Lentivirus integration site standard substance and preparation method thereof

Abstract

The invention discloses a lentivirus integration site standard substance and a preparation method thereof, the standard substance is gDNA with clear insertion site and integration frequency, and the standard substance comprises a monoclonal single integration site standard substance, a monoclonal multi-integration site standard substance and a multi-cloning multi-integration site standard substance. The standard substance prepared by the method disclosed by the invention can effectively overcome the defects that a universal detection standard substance is lacked in the market, the accuracy and the sensitivity of the method cannot be verified, and data among laboratories cannot be compared with each other.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology, and particularly relates to a lentivirus integration site standard product and a preparation method thereof. BACKGROUND

[0002] Chimeric antigen receptor T cell (CAR-T) immunotherapy is a kind of individualized treatment method in which T lymphocytes expressing chimeric antigen receptor (CAR) prepared by using gene modification technology are amplified in vitro and then reinfused into a patient. Lentiviral vector (LV) is the most commonly used gene delivery tool in CAR-T therapy at present.

[0003] However, the random integration characteristics of lentiviral vectors also bring significant safety hazards: insertional mutagenesis risk: lentiviral vectors may be integrated into critical regulatory regions of the host genome (such as near oncogenes or tumor suppressor genes), leading to activation of oncogenes (such as insertion into the promoter / enhancer region of MYC, LMO2, etc., causing abnormal expression) and inactivation of tumor suppressor genes (such as disrupting the function of TP53, PTEN, etc.).

[0004] The FDA issued the “Considerations for the development of Chimeric AntigenReceptor (CAR) T Cell Products” guidance principle, which recommends determining the release standard of vector copy number (VCN) according to risk assessment. Risk assessment includes experimental data supported by research such as insertion site analysis, clonal dominance, dosage, indication, and study population. The “Insertional Mutagenesis Risk Assessment” is also included as a content of non-clinical safety research in the “Guiding Principles for Non-clinical Research and Technology of Genetically Modified Cell Therapy Products” issued by the Center for Drug Evaluation of the National Medical Products Administration (CDE), and the evaluation points of key risk factors are specified in detail.

[0005] The existing integration insertion site detection techniques include LAM-PCR and WGS, and there is a lack of universal detection standard products on the market, which cannot verify the accuracy and sensitivity of the method, and the data between laboratories cannot be compared with each other.

[0006] Therefore, it is urgent to provide a lentivirus integration site standard product that can simulate the random integration of clinical samples on T cells and has a known integration site. SUMMARY

[0007] The technical problems solved: In view of the above technical problems, the present application provides a lentivirus integration site standard and a preparation method thereof, which can effectively solve the lack of universal detection standard in the market, the inability to verify the accuracy and sensitivity of the method, and the inability to compare data between laboratories.

[0008] Technical scheme: In a first aspect, the present application provides a lentivirus integration site standard, which is gDNA with a clear insertion site and integration frequency, denoted as a monoclonal standard.

[0009] Preferably, the standard is a monoclonal single integration site standard or a monoclonal multiple integration site standard.

