has low phosphorus absorption efficiency in low-phosphorus soils, which leads to the need to apply large amounts of phosphate fertilizer, polluting the environment and affecting the quality of tea oil. There is insufficient research on the SPX-MFS3 gene in Camellia oleifera, and there is a lack of applications to improve phosphorus absorption capacity.
By cloning the CoSPX-MFS3 gene of Camellia oleifera and overexpressing it in plant cells, transgenic plants were bred to enhance their phosphorus uptake capacity and antioxidant enzyme activity. Experiments were conducted in Populus tomentosa to reveal its response mechanism under low phosphorus stress.
It significantly improves the phosphorus uptake capacity and low phosphorus tolerance of plants, reduces the use of phosphate fertilizers, reduces environmental pollution, and promotes technological innovation in plant genetic engineering and optimization of germplasm resources.
Smart Images
Figure CN120989145A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to the application of the Camellia oleifera CoSPX-MFS3 gene in improving phosphorus absorption in plants. Background Technology
[0002] Phosphorus is one of the essential nutrients for the development and metabolism of all organisms, playing a vital role in all life activities. As the second most important nutrient, phosphorus is not only a component of important compounds in plants (such as nucleic acids and proteins), but also regulates almost all energy metabolism processes, including photosynthesis, respiration, energy conversion, and enzymatic reactions. Phosphorus in soil mainly exists in the form of aluminum, iron, or calcium salts. Plants absorb orthophosphate (Pi, H₂PO₄). - / HPO4 2- Phosphorus is acquired through various forms. In most soils, the concentration of available phosphorus is less than 10 micromoles. Faced with different phosphorus stress environments, plants have evolved a series of adaptive mechanisms at the morphological, physiological, and molecular functional levels. Therefore, identifying genes that enable efficient phosphorus absorption and utilization in plants, studying their response mechanisms under low phosphorus stress, and subsequently breeding phosphorus-efficient varieties has become a current research hotspot.
[0003] SPX-MFS is the third subfamily of proteins in the SPX family. The SPX-MFS subfamily contains the MFS domain. MFS subfamily proteins contain 12–14 transmembrane domains and transport a wide range of substrates, including nucleotides, amino acids, ions, and polypeptides. In plants, the SPX-MFS family has been shown to be phosphorus transporters. Three putative genes in this family are found in Arabidopsis: AtSPX-MFS1, AtSPX-MFS2, and AtSPX-MFS3. In rice, OsSPX-MFS1 and OsSPX-MFS3 are repressed by phosphorus deficiency, while OsSPX-MFS2 is induced. Heterologous complementation of yeast mutants with impaired phosphorus transporters suggests that phosphorus can be transported using OsSPX-MFS1. The mutant osspx-mfs1 alters phosphorus remobilization. OsSPX-MFS3 is a low-affinity phosphorus transporter that mediates phosphorus outflow from the vacuole into the cytoplasm and couples with proton movement.
[0004] Camellia oleifera, also known as tea seed tree, tea oil tree, and white-flowered tea, is a high-quality woody oil crop unique to southern my country. It has a long history of cultivation, a wide distribution, large-scale planting, and diverse uses. Environmentally, Camellia oleifera is primarily suited to the hilly areas of southern China, where the soil is mostly acidic red, yellow, and yellow-brown soil with a pH between 4.5 and 6.5. However, the inorganic phosphorus content that can be absorbed and utilized by the roots of Camellia oleifera is very low in these soils. To meet the growth needs of Camellia oleifera, large amounts of phosphate fertilizer are applied to the planting areas every year. However, this leads to soil and water pollution, and the actual amount of available phosphorus that Camellia oleifera can absorb and utilize is not high, thus adversely affecting the quality of tea oil. In the research field, current research on the low-phosphorus response-related gene SPX-MFS3 mostly focuses on herbaceous plants such as Arabidopsis thaliana and rice, and aims to improve the phosphorus absorption capacity of these plants. However, there are few reports on the function of the SPX-MFS3 gene in phosphorus absorption in Camellia oleifera. Studying the function of the SPX-MFS3 gene in Camellia oleifera can lay the foundation for cultivating varieties of Camellia oleifera with high phosphorus utilization efficiency through molecular breeding.
[0005] Currently, there is a lack of applications for the Camellia oleifera CoSPX-MFS3 gene to improve phosphorus uptake in plants. Summary of the Invention
[0006] To overcome the above problems, this invention provides an application of the Camellia oleifera CoSPX-MFS3 gene in improving phosphorus absorption in plants.
