SNP (Single Nucleotide Polymorphism) site for identifying carp parent with high relative ovary weight and application of SNP site

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) site for identifying a carp parent with high relative ovary weight and application of the SNP site, and belongs to the technical field of molecular genetics and aquatic breeding. The technical problem that an efficient molecular marker for accurately identifying individuals with high relative ovary weight is lacked in existing carp parent breeding is solved. According to the invention, six SNP (Single Nucleotide Polymorphism) sites, which are obviously related to the character of high relative ovary weight, are found and are respectively positioned at the 1914515 site of the sequence NC056581.1, the 17586713 site of the sequence NC056582.1, the 18667178 site of the sequence NC056592.1, the 23541881 site of the sequence NC056612.1, the 25898489 site of the sequence NC056597.1 and the 49224 site of the sequence NW024879353.1. According to the invention, high-throughput molecular marker-assisted selection of carp parents is realized, and the breeding efficiency and the breeding yield are improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular genetics and aquaculture breeding technology. More particularly, the present application relates to a SNP site for identifying high relative ovary weight of carp parent and its application. BACKGROUND

[0002] Carp (Cyprinus carpio) is an important freshwater economic fish, and its reproductive efficiency is directly related to the benefit of aquaculture industry. In the same age group of female carp, there is a significant difference in the number of eggs among individuals, and the number of eggs per tail can vary from tens of thousands to hundreds of thousands. This difference in reproductive capacity directly reflects the difference in ovary weight. Therefore, quickly and accurately screening individuals with high ovary weight as parents is crucial to improving the overall reproductive potential of carp populations.

[0003] Currently, in production practice, the screening of parents largely depends on empirical phenotypic observation. The traditional method usually makes a preliminary judgment on the egg-carrying condition of female fish according to the degree of abdominal distension during the breeding season. However, this method has obvious limitations. First, it is limited by the breeding cycle of fish, and cannot be used for early prediction and screening of backup parents in non-breeding periods, resulting in a long breeding cycle. Second, the judgment based on abdominal size has a high false positive rate, because the accumulation of abdominal fat tissue can also cause abdominal distension, which makes the observation results not truly reflect the actual development status of the ovary. In addition, the absolute weight of the ovary is closely related to the body weight of the fish, and individuals with larger body weight often have heavier ovaries. However, for individuals with similar body weight, it is difficult to effectively distinguish their relative reproductive capacity based on appearance or absolute ovary weight.

[0004] In order to eliminate the influence of body weight, using relative ovary weight (i.e. the ratio of ovary weight to body weight) as a key indicator to evaluate the reproductive performance of female carp is more scientific and accurate. However, the conventional method of obtaining this data requires dissection and weighing of the parents, which is obviously a destructive test, and is contrary to the breeding goal of preserving excellent parents for continuous reproduction.

[0005] Therefore, there is an urgent need in the aquaculture industry for a new method that can accurately identify high relative ovary weight of carp parents without relying on the breeding season and without dissection, which can predict the reproductive potential of fish at any stage of growth through non-destructive methods, thereby achieving early, efficient and accurate selection of excellent parents. SUMMARY

[0006] It is an object of the present application to solve at least the above problems and to provide at least the advantages described later.

[0007] The application also aims to provide a SNP site for identifying high relative ovary weight carp parents and an application thereof, so as to solve the technical problems that traditional methods rely on phenotype measurement, are destructive, are greatly affected by the environment, cannot be used for early screening of immature individuals, and restrict the breeding efficiency.

[0008] In order to achieve these objects and other advantages of the present application, a SNP site for identifying high relative ovary weight carp parents is provided, and the SNP site is selected from any one of the following sites: a) a SNP at position 1914515 of sequence NC_056581.1; b) a SNP at position 17586713 of sequence NC_056582.1; c) a SNP at position 18667178 of sequence NC_056592.1; d) a SNP at position 23541881 of sequence NC_056612.1; e) a SNP at position 25898489 of sequence NC_056597.1; f) a SNP at position 49224 of sequence NW_024879353.1.

