SNP loci for identifying high relative ovary weight carp parents and application thereof
By using six specific SNP loci, their primer sets, and probes, combined with high-throughput sequencing, the problems of long breeding cycles and high misjudgment rates in carp parent selection were solved, enabling early, accurate, and non-destructive parent selection and improving carp breeding efficiency.
Patent Information
- Application Number
- CN202511517544.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-23
- Publication Date
- 2026-01-27
- Estimated Expiration
- 2045-10-23
AI Technical Summary
Current technologies rely on phenotypic observation in the selection of carp broodstock, resulting in long breeding cycles, high misjudgment rates, and an inability to accurately select individuals with high relative ovarian weight in the early stages. Furthermore, traditional dissection methods are highly destructive, affecting breeding efficiency.
Using six specific SNP loci and their corresponding primer sets or probes, the genotype of individual carp is detected by high-throughput sequencing, enabling non-destructive early identification of parents with high relative ovarian weight, and providing standardized detection kits and operating procedures.
It enables early, accurate, and non-destructive parental screening, shortens the breeding cycle, improves the efficiency and accuracy of parental selection, lowers the operational threshold, and is suitable for rapid screening of large-scale breeding populations.
Smart Images

Figure SMS_1 
Figure SMS_2
Abstract
Description
Technical Field
[0001] This invention relates to the fields of molecular genetics and aquatic breeding technology. More specifically, this invention relates to a SNP locus for identifying high relative ovarian weight carp parents and its application. Background Technology
[0002] Carp (Cyprinus carpio) are important freshwater economic fish, and their reproductive efficiency directly affects the profitability of the aquaculture industry. Within a population of female carp of the same age, there are significant differences in the number of eggs carried by individuals, ranging from tens of thousands to hundreds of thousands per fish. This difference in reproductive capacity is directly reflected in the difference in ovarian weight. Therefore, quickly and accurately selecting individuals with high ovarian weight as broodstock is crucial for improving the overall reproductive potential of the carp population.
[0003] Currently, in production practice, the selection of parent fish largely relies on empirical phenotypic observation. Traditional methods typically involve using the degree of abdominal swelling in female fish during the breeding season to preliminarily determine their ovulation status. However, this method has significant limitations. First, it is constrained by the fish's reproductive cycle, making early prediction and selection of potential parent fish impossible outside the breeding season, resulting in an excessively long breeding cycle. Second, judging based on abdominal size has a high false-positive rate, as the accumulation of adipose tissue in the abdominal cavity also causes abdominal swelling, making the observation results unreliable in reflecting the actual development of the ovaries. Furthermore, the absolute weight of the ovaries is closely related to the fish's body weight; heavier individuals often have heavier ovaries. However, for individuals of similar weight, it is difficult to effectively distinguish their relative reproductive capacity based solely on appearance or absolute ovarian weight.
[0004] To eliminate the influence of body weight, using relative ovarian weight (the ratio of ovarian weight to body weight) as a key indicator for assessing the reproductive performance of female carp is more scientific and accurate. However, the conventional method for obtaining this data requires dissecting and weighing the parent stock, which is clearly a destructive test and contradicts the breeding goal of preserving superior parent stock for continuous reproduction.
[0005] Therefore, the aquaculture industry urgently needs a new method that can accurately identify high relative ovarian weight carp broodstock without relying on the breeding season or dissection, and can predict the reproductive potential of fish at any stage of their growth in a non-destructive manner, thereby enabling early, efficient and precise selection of superior broodstock. Summary of the Invention
[0006] One object of the present invention is to solve at least the above-mentioned problems and to provide at least the advantages that will be described later.
[0007] Another objective of this invention is to provide a SNP locus for identifying high relative ovarian weight carp parents and its application, in order to solve the technical problems that traditional methods rely on phenotypic measurements, which are destructive, highly susceptible to environmental influences, and unable to screen immature individuals in the early stages, thus restricting breeding efficiency.
[0008] To achieve these objectives and other advantages of the present invention, a SNP locus for identifying high relative ovarian weight carp parents is provided, wherein the SNP locus is selected from any of the following loci:
[0009] a) The SNP located at position 1914515 of sequence NC_056581.1;
[0010] b) The SNP located at position 17586713 of sequence NC_056582.1;
[0011] c) The SNP located at position 18667178 of sequence NC_056592.1;
[0012] d) The SNP located at position 23541881 of sequence NC_056612.1;
[0013] e) The SNP located at position 25898489 of sequence NC_056597.1;
[0014] f) The SNP located at position 49224 of sequence NW_024879353.1.
