Application of reagent for detecting expression quantity of lncRNA marker in preparation of oral squamous cell carcinoma diagnosis product or prognosis product

By detecting the expression level of DPY19L1P1, a specific detection kit was designed, which solved the problem of low efficiency in early diagnosis and prognosis of OSCC in the existing technology, and achieved more efficient diagnosis and prognosis of oral squamous cell carcinoma.

CN120989248AActive Publication Date: 2025-11-21WEIFANG MEDICAL UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202511516563.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-23
Publication Date
2025-11-21
Estimated Expiration
2045-10-23

AI Technical Summary

Technical Problem

Current technologies have not fully utilized the role of lncRNA in oral squamous cell carcinoma, resulting in low efficiency in early diagnosis and prognosis of OSCC, and related molecular markers have not been fully discovered or validated.

Method used

Using DPY19L1P1 as a specific biomarker, specific detection reagents or kits are designed by detecting its expression level for the early diagnosis and prognosis of oral squamous cell carcinoma. Combining reverse transcription PCR, real-time quantitative PCR, in situ hybridization or microarray technology can improve diagnostic efficiency.

Benefits of technology

It improves the diagnostic efficiency and prognostic accuracy of oral squamous cell carcinoma, provides new molecular targets and treatment directions, and enhances the sensitivity and specificity of clinical diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120989248A_ABST
    Figure CN120989248A_ABST
Patent Text Reader

Abstract

The invention provides application of a reagent for detecting the expression quantity of an lncRNA marker in preparation of an oral squamous cell carcinoma diagnosis product or a prognosis product, and relates to the technical field of biological medicines. The lncRNA is DPY19L1P1, and the nucleotide sequence of the lncRNA is as shown in SEQ ID NO. 1. The DPY19L1P1 can be used as a tumor molecular marker to design and synthesize a specific detection reagent or kit, is used for early auxiliary diagnosis of clinical oral squamous cell carcinoma, and improves the diagnosis efficiency and prognosis efficiency of oral squamous cell carcinoma. The invention further provides an application of the reagent for detecting the expression quantity of the lncRNA-DPY19L1P1 in a sample as well as a primer and a kit for specifically detecting the lncRNA-DPY19L1P1. The primer can specifically recognize the DPY19L1P1 and detect the expression quantity of the DPY19L1P1 in a tissue.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, and particularly relates to application of a reagent for detecting expression of an lncRNA marker in preparation of a diagnosis product or a prognosis judgment product for oral squamous cell carcinoma. BACKGROUND

[0002] Long non-coding RNA (lncRNA) is a kind of endogenous non-coding RNA with a length of more than 200 nucleotides and lacking of complete open reading frame (ORF). Although lncRNA does not directly encode proteins, it plays a key role in gene expression regulation. More and more studies have shown that lncRNA can deeply participate in the occurrence and progression of tumors by regulating chromatin remodeling, transcriptional activity, RNA splicing and stability, and other mechanisms.

[0003] In the field of tumors, lncRNA has been proved to be able to affect the biological behaviors such as proliferation, apoptosis, migration and invasion of tumor cells, and also can regulate the expression of tumor-related genes at the epigenetic level. These lncRNAs have the potential to become anti-tumor drug targets and tumor biomarkers, providing new ideas and means for the diagnosis and treatment of cancer.

[0004] Oral squamous cell carcinoma (OSCC) is one of the most common malignant tumors in the head and neck, with high recurrence rate, high metastasis rate and poor prognosis. Although the comprehensive treatment means such as surgery, radiotherapy and chemotherapy are constantly improving, the overall five-year survival rate of OSCC patients is still less than 50%. At present, the molecular mechanism of its occurrence and development has not been fully elucidated.

[0005] In recent years, it has been found that a variety of lncRNAs are abnormally expressed in OSCC, and through interaction with DNA, RNA or protein, they regulate the expression of key cancer genes and tumor suppressor genes, thereby affecting the malignant phenotype of tumor cells. For example, some lncRNAs promote tumor proliferation and metastasis by regulating epigenetic modification or mRNA stability, and others can regulate the tumor immune microenvironment and participate in the drug resistance process.