[0009] Preferably, the SNP site for identifying high relative ovary weight carp parents is of the following specific type: For sites a), b), c), e) and f), the specific variation type is heterozygote or mutant homozygote; For site d), the specific variation type is mutant homozygote.

[0010] The application also provides a primer set or probe for identifying high relative ovary weight carp parents, which is used for specifically amplifying or detecting the above-mentioned SNP site.

[0011] The application also provides a detection kit for identifying high relative ovary weight carp parents, which comprises the above-mentioned primer set or probe.

[0012] The application also provides an application of the above-mentioned SNP site for identifying high relative ovary weight carp parents in a method for identifying high relative ovary weight carp parents, which comprises the following steps: (1) obtaining genomic DNA of a to-be-tested carp individual; (2) detecting the genotype of the genomic DNA at any one of the SNP molecular marker sites a) to f); (3) judging whether the to-be-tested individual is a high relative ovary weight parent according to the detected genotype: If the genotype of the detected site a), b), c), e) or f) is heterozygous or mutant homozygous, it is determined that the individual to be tested is a high relative ovary heavy parent; If the genotype of the detected site d) is mutant homozygous, it is determined that the individual to be tested is a high relative ovary heavy parent.

[0013] Preferably, the SNP site for identifying high relative ovary heavy carp parents is used in the method for identifying high relative ovary heavy carp parents, and the genotype of the SNP site is detected by high-throughput sequencing in step (2).

[0014] The present application at least includes the following beneficial effects: 1. The present application provides a direct molecular basis for the identification of high relative ovary heavy traits in carp by providing a set of six specific SNP sites. These sites are significantly associated with the traits, allowing the breeding work to be changed from traditional dependence on dissection and phenotype observation to accurate detection based on DNA level. Using these sites, screening can be performed at any stage before sexual maturation in carp, early selection is achieved, and the breeding cycle is greatly shortened. At the same time, the method is not affected by environmental factors, and the results are more stable and reliable, providing key marker resources for the breeding of new high-fertility varieties of carp.

[0015] 2. The present application clearly defines the dominant genotype corresponding to each SNP site, so that the data of the molecular marker can be accurately interpreted and applied in practice. It is specified that the heterozygous or mutant homozygous genotype is the dominant genotype at five sites, and the mutant homozygous genotype is the dominant genotype at another specific site. The clear determination criteria avoid the ambiguity of genotype results, ensure the consistency and accuracy of the identification conclusion, and enable the technical personnel to quickly and accurately screen the parent individuals with high relative ovary heavy potential according to the test results.

[0016] 3. The present application provides a primer set or probe specifically targeting the above-mentioned SNP sites, which is a key step from theory to application. The specific primer or probe can accurately target the target site, and can achieve efficient and specific amplification or hybridization in PCR, gene chip and other molecular detection techniques, thereby obtaining accurate genotype typing results, laying a core foundation for the subsequent development of standardized detection methods and kits, and ensuring the specificity and sensitivity of the detection.

[0017] 4. The present application integrates the primer set or probe required for detection into a kit, which greatly facilitates the popularization and application of the technology. The kit provides standardized detection components, ensuring the stability and comparability of detection results between different batches and different operators, reducing the technical operation threshold, and enabling breeding field technicians without deep molecular biology background to successfully perform detection, which is conducive to the rapid popularization and application of the molecular marker assisted selection technology in the front line of aquaculture breeding.

[0018] 5、The application establishes a complete and clear standardized operation process from DNA extraction to parent identification in the method for identifying high relative ovary weight carp parents, the method steps are clear, the interpretation standard is specific, and has strong operability and repeatability, using the method, breeders can systematize and batch screen the backup parent population, efficiently identify excellent individuals with high reproductive potential, thereby significantly improving the efficiency and accuracy of parent selection, and reducing the loss caused by misjudgment or omission in the traditional method.

[0019] 6、The application provides an efficient technical solution for rapid screening of large-scale breeding populations by using high-throughput sequencing for genotype detection. High-throughput sequencing technology can simultaneously detect multiple SNP sites of thousands of samples in parallel, has the advantages of high throughput, high automation degree and accurate data, is suitable for large-scale screening of core breeding populations, can significantly shorten the genotyping time and reduce the detection cost per sample, thereby accelerating the entire breeding process.