[0015] Preferably, the SNP sites used for identifying high relative ovarian weight carp parents have the following specific types:
[0016] For sites a), b), c), e), and f), the specific variant type is heterozygous or mutant homozygous;
[0017] For site d), the specific variant type is homozygous mutation.
[0018] The present invention also provides a primer set or probe for identifying high relative ovarian weight carp parents, the primer set or probe being used to specifically amplify or detect the above-mentioned SNP sites.
[0019] The present invention also provides a detection kit for identifying parent carp with high relative ovarian weight, the kit comprising the above-mentioned primer set or probe.
[0020] The present invention also provides the application of the above-mentioned SNP sites for identifying high relative ovarian weight carp parents in the method for identifying high relative ovarian weight carp parents, which includes the following steps:
[0021] (1) Obtain the genomic DNA of the carp to be tested;
[0022] (2) Detect the genotype of genomic DNA at any SNP molecular marker site from a) to f);
[0023] (3) Based on the detected genotype, determine whether the individual being tested is a parent with a high relative ovarian weight:
[0024] If the genotype of the detected loci (a), (b), (c), (e), or (f) is heterozygous or homozygous for mutation, then the individual to be tested is determined to be a parent with high relative ovarian weight.
[0025] If the genotype of the detected locus d) is homozygous for mutation, then the individual to be tested is determined to be a parent with high relative ovarian weight.
[0026] Preferably, in the method for identifying SNP sites for identifying high relative ovarian weight carp parents, step (2) involves detecting the genotype of the SNP sites using high-throughput sequencing.
[0027] The present invention has at least the following beneficial effects:
[0028] 1. This invention provides a set of six specific SNP loci, offering direct molecular evidence for identifying high relative ovarian weight in carp. These loci are significantly associated with the trait, enabling breeding efforts to shift from traditional reliance on anatomical and phenotypic observations to precise DNA-level detection. Using these loci, screening can be performed at any stage before sexual maturity in carp, achieving early selection and significantly shortening the breeding cycle. Furthermore, this method is unaffected by environmental factors, resulting in more stable and reliable results, providing crucial marker resources for breeding new high-fertility carp varieties.
[0029] 2. This invention clarifies the dominant genotype corresponding to each SNP locus, enabling the accurate interpretation and practical application of molecular marker data. It specifies that at five loci, heterozygous or homozygous mutant genotypes are dominant, while at another specific locus, they are homozygous mutant. This clear criterion avoids ambiguity in genotype result interpretation, ensures the consistency and accuracy of identification conclusions, and enables technicians to quickly and accurately screen parental individuals with high relative ovarian weight potential based on test results.
[0030] 3. This invention provides primer sets or probes specifically targeting the above-mentioned SNP sites, which is a key step in moving from theory to application. Specific primers or probes can accurately target the target sites and achieve efficient and specific amplification or hybridization in molecular detection technologies such as PCR and gene chips, thereby obtaining accurate genotyping results. This lays the core foundation for the subsequent development of standardized detection methods and kits, ensuring the specificity and sensitivity of the detection.
[0031] 4. This invention integrates the primer set or probe required for detection into a single kit, greatly facilitating the promotion and application of this technology. The kit provides standardized detection components, ensuring the stability and comparability of detection results across different batches and by different operators. It lowers the technical operation threshold, enabling breeding farm technicians without a strong background in molecular biology to perform the tests smoothly, which is conducive to the rapid popularization and application of this molecular marker-assisted selection technology in the front line of aquaculture breeding.
[0032] 5. This invention establishes a complete and clear standardized operating procedure from DNA extraction to parentage determination in the method for identifying high relative ovarian weight carp parents. The method has clear steps and specific interpretation standards, and has strong operability and repeatability. By applying this method, breeders can systematically and in batches screen the reserve parent population, efficiently identify superior individuals with high reproductive potential, thereby significantly improving the efficiency and accuracy of parentage selection and reducing losses caused by misjudgment or omission in traditional methods.
[0033] 6. This invention provides an efficient technical solution for rapid screening of large-scale breeding populations by specifying the use of high-throughput sequencing for genotyping. High-throughput sequencing technology can simultaneously detect multiple SNP loci in tens of thousands of samples, offering advantages such as high throughput, high automation, and data accuracy. It is suitable for the large-scale screening needs of core breeding populations, significantly shortening genotyping time and reducing the detection cost per sample, thereby accelerating the entire breeding process.
[0034] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Detailed Implementation
[0035] The present invention will be further described in detail below with reference to embodiments, so that those skilled in the art can implement it based on the description.
[0036] It should be understood that terms such as “having,” “comprising,” and “including” as used herein do not exclude the presence or addition of one or more other elements or combinations thereof.