[0006] Therefore, in-depth study of the mechanism of lncRNA in oral squamous cell carcinoma not only helps to reveal the molecular carcinogenic mechanism of OSCC, but also provides new molecular targets and technical paths for early diagnosis, prognosis evaluation and individualized treatment of the disease. At present, a large number of lncRNAs related to OSCC have not been discovered or systematically verified, and the existing technology still needs to be further improved and expanded. SUMMARY

[0007] In view of the above problems of the prior art, the application provides application of a reagent for detecting expression of an lncRNA marker in preparation of a diagnosis product or a prognosis judgment product for oral squamous cell carcinoma, the lncRNA being DPY19L1P1, which can be used as a marker for diagnosis and prognosis judgment of oral squamous cell carcinoma for specifically detecting oral squamous cell carcinoma.

[0008] To solve the above problems, the application provides the following technical solutions: In a first aspect, the application provides application of a reagent for detecting expression of an lncRNA marker in preparation of a diagnosis product or a prognosis judgment product for oral squamous cell carcinoma, the lncRNA being DPY19L1P1, which has a nucleotide sequence as shown in SEQ ID NO. 1.

[0009] The marker DPY19L1P1 can be used for specific high expression in oral squamous cell carcinoma tissues, and has no such specific high expression in normal tissues, and can be used as a tumor-specific molecular marker to design and synthesize a specific detection reagent or kit, which is used for early auxiliary diagnosis of clinical oral squamous cell carcinoma, and improves diagnosis efficiency and prognosis judgment efficiency of oral squamous cell carcinoma.

[0010] The diagnosis product for oral squamous cell carcinoma includes early diagnosis products, recurrence diagnosis products, and late diagnosis products for oral squamous cell carcinoma, such as reagents for detecting expression level of DPY19L1P1 by reverse transcription PCR, real-time quantitative PCR, in situ hybridization, or chip technology.

[0011] Optionally, the product includes a preparation.

[0012] Preferably, the preparation includes any one or a combination of a chip or a detection kit.

[0013] In a second aspect, the application further provides application of a reagent for detecting expression of the aforementioned lncRNA in a sample in preparation of a product having at least one of the following functions: (1) predicting or assisting in predicting postoperative recurrence-free survival rate of a patient with oral squamous cell carcinoma; (2) predicting or assisting in predicting postoperative overall survival rate of a patient with oral squamous cell carcinoma; (3) predicting or assisting in predicting tumor differentiation degree of a patient with oral squamous cell carcinoma, i.e., predicting or assisting in predicting a disease stage of the patient with oral squamous cell carcinoma, whether the patient is in an advanced stage.

[0014] Optionally, in the application, the product is a preparation, a chip, or a detection kit.

[0015] The application synthesizes specific detection reagents (such as primers, DNA probes, etc.) according to the sequence of DPY19L1P1, which can detect the expression level of DPY19L1P1 in the sample based on quantitative PCR method and / or high-throughput sequencing method and / or probe hybridization method, or detect the expression level of the target gene regulated by DPY19L1P1 based on immunological method, and use it as effective information for early diagnosis of oral squamous cell carcinoma.

[0016] The reagent for detecting the expression level of DPY19L1P1 in the chip includes a probe specifically recognizing the DPY19L1P1 gene; and the reagent for detecting the expression level of DPY19L1P1 in the kit includes primers specifically amplifying the DPY19L1P1 gene or a probe specifically recognizing the DPY19L1P1 gene.

[0017] In a third aspect, the application further provides a detection primer pair for specifically amplifying the lncRNA, and the sequence of the primer pair is shown in SEQ ID NO. 2-3.

[0018] The detection primer pair of the application can specifically recognize DPY19L1P1 and detect the expression level of DPY19L1P1 in the tissue, and provide effective information for the diagnosis or prognosis of clinical oral squamous cell carcinoma.

[0019] In a fourth aspect, the application further provides a kit comprising the detection primer pair.

[0020] The kit of the application comprises the primer pair which can specifically recognize DPY19L1P1 and detect the expression level of DPY19L1P1 in the tissue, and has simple composition, convenient use, accurate quantification, stable and reliable detection results, and can improve the sensitivity and specificity of early diagnosis of clinical oral squamous cell carcinoma.

[0021] Preferably, the kit further comprises polymerase chain reaction reagents and reaction buffers, dNTP, internal reference primers and fluorescent dyes. The internal reference primers can be specific detection primers for GAPDH housekeeping genes. The fluorescent dye can be SYBR-Green dye.