[0010] In a second aspect, the present application provides a preparation method of the lentivirus integration site standard of the first aspect, comprising the following steps: S1, preparation of GFP-lentivirus: insert a green fluorescent protein nucleotide sequence into a lentivirus transfer plasmid pTLA1-PAK to obtain a GFP-lentivirus transfer plasmid, i.e. GFP-pTLA1-PAK; resuscitate 293T cells, when the 293T cells reach a confluence of 80% or more, mix GFP-pTLA1-PAK, pTLA1-ENZ, pTLA1-ENV, pTLA1-TOFF and pTLA1-TAT / REV plasmids in a molar ratio of 1:1:1:1:1, and add transfection reagent; after transfection, culture for 72h to collect the supernatant, filter the supernatant with a 0.45μm membrane to obtain GFP-lentivirus; S2, GFP-lentivirus infection: resuscitate Jurkat cells, take 1.5E6 log-phase Jurkat cells, dilute them into 5mL complete culture medium, and inoculate them into a 24-well plate at 0.5mL per well; 4h later, add 1μL of 5mg / mL polybrene solution to each well, mix gently, add GFP-lentivirus at MOI=volume of lentivirus x lentivirus titer / infection cell number=100, mix gently, and incubate for 24h at a constant temperature; centrifuge to remove the lentivirus culture solution, add 0.5mL of fresh complete culture medium, and continue to incubate for 24h at a constant temperature; S3, resistance screening: take 500mL of complete culture medium and add 50μL of 10mg / mL puromycin to prepare a screening medium; centrifuge to remove the supernatant after 48h of GFP-lentivirus infection of Jurkat cells, add 500μL of 37℃ preheated screening medium to each well, and continue to culture in a cell incubator; when the cell density reaches 1E6 / mL, subculture at a 1:3 ratio, and the resistance screening lasts for 2 weeks to obtain stable mixed clone cells Jurkat-GFP; S4, monoclonalization: the mixed clone cell Jurkat-GFP is subcultured with a screening medium to ensure that the cell viability is greater than 90% when monoclonalization is ensured; the cell is monoclonalized by a limited dilution method, and the microwells of a single cell in a 96-well plate are recorded, the cell is replaced with fresh screening medium once every 3-4 days, and finally different Jurkat-GFP monoclonal cells are obtained; S5, verification of insertion site and integration frequency: NGS, LAM-PCR, Sanger and / or dPCR methods are used to verify the insertion site and integration frequency, and finally gDNA with a clear insertion site and integration frequency is obtained as a monoclonal standard.

[0011] Preferably, the green fluorescent protein nucleotide sequence is shown in SEQ ID NO. 1, and specifically, SEQ ID NO. 1: atgagtaaaggagaagaacttttcactggagtggtcccagttcttgttgaattagatggcgatgttaatgggcaaaaattctctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaattttatttgcactactgggaagctacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttctcaagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatattttacaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaaatggaatacaactataactcacataatgtatacatcatgggagacaaaccaaagaatggcatcaaagttaacttcaaaattagacacaacattaaagatggaagcgttcaattagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttccaaagatcccaacgaaaagagagatcacatgatccttcttgagtttgtaacagctgctaggattacacatggcatggatgaactatacaaa.

[0012] In a third aspect, the present application provides a polyclonal multi-integration site standard, which is obtained by mixing the standards of the first aspect in proportion.

[0013] In a fourth aspect, the present application provides use of the standard of the first aspect or the polyclonal multi-integration site standard of the third aspect in evaluating a detection method for detecting integration sites.

[0014] Preferably, the application of the specific process is: when the standard sample of the first aspect is evaluated, the accuracy of the method for detecting the integration site of the standard sample is 100%, and the method is considered to be feasible; when the polyclonal multi-integration site standard sample of the third aspect is evaluated, the accuracy of the method for detecting the integration site of the standard sample is 100%, and the method is considered to be feasible.

[0015] Beneficial effects: The standard sample prepared by the application can help the detection personnel to judge the differences between different detection integration site systems, and then verify the accuracy and sensitivity of the method, provide a basis for the comparison of data between laboratories, and can be used for the development, evaluation and verification of methodology. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 is a schematic diagram of the results of detecting the FITC channel signal of Jurkat-GFP-C10 clone by flow cytometry in an embodiment of the application; Figures 2-7 is a result graph of detecting the breakpoint of Jurkat-GFP-C10 clone by Sanger method in an embodiment of the application. DETAILED DESCRIPTION

[0017] The application will be described in detail below in conjunction with specific embodiments: Embodiment 1

[0018] (1) Preparation of GFP-lentivirus Synthesize the green fluorescent protein (GFP) sequence (SEQ ID NO. 1) and insert it into the lentivirus transfer plasmid pTLA1-PAK to obtain the GFP-lentivirus transfer plasmid GFP-pTLA1-PAK; 293T cells are resuscitated in advance, and when they reach 80% confluence, the GFP-pTLA1-PAK, pTLA1-ENZ, pTLA1-ENV, pTLA1-T0FF and pTLA1-TAT / REV plasmids are mixed in a molar ratio of 1:1:1:1:1, and a transfection reagent (Tipofectamin LTX Reagent with RLU Reagent, Invitrogen, 15338100) is added. After transfection, culture for 72 h, collect the supernatant; filter the supernatant using a 0.45 μm membrane and perform centrifugal concentration to obtain the GFP-lentivirus.