[0007] To achieve the above-mentioned technical objectives, the technical solutions adopted by this invention are as follows: Firstly, this application provides the application of the Camellia oleifera CoSPX-MFS3 gene in improving plant phosphorus absorption; secondly, this application provides the application of the Camellia oleifera CoSPX-MFS3 gene in increasing the activity of antioxidant enzymes in plants; thirdly, this application provides a method for improving the phosphorus absorption capacity of plants; fourthly, this application provides a transgenic plant obtained by the method.
[0008] The first aspect of this application provides the application of the Camellia oleifera CoSPX-MFS3 gene in improving phosphorus absorption in plants. The nucleotide sequence of the Camellia oleifera CoSPX-MFS3 gene is shown in SEQ ID NO.1.
[0009] Furthermore, the plant can be either a dicotyledonous plant or a monocotyledonous plant.
[0010] Furthermore, the dicotyledonous plants are any one of Arabidopsis thaliana, tobacco, or tomato; the monocotyledonous plants are any one of rice, wheat, or maize.
[0011] Furthermore, the plant is the silver poplar.
[0012] The second aspect of this application provides the application of the Camellia oleifera CoSPX-MFS3 gene in increasing the activity of antioxidant enzymes in plants, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0013] The third aspect of this application provides a method for improving the phosphorus uptake capacity of plants, comprising the following steps: introducing the Camellia oleifera CoSPX-MFS3 gene into plant cells, and then cultivating the plant cells into transgenic plants.
[0014] Furthermore, the plant cell can be any one of a fertilized egg, callus tissue, or embryo.
[0015] The fourth aspect of this application provides a transgenic plant obtained by a method, wherein the transgenic plant is any one of Arabidopsis thaliana, tobacco, rice, wheat, corn or tomato.
[0016] Beneficial effects: This invention discloses for the first time the application of the Camellia oleifera CoSPX-MFS3 gene in improving phosphorus absorption in plants. Experiments conducted in Populus tomentosa showed that Populus tomentosa plants overexpressing the CoSPX-MFS3 gene can significantly improve the phosphorus absorption capacity of plants.
[0017] Compared with the prior art, the present invention has the following advantages: (1) This invention successfully identified and cloned the Camellia oleifera CoSPX-MFS3 gene, clarifying that it belongs to the SPX gene family. This gene plays an important role in the phosphorus uptake capacity of Camellia oleifera. Through gene cloning and expression, expression analysis under low phosphorus stress and in different tissues, its response to low phosphorus stress was revealed, filling the gap in the research on genes for efficient phosphorus utilization in Camellia oleifera and providing an important theoretical basis for in-depth research on the low phosphorus tolerance mechanism of Camellia oleifera.
[0018] (2) Studies have found that overexpression of the CoSPX-MFS3 gene in Populus tomentosa can enhance the plant's phosphorus uptake capacity and significantly improve its tolerance to low phosphorus levels. This indicates that the present invention provides a method for regulating the enhancement of plant phosphorus uptake capacity through gene manipulation, which has important application prospects. Enhanced phosphorus uptake capacity allows plants to complete their growth and development needs under lower phosphorus conditions, reducing resource waste and environmental pollution caused by external application of phosphate fertilizers, and helps to cultivate excellent germplasm resources for efficient phosphorus utilization, thereby improving crop production efficiency and economic benefits.
[0019] (3) The possibility that the CoSPX-MFS3 gene is conserved and has similar functions in a variety of plants indicates that the application scope of this invention is not limited to Populus tomentosa, but can also be extended to other crops and horticultural ornamental plants. By overexpressing or inhibiting this gene in different plants, it is expected to achieve the regulation of low phosphorus utilization in plants, which has important practical significance for cultivating excellent germplasm resources with high phosphorus utilization efficiency, and can provide strong technical support for plant genetic improvement and variety optimization of horticultural ornamental plants.
[0020] (4) This invention, through the study of the Camellia oleifera genome sequence and combined with various molecular biology techniques such as transcriptome sequencing, gene cloning, and transgenics, systematically reveals the function and mechanism of action of key genes in the low-phosphorus response of Camellia oleifera. This not only enriches the molecular biology research content on enhancing phosphorus absorption in plants, but also provides valuable experience and reference for research on other plant genetic engineering, helps to promote technological innovation and development in the field of plant genetic engineering, and provides new ideas and methods for solving key problems in plant growth, development, and genetic improvement. Attached Figure Description
[0021] To more clearly illustrate the technical solutions in the embodiments of this application, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0022] Figure 1 This is a gel electrophoresis image of the CoSPX-MFS3 gene amplification product of the present invention; Figure 2 The graph shows the expression analysis of CoSPX-MFS3 under low phosphorus stress (A) and the expression analysis in various tissues (root, stem, leaf, flower and fruit) of the present invention (B). Figure 3 The diagram shows the steps of genetic transformation of the transgenic silver poplar (A) and the identification diagrams of the transgenic positive lines (B and C). Figure 4 Phenotypic diagrams (A) and acid phosphatase activity (B) of wild-type Populus spp. and CoSPX-MFS3 transgenic Populus spp. of this invention are shown. t-test, a, b, c, d indicate significance: P < 0.01.