[0020] Other advantages, objects and features of the present application will be apparent from the following detailed description, and will be appreciated by those skilled in the art. DETAILED DESCRIPTION

[0021] The present application will be further described in detail below with reference to the examples, so that those skilled in the art can implement it according to the description.

[0022] It should be understood that the terms such as "have", "contain" and "include" used herein do not exclude the presence or addition of one or more other elements or combinations thereof.

[0023] It should be noted that the experimental methods described in the following embodiments are all conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0024] The present application creatively correlates the carp genome variation sites, variation types and relative ovary weight, obtains genetic variation sites related to relative ovary weight, and constructs a specific genetic variation site set of high relative ovary weight. On the basis of obtaining the whole genome variation sites and variation types of each individual in the test population, it is determined whether the specific genetic variation sites and types of high relative ovary weight are met, and individuals meeting the above genetic variation sites and types are screened as backup parents of high relative ovary weight. The method provided by the present application can efficiently grade the relative ovary weight of carp, and provide technical support for the identification and breeding of new germplasm of high relative ovary weight carp. The present application can efficiently grade the relative ovary weight of carp, and provide excellent materials for the identification and breeding of new germplasm of high relative ovary weight carp.

[0025] In the present application, the relative ovary weight is a key indicator for evaluating the reproductive performance of female carps, and its calculation formula is: relative ovary weight (Gonadosomatic Index, GSI) = (ovary weight / body weight) x 100%.

[0026] In order to objectively and clearly define the "high relative ovary weight" in the present application, based on the phenotypic data analysis of the reference population, the following classification is carried out: Low relative ovary weight population: refers to individuals whose relative ovary weight values are located in the lowest about 1 / 3 interval of the entire reference population. In the specific embodiments of the present application, the relative ovary weight of this population is usually lower than 33%.

[0027] Medium relative ovary weight population: refers to individuals whose relative ovary weight values are located in the middle about 1 / 3 interval of the entire reference population. In the specific embodiments of the present application, the relative ovary weight of this population is usually between 34% and 66%.

[0028] High relative ovary weight population: refers to individuals whose relative ovary weight values are located in the highest about 1 / 3 interval of the entire reference population. The present application aims to screen such individuals. In the specific embodiments of the present application, the relative ovary weight of this population is usually higher than 67%.

[0029] The above percentage threshold is only an example, and in actual application, it needs to be adjusted according to the target carp variety, breeding environment and breeding target, but the core screening principle remains unchanged, that is, to select the population with the best performance of relative ovary weight trait. The SNP site described in the present application is used to accurately identify individuals with genetic potential of "high relative ovary weight" at the molecular level, and the identification result has high consistency with the above classification standard based on phenotype.

[0030] The present application provides a reference population comprising a plurality of samples, each reference sample comprising whole genome variation data and ovary relative weight.

[0031] In the present application, the obtaining step of the genomic variation site closely related to the relative ovary weight comprises: aligning the resequencing data of the reference population carps to the carp reference genome sequence and filtering to obtain a first set of variation data; using a whole genome association analysis method to screen a second set of variation data associated with the relative weight of carp ovary from the first set of variation data.

[0032] The present application provides a method for obtaining variation sites and variation types specific to high relative ovary weight, comprising: dividing the reference population into three subpopulations according to the ovary weight: high relative ovary weight, medium relative ovary weight and low relative ovary weight; For each genomic variant site closely related to the relative weight of ovary, three types of variants are divided: reference homozygous, mutant homozygous and heterozygote; For each type of each site, the frequency in each subpopulation is counted. If the frequency of a type in the high relative ovary weight subpopulation is more than 2 times of the other two subpopulations, and the proportion of individuals with high relative ovary weight in the high relative ovary weight subpopulation is more than 20%, and the proportion in the low relative ovary weight subpopulation is less than 10%, then this type is considered to be a high relative ovary weight subpopulation specific variant type. All high relative ovary weight subpopulation specific variant types are classified into a high relative ovary weight specific genetic variant site and type set.