[0019] (2) GFP-lentivirus infection Jurkat cells were subcultured normally for 2-3 times to ensure good cell state. Before infection, 1.5E6 logarithmic growth Jurkat cells were diluted into 5 mL complete medium, then inoculated into a 24-well plate, 0.5 mL per well. After 4 h, 1 μL of 5 mg / mL polybrene solution was added to each well, mixed gently, and GFP-lentivirus was added according to MOI = lentivirus volume x lentivirus titer / infection cell number = 100, mixed gently, and incubated for 24 h at constant temperature; centrifugation to remove lentivirus culture solution, add 0.5 mL of fresh complete medium, continue to incubate at constant temperature for 24 h.

[0020] (3) Resistance screening Take 500 mL complete medium and add 50 μL of 10 mg / mL puromycin to prepare the screening medium; centrifuge to remove the supernatant after GFP-lentivirus infection of Jurkat cells for 48 hours, add 500 μL of 37°C preheated screening medium to each well, and continue to culture in a cell incubator; when the cell density reaches 1E6 / mL, subculture at a ratio of 1:3, and the resistance screening lasts for 2 weeks to obtain stable mixed clone cells Jurkat-GFP.

[0021] (4) Monoclonalization The mixed clone cells Jurkat-GFP were subcultured with the screening medium to ensure good cell state and more than 90% viability during monoclonalization. The cells were plated by limiting dilution method to monoclonalize, and the microwells of individual cells in the 96-well plate were recorded. The cells were replaced with fresh screening medium every 3-4 days, and different Jurkat-GFP monoclonal cells were finally obtained.

[0022] (5) Flow verification The Jurkat-GFP monoclonal cells and Jurkat cells after expansion were centrifuged and resuspended in PBS, and the FITC channel signal was detected by flow cytometry. Taking the selected Jurkat-GFP-C10 clone as an example, the detection results are shown in Figure 1 Jurkat-GFP-C10 can stably express GFP.

[0023] (6) NGS verification The different Jurkat-GFP monoclonal cells obtained were subjected to NGS sequencing to analyze the insertion sites. Taking the Jurkat-GFP-C10 clone as an example, the breakpoint splicing position obtained by NGS detection is shown in Table 1: Table 1 Breakpoint splicing position of Jurkat-GFP-C10 clone obtained by NGS detection

[0024] (7) LAM-PCR verification LAM-PCR was used to verify the obtained Jurkat-GFP-C10 clone cells, and the insertion site was analyzed and detected, and the results are shown in Table 2 below: Table 2 LAM-PCR detection of the breakpoint splicing position of Jurkat-GFP-C10 clone

[0025] Consistent with the detection results of NGS, further verification confirmed the insertion position.

[0026] (8) Sanger verification According to the position sequence splicing template obtained by NGS and LAM-PCR verification, Sanger verification was performed. The results are shown in Table 2: Figures 2-7 The results show that the sequence obtained by NGS and LAM-PCR detection is consistent.

[0027] (9) dPCR verification The position of lentivirus integration was verified by NGS, LAM-PCR and Sanger, and the frequency of integration was further verified by digital PCR technology. The sequence with splicing was regarded as a mutant, and the original genomic conserved gene sequence without splicing was regarded as a wild type. The primers and probes were designed and synthesized, microdroplets were prepared, dPCR detection was performed, and the frequency was calculated. The primers and probes used are shown in Table 3: Table 3 Primers and probes used for dPCR verification of Jurkat-GFP-C10 clone

[0028] The results of each site frequency are shown in Table 4: Table 4 Results of each site frequency

[0029] Through the verification of NGS, LAM-PCR, Sanger and dPCR, a single clone multi-site lentivirus integration site standard with a clear insertion site, integration frequency and stability was obtained. Other clones were also verified to prepare single clone unit site, single clone multi-site lentivirus integration site standard. At the same time, these single clones can be used as raw materials for multi-clone multi-site mixed standard.