[0023] Figure 5 The phosphorus content of wild-type Populus simonii and CoSPX-MFS3 transgenic Populus simonii was analyzed for the purposes of this invention. The t-test was used, with a, b, c, and d indicating significance: P < 0.01.
[0024] Figure 6The organic acid content (A) and antioxidant enzyme activity (B) of wild-type Populus spp. and CoSPX-MFS3 transgenic Populus spp. of this invention are analyzed. t-tests are used, with a, b, c, and d indicating significance: P < 0.01. Detailed Implementation
[0025] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0026] In this application, the term "and / or" describes the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can represent: A existing alone, A and B existing simultaneously, or B existing alone. A and B can be singular or plural. The character " / " generally indicates that the preceding and following related objects have an "or" relationship.
[0027] In this application, "~ one less" means one or more, and "more than" means two or more. "~ one less item (item) below" or similar expressions refer to any combination of these items, including any combination of single items (items) or multiple items (items). For example, "~ one less item (item) in a, b, or c", or "~ one less item (item) in a, b, and c", can all mean: a, b, c, a~b (i.e., a and b), a~c, b~c, or a~b~c, where a, b, and c can be single or multiple.
[0028] It should be understood that in the various embodiments of this application, the order of the above processes does not imply the order of execution. Some or all steps may be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.
[0029] The first aspect of this application provides an application of the Camellia oleifera CoSPX-MFS3 gene in improving phosphorus absorption in plants. The nucleotide sequence of the Camellia oleifera CoSPX-MFS3 gene is shown in SEQ ID NO.1.
[0030] In some embodiments, the plant is a dicotyledonous plant.
[0031] In some embodiments, the plant is a monocotyledonous plant.
[0032] In some embodiments, the dicotyledonous plant is Arabidopsis thaliana.
[0033] In some embodiments, the dicotyledonous plant is tobacco.
[0034] In some embodiments, the dicotyledonous plant is the tomato.
[0035] In some embodiments, the monocotyledonous plant is rice.
[0036] In some embodiments, the monocotyledonous plant is wheat.
[0037] In some embodiments, the monocotyledonous plant is maize.
[0038] In some embodiments, the plant is silver poplar.
[0039] The second aspect of this application provides the application of the Camellia oleifera CoSPX-MFS3 gene in increasing the activity of antioxidant enzymes in plants. The nucleotide sequence of the Camellia oleifera CoSPX-MFS3 gene is shown in SEQ ID NO.1.
[0040] The third aspect of this application provides a method for improving the phosphorus absorption capacity of plants, comprising the following steps: introducing the Camellia oleifera CoSPX-MFS3 gene into plant cells, and then cultivating the plant cells into transgenic plants.
[0041] In some embodiments, the plant cell is a fertilized egg.
[0042] In some embodiments, the plant cells are callus tissue.
[0043] In some embodiments, the plant cell is an embryo.
[0044] The fourth aspect of this application provides a transgenic plant obtained by a method, wherein the transgenic plant is any one of Arabidopsis thaliana, tobacco, rice, wheat, corn, or tomato.
[0045] In some embodiments, the transgenic plant is Arabidopsis thaliana.
[0046] In some embodiments, the genetically modified plant is tobacco.
[0047] In some embodiments, the genetically modified plant is rice.
[0048] In some embodiments, the genetically modified plant is wheat.
[0049] In some embodiments, the genetically modified plant is maize.
[0050] In some embodiments, the genetically modified plant is a tomato.
[0051] Example 1 The present invention relates to the application of the Camellia oleifera CoSPX-MFS3 gene in improving phosphorus absorption in plants. The nucleotide sequence of the Camellia oleifera CoSPX-MFS3 gene is shown in SEQ ID NO.1.
[0052] Obtaining the CoSPX-MFS3 encoding gene from Camellia oleifera (1) RNA extraction RNA was extracted from a mixture of roots, stems and leaves of *Camellia oleifera* 'Changlin 166'. The total RNA was extracted using the EasyPlant RNA Kit (Zhejiang EasyPlant Biotechnology Co., Ltd.) according to the instructions and stored at -80℃ for later use.