[0033] The step of determining whether the sample to be tested is high relative ovary weight in the present application comprises: Whole genome resequencing is performed on the test population of carp, the resequencing data is aligned to the reference genome sequence of carp, and filtering is performed to obtain variant sites and variant types. The variant sites and variant types of each sample to be tested are compared one by one with the high relative ovary weight specific genetic variant sites and types of the reference population, and if all the variant sites meet the variant types, the sample to be tested is a high relative ovary weight parent.

[0034] In the present application, the high relative ovary weight specific variant sites and variant types include: The first case: the 1914515th site of the carp genome NC_056581.1 is a heterozygote or mutant homozygote, and the flanking sequence is SEQ ID NO: 1, as shown below: GACCAACACTGAATACTGTAAACATGCTTAAATTATCTGGAAGAGAACCTCATTTGTCCTGTGATCAGACTTAAGATTAGAGCATGTTGGGATATAATGA[C / A]GTGACACAGCCAGTGTGATCTGTGATGAATGACTGTAACCTACAGTCAAAGACACGAGTTCAGCTCTCTGCTGCTTCAGCTCATGGCTTTATTACTGAAG The second case: the 17586713th site of the carp genome NC_056582.1 is a heterozygote or mutant homozygote, and the flanking sequence is SEQ ID NO: 2, as shown below: CGGCACCATCACCTCCACCTTGTCAGTTGGAAAGATGATTCTTACAGTGTCTAATTTCCTCTTGTGTCCTTTTTATTGCATGAATCAGTATTTTCTGTCT[G / A]CTTGCACGTACATTGTGTTGTCTTATTTCAGTCAAGCGTGCTGCTTACAGCACACAGCTCATATCTGGTAGTGATTGGACAGTTGATGTGAGTGTCAGAG Third case: the position 18667178 of the common carp genome NC_056592.1 is heterozygous or mutant homozygous, and its flanking sequence is SEQ ID NO: 3, as follows: TCGATTGCCAATCCCACTATCATGAAGTCTAGCTTGGCATTGAAACAGCCAAAGAATAGACTCAACTCTGTGATAGCATGCAAGTTTGTTTGTGGTCATG[C / G]CAGTAAATGTACAACTTTTGTGCCTGAGTGATGTGGCGGGCCGCCACAAATAGATTTTTGAAAGGCTTTGACTTTGTTGAATAAGTATAAGCACTGCACT Fourth case: the position 23541881 of the common carp genome NC_056612.1 is mutant homozygous, and its flanking sequence is SEQ ID NO: 4, as follows: ATGTGGCAGGATGTTTTGTGTTCTCTGTTTTCCCCTTTTAAGTGTGTCTCCCTGCTGTTAACAATCCTGTGAAAATGTCTGCAACACTTTAAAATTAATT[A / G]CCCATGCTCAAGCAGGTAAGACAAGGTGCCCTGATATTCCAGGAACACACTCAGCGTCTGGTAAATGAAGAGTAACCACTCACACACGGCATAATGTGAG Fifth case: the position 25898489 of the common carp genome NC_056597.1 is heterozygous or mutant homozygous, and its flanking sequence is SEQ ID NO: 5, as follows: TAAAAAATGCACCTGTAAATCAGTTTAAGGAGGCAAATATTATCTCTTAATGGAAAAGGTGTGACTGCGATCTAATTTTAAATGCACCGGGGGAGCGCTG[C / G]TGTTTGGGGTTTGAGAAGCACTGGTTCAGAGCATCGGACCCAGTATAGAGCGGCTGTACCGGCCTTGCTGCGGGAGTGCAGGTAATCATGCAGCGGCGCC Sixth case: the 49224th position of the carp genome NW_024879353.1 is heterozygous or mutant homozygous, and its flanking sequence is SEQ ID NO: 6, as shown below: TCACACAGAGTTTCCGCTCTTGTAATTAAAGTCTCTGTAGGACTCTTAAGAAAATGAAACTCCAGACAGTCTGGAATCATCAGCTGATTAAAGCACATGT[T / A]TTATTTACTCATCCCATCATTAAACGCTCGTGTCAATAACAAGCAGCTCGTCGCTTCATCCGCCGAGGGCTTCATCTTGCTTTGGGAATAGACAGCCTCA Example 1 The method for screening the high relative ovary weight dominant parent of the carp is specifically as follows: S10, obtaining the variation information of the reference population and the relative ovary weight, and the variation information including the position and variation type of the reference sample.