[0022] Preferably, the kit further comprises RNA extraction reagents and cDNA reverse transcription reagents. The kit combined with commonly used RNA extraction reagents and general reverse transcription reagents can specifically detect the expression level of DPY19L1P1 in the tissue, and is effectively used for early auxiliary diagnosis of oral squamous cell carcinoma.

[0023] The application further provides an application of the detection primer pair or the kit, characterized by specifically amplifying the lncRNA.

[0024] The present invention also provides an application of the above-mentioned lncRNA gene agonist in the preparation of a pharmaceutical composition for the prevention or treatment of oral squamous cell carcinoma. Its mechanism of action is to promote or enhance the development of oral squamous cell carcinoma by regulating the proliferation, migration and invasion of tumor cells and promoting tumor cell progression.

[0025] The present invention has the following beneficial effects: 1. This invention is the first to discover that the expression level of DPY19L1P1 is associated with oral squamous cell carcinoma. It can be used as a specific molecular marker to design and synthesize specific detection reagents or kits for early auxiliary diagnosis of oral squamous cell carcinoma in clinical practice, thereby improving the diagnostic efficiency and prognostic efficiency of oral squamous cell carcinoma.

[0026] 2. The present invention also provides primers for amplifying DPY19L1P1 and a kit containing the primers. The primers can specifically recognize DPY19L1P1 and detect the expression level of DPY19L1P1 in tissues. They are simple in composition, easy to use, accurate in quantification, and provide stable and reliable detection results, which can improve the sensitivity and specificity of early diagnosis of oral squamous cell carcinoma in clinical practice.

[0027] By integrating data from the TCGA databases of UCSC Xena and GDC, we discovered that the long non-coding RNA DPY19L1P1 is specifically highly expressed in oral squamous cell carcinoma tissues, and ROC curve analysis confirmed its diagnostic value. Furthermore, high expression of DPY19L1P1 was significantly associated with higher clinical stage and worse histological grade, indicating that it can serve as a potential indicator for assessing tumor malignancy. We have obtained a biomarker for oral squamous cell carcinoma: DPY19L1P1, which can be used for the specific detection of oral squamous cell carcinoma. Based on its oncogenic effect, this provides a new research direction and theoretical support for the development of drugs to treat oral squamous cell carcinoma. Attached Figure Description

[0028] Figure 1 Figure A shows the differential expression analysis of DPY19L1P1 in oral squamous cell carcinoma tissue and normal tissue in Example 1; Figure B shows the ROC curve analysis of the value of DPY19L1P1 in the diagnosis of oral squamous cell carcinoma; Figures C and D show the correlation between DPY19L1P1 expression and clinical stage and histological grade.

[0029] Figure 2In Example 2, A shows the effect of CCK-8 assay on reducing the proliferation of oral squamous cell carcinoma cells after DPY19L1P1 knockdown. In Example 2, B shows the effect of crystal violet staining on reducing the migration of oral squamous cell carcinoma cells after DPY19L1P1 knockdown. In Example 2, C shows the statistical graph of migrating cells in the cell migration assay. SS-NC is the control group, and SS-DPY19L1P1 is the DPY19L1P1 knockdown cell group. Detailed Implementation

[0030] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in the art. Unless otherwise specified, the methods in the following embodiments are conventional methods in the art.

[0031] Experimental reagents used in the examples: 1. Reverse transcription kit: PrimerScript from TakaRa Biotechnology (Beijing) Co., Ltd. TM -RT ReagentKit premixed reagent for first-strand synthesis of genomic cDNA (RR037A); 2. qRT-PCR kit: SYBR Green Pro Taq HS premixed qPCR kit (AG11701) from Aikerui Biotechnology.

[0032] Example 1 Analysis of DPY19L1P1 expression levels in oral squamous cell carcinoma tumor samples This example obtains DPY19L1P1 as a biomarker for cancer tissue and compares its expression level in cancer tissue and its association with survival.

[0033] 1. Experimental Methods The expression of DPY19L1P1 in oral squamous cell carcinoma tissues and its correlation with clinicopathology were analyzed using TCGA data from the UCSC Xena database (University of California Santa Cruz Xena, http: / / xena.ucsc.edu / ) and the GDC database (Genomic Data Commons Data Portal, https: / / portal.gdc.cancer.gov / ). Inclusion criteria were: 1) primary tumor, 2) adult patients; exclusion criteria were: 1) history of any other tumor or co-existing tumors, 2) incomplete clinical data or refusal of follow-up, 3) no accurate DPY19L1P1 expression, 4) no accurate tumor status, 5) no accurate clinical stage, 6) no accurate pathological stage, 7) no accurate histological grade. Patients were divided into high and low DPY19L1P1 expression groups based on the median expression value.