[0053] (2) Cloning of the CoSPX-MFS3 gene The first strand of cDNA was synthesized using a reverse transcription kit (PrimeScript™ 1st Strand cDNA Synthesis Kit) (Takara Biotech (Beijing) Co., Ltd.). Take 2 μg of RNA sample, calculate the required RNA volume based on the RNA concentration, add 2 μL of 50 μM Oligo dT Primer, 2 μL of 10 mM dNTP Mixture, and add RNase-free ddH2O to a final volume of 20 μL. Mix the reagents thoroughly, incubate at 65°C for 5 min, and then rapidly cool on ice. Prepare 40 μL of reaction solution according to Table 1. The reaction system is as follows (Table 1): Table 1
[0054] Incubate at 42°C for 60 min, then at 95°C for 5 min, and place on ice. Obtain the cDNA template and store at -20°C.
[0055] The CoSPX-MFS3 gene sequence was obtained based on the Camellia oleifera genome and transcriptome information. Specific primers for this gene were designed (CoSPX-MFS3-F: ATGGTTAACTTTGGGAAAAAGTTG; CoSPX-MFS3-R: CTAATAGAGAGAATTGTAGGTACAGC). The CDS sequence was amplified using PrimeSTAR® Max DNA Polymerase (Takara Biotech (Beijing) Co., Ltd.). The PCR reaction system is shown in Table 2. Table 2
[0056] After slowly mixing the above mixture by pipetting, place it in a PCR instrument for amplification reaction. The reaction program is as follows: 98℃ for 5 min; 98℃ for 30 s; set the temperature according to the Tm value of the upstream and downstream primers, 30 s; 72℃, design the extension time according to 1 min / 1 Kb, for a total of 35 cycles; 72℃ for 5 min.
[0057] After the above reaction was completed, the target fragment (approximately 2097 bp) was obtained by agarose gel electrophoresis. Figure 1 After recovery and purification, the samples were sent for sequencing, and the results are shown in SEQ ID NO.1, which encodes 698 amino acids (as shown in SEQ ID NO.2). All primer synthesis and sequencing were performed at Zhejiang Shangya Biotechnology Co., Ltd.
[0058] Example 2 The difference between Example 2 and Example 1 is that the plant is a dicotyledonous plant.
[0059] Example 3 The difference between Example 3 and Example 1 is that the plant is a monocotyledonous plant.
[0060] Example 4 The difference between Example 4 and Example 1 is that the dicotyledonous plant is Arabidopsis thaliana.
[0061] Example 5 The difference between Example 5 and Example 1 is that the dicotyledonous plant is tobacco.
[0062] Example 6 The difference between Example 6 and Example 1 is that the dicotyledonous plant is tomato.
[0063] Example 7 The difference between Example 7 and Example 1 is that the monocotyledonous plant is rice.
[0064] Example 8 The difference between Example 8 and Example 1 is that the monocotyledonous plant is wheat.
[0065] Example 9 The difference between Example 9 and Example 1 is that the monocotyledonous plant is corn.
[0066] Example 10 The difference between Example 10 and Example 1 is that the plant used is silver poplar.
[0067] Example 11 The present invention relates to the application of the Camellia oleifera CoSPX-MFS3 gene in increasing the activity of antioxidant enzymes in plants. The nucleotide sequence of the Camellia oleifera CoSPX-MFS3 gene is shown in SEQ ID NO.1.
[0068] Example 12 The present invention provides a method for improving the phosphorus absorption capacity of plants, comprising the following steps: introducing the Camellia oleifera CoSPX-MFS3 gene into plant cells, and then cultivating the plant cells into transgenic plants.
[0069] Example 13 The difference between Example 13 and Example 12 is that the plant cells are fertilized eggs.
[0070] Example 14 The difference between Example 14 and Example 12 is that the plant cells are callus tissue.
[0071] Example 15 The difference between Example 15 and Example 12 is that the plant cells are embryos.
[0072] Example 16 Analysis of CoSPX-MFS3 gene expression pattern in Camellia oleifera (1) Expression patterns after different low phosphorus treatments To analyze the expression pattern of the CoSPX-MFS3 gene in Camellia oleifera after different low-phosphorus treatments, qRT-PCR was used to analyze the expression level of CoSPX-MFS3 after different low-phosphorus treatments. It was found that the expression level of the CoSPX-MFS3 gene was highest 3 days after low-phosphorus treatment, and showed an expression trend of first increasing and then decreasing within 7 days. Figure 2 A).