[0035] S20, performing correlation analysis on the variation position and variation type and the relative ovary weight to obtain the variation position closely correlated with the relative ovary weight.

[0036] S30, obtaining the variation type specific to the high relative ovary weight.

[0037] S40, selecting the closely correlated position and its variation type from all the genomic variation information of the to-be-tested sample.

[0038] S50, if all the variation positions of the to-be-tested sample relative to the relative ovary weight meet the variation type of the high relative ovary weight, the to-be-tested sample is the dominant parent of the carp with high relative ovary weight.

[0039] In step S10, the step of obtaining the whole genomic variation information of the reference sample includes: S101, for each reference carp, performing whole genome resequencing by using the second-generation sequencing technology.

[0040] S102, using BWA software, the reference of the whole genome resequencing data of carp is aligned to the reference genome sequence of carp (GCF_018340385.1). Using SAMtools software for population variation detection, VCF file storing SNP genotyping data is obtained.

[0041] S103, using Plink and VCFtools software, genotype filtering is carried out according to the standards of sequencing depth 10x, minimum allele frequency ≥0.1, deletion rate and heterozygosity <10%, and the first group of variation sites in the genome range is obtained.

[0042] In step S20, the step of obtaining the variation site closely related to the ovarian weight comprises: S201, using GCTA software to perform principal component analysis and kinship analysis on the first group of variation sites, the first five principal component feature vector matrices of the reference population and the kinship matrix between two individuals are obtained, which are used to control the false positive caused by population structure in association analysis.

[0043] S202, using mixed linear variation sites and variation types, the ovarian weight is associated to obtain closely related sites. Based on the filtered SNP sites, the relative ovarian weight of carp is used as the phenotype data, GEMMA software is used, linear mixed model (LMM) is used for association analysis, population structure and kinship obtained in step S201 are used as covariance, and P value and phenotype variation explanation rate of each variation site are estimated.

[0044] S203, taking 10-7 as the threshold, screening the SNP sites significantly associated with the relative ovarian weight to serve as the second group of variation sites.

[0045] In step S30, the step of obtaining the variation type specific to high relative ovarian weight in the closely related site comprises: S301, for the second group of variation sites, the variation type is divided into homozygous non-mutation, heterozygote and homozygous mutation, respectively marked as 0 / 0 for reference homozygous genotype, 0 / 1 for heterozygous genotype, and 1 / 1 for mutant homozygous genotype.

[0046] S302, the reference population is divided into three subpopulations according to the ovarian weight: high relative ovarian weight, medium relative ovarian weight and low relative ovarian weight.

[0047] S303, for each type of each locus, statistics the frequency in each subpopulation; if the frequency of a type in the high relative ovary weight subpopulation is more than 2 times of the other two subpopulations, then this type is considered as a high relative ovary weight subpopulation specific variant type. All high relative ovary weight subpopulation specific variant types are classified into the high relative ovary weight specific genetic variant locus and type set.

[0048] Example 2 Select 173 carp from different sources and no direct relationship, of which 143 are used as reference population and 30 samples are used as test population to verify the accuracy of variant loci and variant types. The specific steps are as follows: 1) Test materials The carp population used in the experiment is 1-year-old female carp. The population is fed in the same pond. Dissect 173 carp, weigh the ovary weight and body weight. Then store in -80°C refrigerator. Cut the fins, extract DNA, and then use second-generation genome sequencing technology to perform double-end PE150 sequencing on these individuals.

[0049] 2) Relative ovary weight detection: relative ovary weight = ovary weight / body weight x 100%. From the 173 carp, 143 are selected as reference population, of which 46 are low relative ovary weight, 47 are medium relative ovary weight, and 50 are high relative ovary weight. The remaining 30 carp are used as test samples, with 10 in each group.