[0034] This invention obtains clinical data of oral squamous cell carcinoma patients from the TCGA database using the UCSC Xena and GDC databases, analyzes the expression level of DPY19L1P1 and its correlation with clinicopathological features, and clearly defines inclusion and exclusion criteria to ensure the accuracy and reliability of the analysis results. Therefore, the above analysis can serve as an effective method for assessing the survival rate and prognosis of cancer patients.

[0035] 2. Experimental Results and Analysis (1) such as Figure 1 The results of A show that the expression level of DPY19L1P1 in cancer samples is higher than that in normal samples.

[0036] (2) ROC curve analysis showed its value in the diagnosis of oral squamous cell carcinoma. The area under the curve (AUC) was 0.7848, the sensitivity was 64.04%, and the specificity was 79.55%. Figure 1 B). Analysis of the relationship between DPY19L1P1 expression and clinicopathological features revealed that DPY19L1P1 expression levels were closely related to clinical stage and histological grade. Specifically, DPY19L1P1 expression levels were significantly elevated in patients with advanced clinical stage and poor histological differentiation. Figure 1 C, D).

[0037] This example demonstrates that DPY19L1P1 can serve as a biomarker, providing important clues and evidence for the diagnosis, treatment, and prognosis of tumors.

[0038] Example 2 Functional verification of DPY19L1P1 1. Cell transfection In a six-well plate, use 3.0 × 10 5 HN30 oral squamous cell carcinoma cells were seeded at a cell density of 1 / mL and 2mL of complete culture medium containing 10% FBS was added. Transfection was performed when the cell density reached approximately 70%.

[0039] The cell transfection includes the following steps: (1) Synthesis of siRNA We designed and synthesized siRNA targeting the human DPY19L1P1 gene, with Smart Silencer-lncRNA (purchased from Guangzhou Ruibo Biotechnology Co., Ltd.) as the control. The sequence of DPY19L1P1 Smart Silencer is SEQ ID NO.4. (2) Preparation of siRNA dilution targeting the human DPY19L1P1 gene: Dilute 5 μL of the above siRNA (20 μM concentration per strip) with 125 μL of serum-free DMEM medium, mix well, and let stand at room temperature for 5 min.

[0040] Preparation of Lipo8000 dilution: Dilute 4 μL of Lipo8000 with 125 μL of serum-free DMEM medium, mix well and let stand at room temperature for 10 min.

[0041] (3) Mix the two diluents at a 1:1 ratio and let stand at room temperature for 20 minutes. (4) Add the above mixture dropwise to the HN30 cell supernatant, and measure to 125 μL per well. Shake the plate gently to mix. (5) Incubate at 37℃ in a 5% CO2 incubator for 6 hours; (6) Replace with 2 mL of complete culture medium containing 10% FBS in DMEM. Culture each group of cells at 37°C and 5% CO2 for 24 h to obtain DPY19L1P1 knockdown cells. Collect these cells for subsequent experiments.

[0042] 2. Cell proliferation experiment Cell proliferation assays are commonly used tumor phenotypic experiments, often used to assess and quantify the rate of tumor cell growth and replication. This experiment used the CCK-8 assay to detect tumor cell proliferation using the Vazyme CCK-8 Cell Counting Kit, a widely used cell proliferation assay based on WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonylbenzene)-2H-tetrazole monosodium salt). This example investigates the effect of DPY19L1P1 on the proliferation of oral squamous cell carcinoma cells using the CCK-8 assay.

[0043] (1) Experimental methods ① Treat each group of transfected cells with trypsin and count them using a cell counter. Then resuspend each group of transfected cells in an appropriate amount of complete culture medium, so that each 100 μl of cell suspension contains 1000 cells. Seed each group of transfected cells into 96-well plates, each well containing 100 μl of cell suspension, with 3 replicates per group. Wells without culture medium need to be sealed with phosphate-buffered saline (PBS). Then place the 96-well plates in an incubator at 37°C and 5% CO2. ②After the cells adhere to the culture medium, add 10 μl of CCK-8 reagent; ③ Place the 96-well culture plate in an incubator and incubate for 5 hours; ④ After the cells have adhered to the culture medium for 0, 24, 48, 72, 96 and 120 hours, add 10 μl of CCK-8 reagent to the culture medium, then put the 96-well plate back into the incubator and continue culturing for 2 hours. Then use an ELISA reader to measure the absorbance at 450 nm.