[0073] (2) Expression patterns of different organizations To analyze the differential expression of the CoSPX-MFS3 gene in different tissues of Camellia oleifera, the expression levels of CoSPX-MFS3 in roots, stems, leaves, flowers, and fruits were detected using qRT-PCR. The results showed that CoSPX-MFS3 exhibited tissue specificity. The expression levels of CoSPX-MFS3 were higher in roots and fruits, and lowest in flowers. Figure 2 B).
[0074] Functional analysis of the CoSPX-MFS3 gene in Camellia oleifera (1) Carrier construction 1) Construction of the introductory carrier The obtained PCR products were ligated using the TA / Blunt-Zero Cloning Kit (Novizan Biosciences, Nanjing, China). The reaction system is shown in Table 3. Table 3
[0075] After gently mixing the reaction mixture, place it in a PCR instrument and react at 25°C for 5 minutes. After the reaction is complete, place it on ice.
[0076] The above ligation product was transformed into E. coli DH5α competent cells via heat shock, as detailed below: ① After removing the DH5α competent cells from the -80℃ ultra-low temperature freezer, quickly insert them into ice. It takes 2-3 minutes to thaw. Add the ligation product to the competent cells, gently touch the bottom of the centrifuge tube to mix, and let stand on ice for 20 minutes.
[0077] ② Heat shock for 90 seconds (water bath, 42℃), then quickly return to ice and let stand for 3 minutes. Try not to move the device during this process.
[0078] ③ Add 800 μL of antibiotic-free LB liquid medium to a centrifuge tube, mix by inverting, and incubate at 37°C for 45-60 min at 180 rpm.
[0079] ④ Centrifuge at 5000 rpm for 2 min at room temperature to collect bacterial cells, discard 700 μL of supernatant, resuspend the bacterial cells using a pipette and spread them on LB solid medium plates with the corresponding antibiotic selection (ampicillin, Amp).
[0080] ⑤ Invert the plate and place it in a 37°C incubator overnight for about 10-12 hours. Pick a single colony from the plate and transfer it to a 2.0 mL centrifuge tube. Add 500 μL of LB liquid medium containing ampicillin and place the tube in a 37°C incubator. Shake the tube at 220 rpm for incubation.
[0081] After the bacterial cells became turbid, they were validated by PCR using Green Taq mix. The reaction system is shown in Table 4. Table 4
[0082] After mixing the above reaction solution, place it in a PCR instrument for amplification. The reaction program is as follows: 94℃ for 5 min; 94℃ for 30 s; set the temperature according to the Tm value of the upstream and downstream primers, 30 s; 72℃, set the time according to 1 min / 1 kb, for a total of 35 cycles; 72℃ for 5 min.
[0083] The bacterial culture with the correct target band was sent to the company for sequencing. The sequencing results were compared using DNAMAN software. The result of a complete match was the constructed recombinant entry vector containing the target gene, named T-CoSPX-MFS3, and stored at -20℃ as a template for subsequent amplification of the target gene.
[0084] 2) Construction of expression carrier The plant overexpression vector pBI121 was used via homologous recombination. First, suitable restriction enzyme sites were selected for double digestion of the expression vector. For example, the selected restriction enzyme sites for pBI121 were Sma I and Sac I. Referring to the digestion temperature of the restriction enzymes, the optimal digestion temperature was set in a constant temperature water bath for 2-3 hours. Then, 1 μL of Enzyme I and Enzyme II were added to ensure complete digestion of the expression vector. The digestion was continued for 1-2 hours for recovery and purification of the digestion products. The digestion reaction system is shown in Table 5. Table 5
[0085] Primers for CoSPX-MFS3 with the relevant expression vector restriction sites were designed (Table 6). Using the T-CoSPX-MFS3 recombinant plasmid as a template, PCR amplification was performed using PrimeSTAR® Max DNA Polymerase to obtain the complete CDS sequence of CoSPX-MFS3 containing the vector restriction sites. Gel electrophoresis and PCR product recovery and purification experiments were then performed. The CoSPX-MFS3 insert was ligated to the relevant expression vector using homologous recombination, and the reaction system is shown in Table 7. Table 6
[0086] Table 7
[0087] After thoroughly mixing the above ligation reaction mixture, place it in a PCR instrument for ligation reaction. The reaction program is 37℃, 30 min, 4℃, ∞. After the reaction, place it at 4℃ or on ice, and then transform E. coli DH5α competent cells by heat shock method. Further experiments such as bacterial culture PCR detection and sequencing were performed to obtain the correct recombinant plasmid, named pBI121-CoSPX-MFS3.