[0050] 3) Mining high-quality variant loci and variant types The resequencing data of each carp is aligned to the carp genome (GCF_018340385.1) as a reference. According to the steps of S102 and S103, 28,062,245 high-quality variant loci are obtained.

[0051] 4) Obtain high relative ovary weight associated variant information According to the steps of S201, construct the 5 principal component feature vector matrix and the Kinship matrix between the 143 reference samples; according to the steps of S202, calculate the P value of the above high-quality variant loci in the relative ovary weight trait. According to the steps of S203, take 10-7 as the threshold value, and obtain 109 variant loci significantly associated with relative ovary weight.

[0052] 5) Obtain high relative ovary weight specific variant loci According to the S30 step, a total of 6 specific mutation sites with high relative ovary weight and their mutation types were obtained, and the results are shown in Table 1. As shown in Table 1, NC_056612.1: 23541881 is a mutation homozygote, which is a specific mutation type of high relative ovary weight. The remaining 5 mutation sites are heterozygotes or mutation homozygotes, which are specific mutation types of high relative ovary weight. The proportion of heterozygotes / mutation homozygotes of the 6 sites in high relative ovary weight is 22%~34%, while the proportion in low relative ovary weight is only 2.15%~6.45%. The distribution of the 6 mutation sites in the two populations has a significant difference.

[0053] Table 1 Mutation sites and mutation types closely related to relative ovary weight.

[0054] 6) Verification of the accuracy of 6 specific mutation sites in the test population In 3), the whole genome mutation sites of 30 test samples were obtained, including 6 specific mutation sites with high relative ovary weight and their mutation types. With true positive (actually high relative ovary weight individual, identified as high relative ovary weight individual after using the mutation site for detection), false positive (actually low relative ovary weight individual, identified as high relative ovary weight individual after using the mutation site for detection), true negative (actually low relative ovary weight individual, identified as low relative ovary weight individual after using the mutation site for detection), and false negative (actually high relative ovary weight individual, identified as low relative ovary weight individual after using the mutation site for detection), the accuracy of 6 specific mutation sites was evaluated, and the results are shown in Table 2. As shown in Table 2, the true positive rate, false positive rate, and true negative rate of the 6 mutation sites are 100%, 0%, and 100%, respectively, and the false negative rate is 50%~70%. These results show that the results of using these sites for detection are positive, and there is a high accuracy of high relative ovary weight female fish.

[0055] Table 2 Prediction accuracy of 6 mutation sites based on 30 test individuals SEQUENCE LISTING SEQ ID NO: 1 GACCAACACTGAATACTGTAAACATGCTTAAATTATCTGGAAGAGAACCTCATTTGTCCTGTGATCAGACTTAAGATTAGAGCATGTTGGGATATAATGA[C / A]GTGACACAGCCAGTGTGATCTGTGATGAATGACTGTAACCTACAGTCAAAGACACGAGTTCAGCTCTCTGCTGCTTCAGCTCATGGCTTTATTACTGAAG SEQ ID NO: 2 CGGCACCATCACCTCCACCTTGTCAGTTGGAAAGATGATTCTTACAGTGTCTAATTTCCTCTTGTGTCCTTTTTATTGCATGAATCAGTATTTTCTGTCT[G / A]CTTGCACGTACATTGTGTTGTCTTATTTCAGTCAAGCGTGCTGCTTACAGCACACAGCTCATATCTGGTAGTGATTGGACAGTTGATGTGAGTGTCAGAG SEQ ID NO: 3 TCGATTGCCAATCCCACTATCATGAAGTCTAGCTTGGCATTGAAACAGCCAAAGAATAGACTCAACTCTGTGATAGCATGCAAGTTTGTTTGTGGTCATG[C / G]CAGTAAATGTACAACTTTTGTGCCTGAGTGATGTGGCGGGCCGCCACAAATAGATTTTTGAAAGGCTTTGACTTTGTTGAATAAGTATAAGCACTGCACT SEQ ID NO: 4 ATGTGGCAGGATGTTTTGTGTTCTCTGTTTTCCCCTTTTAAGTGTGTCTCCCTGCTGTTAACAATCCTGTGAAAATGTCTGCAACACTTTAAAATTAATT[A / G]CCCATGCTCAAGCAGGTAAGACAAGGTGCCCTGATATTCCAGGAACACACTCAGCGTCTGGTAAATGAAGAGTAACCACTCACACACGGCATAATGTGAG SEQ ID NO: 5 TAAAAAATGCACCTGTAAATCAGTTTAAGGAGGCAAATATTATCTCTTAATGGAAAAGGTGTGACTGCGATCTAATTTTAAATGCACCGGGGGAGCGCTG[C / G]TGTTTGGGGTTTGAGAAGCACTGGTTCAGAGCATCGGACCCAGTATAGAGCGGCTGTACCGGCCTTGCTGCGGGAGTGCAGGTAATCATGCAGCGGCGCC SEQ ID NO: 6 TCACACAGAGTTTCCGCTCTTGTAATTAAAGTCTCTGTAGGACTCTTAAGAAAATGAAACTCCAGACAGTCTGGAATCATCAGCTGATTAAAGCACATGT[T / A]TTATTTACTCATCCCATCATTAAACGCTCGTGTCAATAACAAGCAGCTCGTCGCTTCATCCGCCGAGGGCTTCATCTTGCTTTGGGAATAGACAGCCTCA The number of devices and the processing size described herein are used to simplify the description of the application. Applications, modifications and variations of the application will be apparent to those skilled in the art.