[0044] ⑤ Process the experimental data, plotting cell growth curves with 0 hours, 24 hours, 48 ​​hours, 72 hours, 96 hours, and 120 hours as the x-axis and the absorbance value at 450nm as the y-axis.

[0045] (2) Experimental results and analysis The results of the cell growth curve are as follows Figure 2 As shown in Figure A, the proliferation of DPY19L1P1 knockdown cells was lower than that of the control group. This experimental result indicates that knockdown of DPY19L1P1 significantly inhibits the proliferation of oral squamous cell carcinoma cells.

[0046] 3. Cell migration experiment Cell migration assays are used to simulate the ability of tumor cells to move in the external environment. Transwell chambers are an ideal model for assessing cell migration capabilities. In this model, cells move from the upper layer to the lower layer of the chamber through a porous polycarbonate membrane with a diameter of 8 μm, a process that mimics the migration behavior of tumor cells.

[0047] (1) Experimental methods ① Take HN30 cells in good growth condition and perform trypsin digestion. Wash the cells once with serum-free culture medium. 5×10⁶ 4 The cells were resuspended in 150 μL of serum-free culture medium; ②Seed the cell suspension into the upper layer of each Transwell compartment. Add 600 μL of complete culture medium containing 50% FBS to the lower layer of the Transwell compartment; ③ Place the Transwell chamber containing cells in a cell culture incubator and incubate for 24 hours; ④ Fix the cells on the chamber membrane with 4% polymethyl methacrylate for 15 minutes. Stain the cells with crystal violet for 15 minutes, then gently rinse with water. ⑤ Gently wipe away the excess dye with a cotton swab, take pictures of the cells on the underside of the polycarbonate membrane under a microscope, and perform statistical analysis.

[0048] (2) Experimental results and analysis Electron microscopy results of the migration effect are as follows Figure 2 As shown in B, the statistics of migrating cells are as follows: Figure 2 As shown in Figure C. The results show that, compared with the control group, the number of cells passing through the porous polycarbonate membrane in the experimental group was significantly reduced. Therefore, this result indicates that knocking down DPY19L1P1 inhibits the migration ability of oral squamous cell carcinoma cells.

[0049] Example 3 Application of DPY19L1P1 as a biomarker for oral squamous cell carcinoma in detecting the risk of recurrence and whether the oral squamous cell carcinoma is in an advanced stage. This embodiment provides a method for using DPY19L1P1 as a biomarker for oral squamous cell carcinoma in detecting the recurrence risk and whether the carcinoma is in an advanced stage. This method predicts or assists in predicting the postoperative prognosis of the patient by detecting the expression level of lncRNA-DPY19L1P1 in the cancer tissue sample of the patient. The method includes the following steps: 1. Extraction of total RNA: (1) Add 1 mL of TRIzol to the cell or tissue sample, shake well to mix, transfer to an RNase-free centrifuge tube, and let stand on ice for 5 minutes. (2) Add 300 μL of chloroform, shake well again, let stand on ice for 10 minutes, and centrifuge at 12000 g for 15 minutes at 4°C; (3) Carefully transfer the supernatant to a new RNase-free EP tube, add an equal volume of isopropanol, and let stand on ice for 15 minutes; (4) Centrifuge again at 12000g for 15 minutes at 4℃. Discard the supernatant and wash the precipitate twice with 75% ethanol and anhydrous ethanol, respectively; (5) Centrifuge at 12000g for 5 minutes at 4℃, discard the supernatant, and air-dry the precipitate at room temperature until it becomes transparent; dilute with 40μL of DEPC water. Subsequently, detect the concentration and purity of RNA using a UV spectrophotometer, and prepare cDNA by reverse transcription.

[0050] 2. qPCR detection of DPY19L1P1 1 ng of cDNA was used for qPCR detection, with ACTIN as an internal control. A qPCR reaction system with a final volume of 20 μL was prepared according to the kit (Vazyme's Taq Pro Universal SYBR qPCR Master Mix) instructions.