[0088] 3) Agrobacterium-mediated transformation First, the constructed recombinant expression vector (pBI121-CoSPX-MFS3 plasmid) was transformed into Agrobacterium EHA105 using electroporation, as detailed below: ① Prepare multiple electroporation cups. First, clean them three times with ddH2O, then clean them three times with 75% anhydrous ethanol. Place them in a sterile workbench and sterilize them under UV light for 30 minutes, then blow off any residual anhydrous ethanol. Place the electroporation cups on ice to pre-cool them. At the same time, adjust the voltage of the Bio-Rad electroporator to 2.0 kV according to the instructions. Adjusting the voltage in advance helps stabilize the instrument's voltage and reduces the probability of Agrobacterium transformation failure due to the breakdown of the electroporation cups.
[0089] ② After removing the EHA105 competent cells from the -80℃ ultra-low temperature freezer, quickly insert them into the prepared ice. After they melt for about 2-3 minutes, add 2-3 μL of recombinant plasmid and mix gently with a pipette.
[0090] ③ Quickly transfer the mixture to a pre-cooled electric rotary cup, wipe the surface water dry with a paper towel, especially the water remaining at the bottom, perform the electric shock, and immediately place it on ice after completion.
[0091] ④ Add 850 μL of antibiotic-free LB liquid medium to the electroporation cup, gently mix by pipetting, and then transfer to a sterile centrifuge tube. Place the tube in a shaker at 28°C and 180 rpm for 2-4 h.
[0092] ⑤ Take 70 μL of bacterial suspension and spread it evenly on an LB solid medium plate containing Kan and rif (50 mg / L). Invert the plate and place it in a constant temperature incubator at 28℃. Remove it after 2-3 days.
[0093] ⑥ Pick a single colony and gently shake it in LB liquid medium containing the corresponding antibiotic. Perform bacterial PCR detection. Agrobacterium strains whose target band size matches the expected size are considered successfully transformed positive strains and can be used for subsequent experiments.
[0094] 4) Obtaining genetically modified silver poplar The successfully transformed Agrobacterium strain (pBI121-CoSPX-MFS3) was used to obtain transgenic silver poplar using the Agrobacterium-mediated leaf infection method. The operation steps are as follows: ① Agrobacterium preparation: The constructed Agrobacterium strain was activated on YM solid medium containing Kan and Rif, cultured at 28℃ for 3 days, and the bacterial cells were resuspended in the infection solution for infection. ② Infecting poplar leaves: Select the third or fourth healthy leaf with a growth cycle of about 4 weeks, cut off the leaf tip and petiole with a sterilized scalpel, make 3-4 cuts with the scalpel in the direction perpendicular to the main vein, place the leaf in a heavy suspension liquid, shake gently, infect for 15 minutes, shake several times during the period, and then place the leaf on sterile filter paper for adsorption. ③ Poplar dark culture: The infected silver-gray poplar leaves were placed face down on a solid culture medium containing As and cultured at 28℃ for 3 days. ④ Poplar selection and differentiation culture: Transfer the leaves to a selection and differentiation medium containing the corresponding antibiotics, and change the medium every three days; ⑤ Poplar seedling cultivation: After about one month of cultivation on the differentiation medium, the differentiated seedlings can be transferred to a seedling cultivation medium containing the corresponding antibiotics; ⑥ Poplar rooting culture: Once the seedlings have grown slightly, cut them off individually and place them in a rooting medium containing the appropriate antibiotics. After about two weeks, the seedlings will have developed roots. Transfer the seedlings to sterile culture soil to harden them off, and wait for their growth to stabilize before using them for the next experiment.
[0095] The culture medium formulas for the entire transformation process of poplar trees are shown in Table 8: Table 8
[0096] ⑦ Genomic DNA was extracted from wild-type and transgenic Populus simonii using the CTAB method. Specific detection primers were designed to verify the transgenic Populus simonii. The plasmid was used as a positive control, and the DNA of wild-type Populus simonii was used as a negative control. Finally, transgenic Populus simonii plants with positive PCR identification results were obtained through screening.
[0097] 5) Low phosphorus treatment of transgenic poplar lines ① Low phosphorus treatment: Genetically modified silver-gray poplar positive lines were aseptically propagated in large numbers. Aseptic seedlings with consistent growth after approximately one month of rooting were used for hydroponic experiments. In the early stages of hydroponics, the plants were slightly pruned and covered with a transparent plastic cover to prevent drying out. After the seedlings had adapted for one week, the cover was removed, and the solution was replaced with a modified Hogland nutrient solution containing normal phosphorus (NP, 1 mM) and low phosphorus (LP, 5 μM). An air pump was added to the water to prevent root rot. Each line was replicated in triplicate.