[0056] While embodiments of the application have been disclosed in connection with the specified embodiments, as described above, it should be understood that it can be employed in various other arrangements and scenarios. Other modifications and enhancements are also possible. Accordingly, the application is not to be limited in scope by the specific embodiments disclosed and will be interpreted to embrace all modifications and enhancements that are within the true spirit and scope of the general inventive concept as set out in the claims and equivalents thereof.

Claims

1. A SNP locus for identifying parent carp with high relative ovarian weight, characterized in that, SNP sites are selected from any of the following sites: a) The SNP located at position 1914515 of sequence NC_056581.1; b) The SNP located at position 17586713 of sequence NC_056582.1; c) The SNP located at position 18667178 of sequence NC_056592.1; d) The SNP located at position 23541881 of sequence NC_056612.1; e) The SNP located at position 25898489 of sequence NC_056597.1; f) The SNP located at position 49224 of sequence NW_024879353.

1.

2. The SNP locus for identifying high relative ovarian weight carp parents as described in claim 1, characterized in that, The specific types of SNP sites are as follows: For sites a), b), c), e), and f), the specific variant type is heterozygous or mutant homozygous; For site d), the specific variant type is homozygous mutation.

3. A primer set or probe for identifying high relative ovarian weight carp parents, characterized in that, The primer set or probe is used to specifically amplify or detect the SNP site as described in any one of claims 1 or 2.

4. A detection kit for identifying parent carp with high relative ovarian weight, characterized in that, The kit contains the primer set or probe as described in claim 3.

5. The application of the SNP loci for identifying high relative ovarian weight carp parents as described in claim 1 in the method for identifying high relative ovarian weight carp parents, characterized in that, Includes the following steps: (1) Obtain the genomic DNA of the carp to be tested; (2) Detecting the genotype of genomic DNA at any one of the SNP molecular marker sites described in claims 1 (a) to (f); (3) Based on the detected genotype, determine whether the individual being tested is a parent with a high relative ovarian weight: If the genotype of the detected loci (a), (b), (c), (e), or (f) is heterozygous or homozygous for mutation, then the individual to be tested is determined to be a parent with high relative ovarian weight. If the genotype of the detected locus d) is homozygous for mutation, then the individual to be tested is determined to be a parent with high relative ovarian weight.

6. The application of the SNP loci for identifying high relative ovarian weight carp parents as described in claim 5 in the method for identifying high relative ovarian weight carp parents, characterized in that, In step (2), the genotype of the SNP site is detected by high-throughput sequencing.

Images