[0051] The reaction system consists of: 1 ng of the above-mentioned cDNA, 10 μL of SYBR Green I, 0.8 μL each of upstream and downstream primers (concentration of 10 μmol / L), and the remainder is DEPC water.

[0052] The upstream and downstream primer sequences are as follows: DPY19L1P1-F: CAGCAAGGTCCACGGAGTAG (SEQ ID NO.2) DPY19L1P1-R: GGTAAACTCCCGTCTCCCAC (SEQ ID NO.3) The thermal cycling program for qPCR is as follows: pre-denaturation at 95℃ for 30 seconds, followed by a 3-step reaction: denaturation at 95℃ for 5 seconds, annealing at 60℃ for 30 seconds, for 40 cycles.

[0053] The final test results were obtained using 2 -ΔΔCt The relative expression level of lncRNA-DPY19L1P1 was calculated using this method.

[0054] 3. Analysis of test results The expression level of lncRNA-DPY19L1P1 in cancer tissue samples from test patients can be detected to predict or assist in predicting the postoperative prognosis of the test patients. The judgment criteria are as follows: The relapse-free survival rate of patients in the high expression group was lower than that of patients in the standard expression group and also lower than that of patients in the low expression group; and / or, the overall survival rate of patients in the high expression group was lower than that of patients in the standard expression group and also lower than that of patients in the low expression group.

[0055] Alternatively, the expression level of the lncRNA-DPY19L1P1 gene measured by the above method can also be used as an intermediate result. By combining it with other clinical diagnostic results, further analysis can be conducted to obtain more informative results on the risk of recurrence and whether it is advanced oral squamous cell carcinoma, and it can be used as one of the reference information for the formulation of clinical treatment plans for patients.

[0056] It is understood that those skilled in the art can make equivalent substitutions or modifications to the technical solutions and concepts of this invention, and all such substitutions or modifications should fall within the protection scope of the appended claims.

Claims

1. The application of a reagent for detecting the expression level of lncRNA markers in the preparation of diagnostic or prognostic products for oral squamous cell carcinoma, characterized in that, The lncRNA is DPY19L1P1, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. The use of a reagent for detecting the expression level of lncRNA as described in claim 1 in a sample in the preparation of a product having at least one of the following functions: (1) To predict or assist in predicting the postoperative recurrence-free survival rate of patients with oral squamous cell carcinoma; (2) To predict or assist in predicting the overall survival rate of patients with oral squamous cell carcinoma after surgery; (3) To predict or assist in predicting the degree of tumor differentiation in patients with oral squamous cell carcinoma.

3. The application according to claim 2, characterized in that, The product includes formulations.

4. The application according to claim 3, characterized in that, The formulation includes any one or a combination of a chip or a test kit.

5. A detection primer pair for specifically amplifying the lncRNA as described in claim 1, characterized in that, The sequences of the primer pairs are shown in SEQ ID NO.2~3.

6. A reagent kit, characterized in that, Includes the detection primer pair as described in claim 5.

7. The reagent kit according to claim 6, characterized in that, It also includes polymerase chain reaction reagents and their reaction buffers, dNTPs, internal reference primers, and fluorescent dyes.

8. The kit according to claim 7, characterized in that, It also includes RNA extraction reagents and cDNA reverse transcription reagents.

9. The application of the detection primer pair of claim 5 or the kit of claim 6, characterized in that, Used for specific amplification of the lncRNA as described in claim 1.

10. The use of the lncRNA gene agonist of claim 1 in preparing a pharmaceutical composition for the prevention or treatment of oral squamous cell carcinoma, characterized in that, Its mechanism of action is to promote or enhance the development of oral squamous cell carcinoma by regulating the proliferation, migration and invasion of tumor cells and promoting tumor cell progression.

Citation Information

Patent Citations

  • Methods and compositions for altering health, well-being, and lifespan.

    CN102300578A

  • Application of biomarker RP11-54A9.1 in prediction of oral squamous cell carcinoma and treatment of oral squamous cell carcinoma

    CN112322741A

  • New therapies involving miRNA-193a

    CN114729358A

  • Novel peptides and combination of peptides for use in immunotherapy against various cancers

    US20190192567A1

  • Biomarkers Related to Oral Squamous Cell Carcinoma and Methods of Diagnosis and Treatment Thereof

    US20230203493A1