[0098] ② Samples were taken four weeks after low phosphorus treatment, and the corresponding indicators were measured: phenotypic photos of the low phosphorus treatment were taken.
[0099] Determination of acid phosphatase content: According to the Suzhou Greens reagent kit, take 0.1g of sample, add 1ml of extraction solution and mix well. Centrifuge at 4℃×12000 rpm for 10 minutes, and put the supernatant on ice for testing. Add the appropriate amount of reagent according to the instructions and measure at a wavelength of 405 nm.
[0100] Total phosphorus content was determined by wet digestion with nitric acid and perchloric acid and microwave digestion, followed by inductively coupled plasma atomic emission spectrometry.
[0101] Determination of inorganic phosphorus content: Fresh plant samples were rinsed with deionized water and dried with filter paper. The fresh tissue was ground into powder using liquid nitrogen. Inorganic phosphorus extract (Table 9) was then added, with 100 μl of extract added per 10 mg of sample and mixed thoroughly to homogenize. Next, 900 μl of 1% glacial acetic acid was added and mixed thoroughly. The mixture was incubated at 42°C for 30 min, centrifuged at 13,000 g for 5 min, and 1.4 g of ascorbic acid was dissolved in 100 ml of colorimetric reaction stock solution. Then, 150 μl of the supernatant was added to 350 μl of ammonium molybdate reaction solution (Table 10), mixed by inverting, and incubated at 42°C for 30 min. The result was measured at a wavelength of OD = 820 nm. The inorganic phosphorus extract is shown in Table 9. Table 9
[0102] The ammonium molybdate colorimetric reaction stock solution is shown in Table 10: Table 10
[0103] Malic acid content determination: Take 0.1g of sample, add 1ml of extraction solution and mix well. Centrifuge at 4℃×12000 rpm for 10 minutes. Take the supernatant and place it on ice for testing. Add the appropriate amount of reagent according to the instructions and measure at a wavelength of 340 nm.
[0104] Citric acid content determination: Take 0.1g of sample, add 1ml of extraction solution and mix well. Centrifuge at 4℃×12000 rpm for 10 minutes. Take the supernatant and place it on ice for testing. Add the appropriate amount of reagent according to the instructions and measure at a wavelength of 340 nm.
[0105] Catalase (CAT) content determination: Take 0.1g sample, add 1ml of extraction solution and mix well. Centrifuge at 4℃×12000rpm for 10 minutes. Take the supernatant and place it on ice for testing. Add the appropriate amount of reagent according to the instructions and measure at a wavelength of 510 nm.
[0106] Peroxidase (POD) content determination: Take 0.1g sample, add 1ml of extraction solution and mix well. Centrifuge at 4℃×12000rpm for 10 minutes. Take the supernatant and place it on ice for testing. Add the appropriate amount of reagent according to the instructions and measure at a wavelength of 470 nm.
[0107] Superoxide dismutase (SOD) content determination: Take 0.1g sample, add 1ml of extraction solution and mix well. Centrifuge at 4℃×12000 rpm for 10 minutes. Take the supernatant and place it on ice for testing. Add the appropriate amount of reagent according to the instructions and measure at a wavelength of 560 nm.
[0108] 3. Experimental Results 3.1 Analysis of the expression pattern of CoSPX-MFS3 in Camellia oleifera after different low phosphorus treatments The expression patterns of Camellia oleifera under different low-phosphorus treatments were analyzed by qRT-PCR. Figure 2 (A) The results showed that the expression level of the CoSPX-MFS3 gene was highest 3 days after low phosphorus treatment, and then showed a trend of first increasing and then decreasing within 7 days. This indicates that the CoSPX-MFS3 gene can respond rapidly to low phosphorus stress.
[0109] 3.2 Analysis of the expression pattern of CoSPX-MFS3 in different tissues of Camellia oleifera The expression patterns of the CoSPX-MFS3 gene in different tissues (roots, stems, leaves, flowers, and fruits) of Camellia oleifera were analyzed by qRT-PCR. Figure 2 (B) The results showed that CoSPX-MFS3 exhibited significant tissue specificity in expression. The expression level of CoSPX-MFS3 was higher in roots and fruits, and lowest in flowers.