[0030] Example 2: Preparation and verification of multi-clone multi-integration site standard Select 11 monoclonal samples gDNA of different insertion sites verified to mix a certain proportion, and add negative (no insertion sequence) Jurkat cell gDNA, dilute its frequency to 5% and 2%, so as to obtain the standard of polyclonal multi-integration site covering 20 known insertion sites from different 11 chromosomes, the frequency as low as 5% / 2%, as shown in the following table 5: Table 5 Gene information contained in polyclonal multi-integration site standard

[0031] The polyclonal multi-integration site standard was verified by NGS and LAM-PCR. Taking 5% polyclonal multi-integration site standard as an example, the verification results are shown in tables 6-7: Table 6 NGS verification results of 5% polyclonal multi-integration site standard

[0032] Table 7 LAM-PCR verification results of 5% polyclonal multi-integration site standard

[0033] The results show that the results obtained by NGS detection are consistent with the known mixed introduced sites, and the sites verified by dPCR are consistent; the results obtained by LAM-PCR detection are consistent with the known mixed introduced sites, and the sites verified by dPCR are consistent, and the sites verified by NGS are consistent.

[0034] The above only describes the preferred embodiments of the present application and does not limit the present application. Any modification, equivalent replacement and improvement made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A lentiviral integration site standard, characterized in that: The standard is gDNA with clear insertion site and integration frequency, denoted as a monoclonal standard.

2. The lentivirus integration site standard of claim 1, wherein: The standard is a monoclonal single integration site standard or a monoclonal multiple integration site standard.

3. A method of producing a lentiviral integration site standard of claim 1 or 2, characterized in that, The method comprises the following steps: S1, preparation of GFP-lentivirus: insert a green fluorescent protein nucleotide sequence into a lentivirus transfer plasmid pTLA1-PAK to obtain a GFP-lentivirus transfer plasmid, namely GFP-pTLA1-PAK; resuscitate 293T cells, when the 293T cells reach a confluence of 80% or above, mix the GFP-pTLA1-PAK, pTLA1-ENZ, pTLA1-ENV, pTLA1-TOFF and pTLA1-TAT / REV plasmids in a molar ratio of 1:1:1:1:1, and add a transfection reagent; after transfection, culture for 72 hours to collect the supernatant, and filter the supernatant with a 0.45 mu m membrane to obtain the GFP-lentivirus; S2, GFP-lentivirus infection: resuscitate Jurkat cells, take 1.5E6 log-phase Jurkat cells, dilute them into 5 mL complete culture medium, and inoculate them into a 24-well plate at 0.5 mL per well; 4 hours later, add 1 mu L of a 5 mg / mL polybrene solution to each well, mix gently, add the GFP-lentivirus at a MOI of 100, mix gently, and incubate at a constant temperature for 24 hours; centrifuge to remove the lentivirus culture solution, add 0.5 mL of fresh complete culture medium, and continue to incubate at a constant temperature for 24 hours; S3, resistance screening: take 500 mL of complete culture medium and add 50 mu L of 10 mg / mL puromycin to prepare a screening culture medium; centrifuge to remove the supernatant after the Jurkat cells are infected with the GFP-lentivirus for 48 hours, add 500 mu L of a 37 DEG C preheated screening culture medium to each well, and continue to culture the 24-well plate in a cell incubator; when the cell density reaches 1E6 / mL, subculture at a 1:3 subculture ratio, and continuously screen for resistance for 2 weeks to obtain stable mixed clone cells Jurkat-GFP; S4, monoclonalization: subculture the mixed clone cells Jurkat-GFP with the screening culture medium to ensure that the cell viability is greater than 90% when monoclonalization is performed; plate the cells by the limiting dilution method to monoclonalize the cells, record the microwells of the single cells in the 96-well plate, and replace the fresh screening culture medium every 3-4 days; and finally obtain different Jurkat-GFP monoclonal cells; S5, verification of insertion site and integration frequency: verify the insertion site and integration frequency by NGS, LAM-PCR, Sanger and / or dPCR methods, and finally obtain gDNA with clear insertion site and integration frequency, namely a monoclonal standard.

4. The method of claim 3, wherein: The green fluorescent protein nucleotide sequence is shown in SEQ ID NO.

1.

5. A polyclonal multi-integration site standard, characterized in that: The polyclonal multiple integration site standard is obtained by mixing the standards of claim 1 in a proportion. The green fluorescent protein nucleotide sequence is shown in SEQ ID NO.

1. The polyclonal multiple integration site standard is obtained by mixing the standards of claim 1 in a proportion.

Images