[0110] 3.3 Phenotypic analysis of CoSPX-MFS3 transgenic plants After obtaining CoSPX-MFS3 transgenic poplar plants, a total of 8 positive seedlings were obtained through a series of genetic differentiation and PCR identification of genomic DNA. Subsequently, qRT-PCR analysis was used to select two high-expression transgenic poplar lines for further experiments. Figure 3 Using wild-type Populus spp. as a control, these transgenic lines were treated with low-phosphorus Hogland nutrient solution modified with normal phosphorus (NP, 1 mM) and low phosphorus (LP, 5 μM), respectively. The study found that under low-phosphorus conditions, the damage to wild-type transgenic plants was significantly higher than that to transgenic plants. Figure 4 A), the root acid phosphatase activity of transgenic plants was significantly increased under low phosphorus conditions. Figure 4 B). These results indicate that overexpression of CoSPX-MFS3 enhances the tolerance of transgenic poplar to low phosphorus.
[0111] 3.4 Phosphorus content analysis of CoSPX-MFS3 transgenic plants To further analyze the tolerance of the CoSPX-MFS3 gene to low phosphorus in poplar, this invention measured the phosphorus content of CoSPX-MFS3-OE transgenic lines and wild-type (PC-WT) plants after 30 days of low phosphorus treatment. The results showed that the phosphorus content in the transgenic plants was higher than that in the wild-type WT, and the phosphorus content in the roots was greater than that in the aboveground parts. Figure 5 A and Figure 5 C). The phosphorus transfer coefficient (above-ground parts / roots) of transgenic poplar was also higher than that of WT plants. Figure 5 B and Figure 5 D). It is possible that the roots of the CoSPX-MFS3-OE transgenic plants absorbed more phosphorus and transported it to the aboveground parts, and the transgenic poplar trees had a stronger ability to absorb phosphorus than PC-WT.
[0112] 3.5 Analysis of Organic Acid Content and Antioxidant Enzyme Activity in CoSPX-MFS3 Transgenic Plants To further investigate the effects of low phosphorus levels on CoSPX-MFS3 transgenic plants, this invention primarily measured two important organic acids: malic acid and citric acid. Figure 6 As shown in Figure A, under low phosphorus conditions, the contents of malic acid and citric acid were significantly increased in the roots and leaves of the overexpression plants compared to the wild-type plants, with the contents in the leaves being higher than those in the roots. Furthermore, by measuring the activities of three key enzymes, POD, SOD, and CAT, in CoSPX-MFS3 transgenic poplar, it was found that under normal phosphorus treatment, the activities of these three enzymes in the transgenic plants were significantly higher than those in the PC-WT plants. Figure 6 B). Under low phosphorus treatment, the activities of three key enzymes in transgenic plants were also significantly higher than those in PC-WT plants ( Figure 6 B).
[0113] Example 17 The difference between Example 17 and Example 16 is that: the transgenic plant obtained by the method of the present invention is Arabidopsis thaliana.
[0114] Example 18 The difference between Example 18 and Example 16 is that the transgenic plant is tobacco.
[0115] Example 19 The difference between Example 19 and Example 16 is that the transgenic plant is rice.
[0116] Example 20 The difference between Example 20 and Example 16 is that the transgenic plant is wheat.
[0117] Example 21 The difference between Example 21 and Example 16 is that the transgenic plant is corn.
[0118] Example 22 The difference between Example 22 and Example 16 is that the genetically modified plant is a tomato.
[0119] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope. The scope of protection of the present invention is defined by the appended claims, specification, and their equivalents.
Claims
1. An application of the Camellia oleifera CoSPX-MFS3 gene in improving phosphorus uptake in plants, characterized by: The nucleotide sequence of the Camellia oleifera CoSPX-MFS3 gene is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that: The plant can be either a dicotyledonous plant or a monocotyledonous plant.
3. The application according to claim 1, characterized in that: The dicotyledonous plant is any one of Arabidopsis thaliana, tobacco, or tomato; the monocotyledonous plant is any one of rice, wheat, or corn.
4. The application according to claim 1, characterized in that: The plant in question is the silver-gray poplar.
5. An application of the Camellia oleifera CoSPX-MFS3 gene in increasing the activity of antioxidant enzymes in plants, characterized in that: The nucleotide sequence of the Camellia oleifera CoSPX-MFS3 gene is shown in SEQ ID NO.
1.
6. A method for improving the phosphorus absorption capacity of plants, characterized in that... The procedure includes the following steps: introducing the Camellia oleifera CoSPX-MFS3 gene as described in claim 1 into plant cells, and then cultivating the plant cells into a transgenic plant.
7. The method according to claim 6, characterized in that: The plant cells can be any one of a fertilized egg, callus tissue, or embryo.
8. A transgenic plant obtained by the method of claim 6, characterized in that: The genetically modified plant is any one of Arabidopsis thaliana, tobacco, rice, wheat, corn, or tomato.