[0037] It should be noted that, unless otherwise specified, the experimental methods described in the following implementation plan are all conventional methods, and the reagents and materials described are all commercially available unless otherwise specified.
[0038] This application creatively links genomic variation sites and variation types of carp with relative ovarian weight, obtaining genetic variation sites associated with relative ovarian weight and constructing a set of specific genetic variation sites for high relative ovarian weight. Based on obtaining the whole-genome variation sites and variation types of each individual in the test population, it determines whether they conform to the specific genetic variation sites and types for high relative ovarian weight, and selects individuals conforming to the above genetic variation sites and types as reserve parents for high relative ovarian weight. The method provided in this application can efficiently classify the relative ovarian weight of carp, providing technical support for the identification and breeding of new germplasm of carp with high relative ovarian weight. This application can efficiently classify the relative ovarian weight of carp, providing excellent materials for the identification and breeding of new germplasm of carp with high relative ovarian weight.
[0039] In this invention, "relative ovarian weight" is a key indicator for evaluating the reproductive performance of female carp. Its calculation formula is: relative ovarian weight (Gonadosomatic Index, GSI) = (ovarian weight / body weight) × 100%.
[0040] To objectively and clearly define the "high relative ovarian weight" of this invention, the following classification is made based on the phenotypic data analysis of the reference population:
[0041] Low relative ovarian weight group: refers to individuals whose relative ovarian weight is in the lowest 1 / 3 range of the entire reference group. In a specific embodiment of the present invention, the relative ovarian weight of this group is typically below 33%.
[0042] The middle relative ovarian weight group refers to individuals whose relative ovarian weight falls within approximately one-third of the middle range of the entire reference group. In specific embodiments of the present invention, the relative ovarian weight of this group typically ranges from 34% to 66%.
[0043] High relative ovarian weight population: refers to individuals whose relative ovarian weight falls within approximately the highest 1 / 3 of the entire reference population. This invention aims to screen for precisely this type of individual. In a specific embodiment of this invention, the relative ovarian weight of this population is typically higher than 67%.
[0044] The percentage thresholds mentioned above are merely examples. In actual applications, adjustments need to be made based on the target carp variety, aquaculture environment, and breeding objectives. However, the core selection principle remains unchanged: selecting the population with the best relative ovarian weight trait. The SNP loci described in this invention are used to accurately identify individuals with the genetic potential for "high relative ovarian weight" at the molecular level, and their identification results are highly consistent with the aforementioned phenotypic-based grading standards.
[0045] This invention provides a reference population comprising multiple samples, each of which includes whole-genome variation data and relative ovarian weight.
[0046] In this invention, the steps for obtaining genomic variant sites closely associated with relative ovarian weight include:
[0047] The resequencing data of the reference carp population was aligned to the carp reference genome sequence and filtered to obtain the first set of variation data;
[0048] Using genome-wide association analysis, a second set of variant data associated with the relative weight of carp ovaries was screened from the first set of variant data.
[0049] The steps for obtaining high relative ovarian weight-specific variant sites and variant types in this invention include:
[0050] The reference population was divided into three subgroups based on ovarian weight: high relative ovarian weight, medium relative ovarian weight, and low relative ovarian weight.
[0051] For each genomic variant site closely associated with relative ovarian weight, it is classified into three variant types: reference homozygous, mutant homozygous, and heterozygous.
[0052] For each type at each locus, the frequency in each subpopulation was counted;
[0053] If a type is more than twice as frequent in the high relative ovarian weight subgroup as in the other two subgroups, and can identify individuals with high relative ovarian weight in more than 20% of the relative ovarian weight subgroup, and in less than 10% of the medium and low relative ovarian weight subgroups, then this type is considered a variant specific to the high relative ovarian weight subgroup.
[0054] All subpopulation-specific variants of high relative ovarian weight are classified into a set of specific genetic variant sites and types of high relative ovarian weight.
[0055] The steps of this invention to determine whether a sample has a high relative ovarian weight include:
[0056] Whole-genome resequencing was performed on the carp population to be tested. The resequencing data was aligned to the carp reference genome sequence and filtered to obtain the mutation sites and mutation types.
[0057] Using the specific genetic variant sites and types of high relative ovarian weight in the reference population as a control, the variant sites and variant types of each test sample are compared one by one. If all variant sites match the variant type, then the test sample is a parent with high relative ovarian weight.
[0058] In this invention, the variant sites and variant types that are highly specific to ovarian weight include:
[0059] The first scenario: Position 1914515 of the carp genome NC_056581.1 is heterozygous or homozygous for a mutation, and its flanking sequence is SEQ ID NO: 1, as shown below:
[0060] GACCAACACTGAATACTGTAAACATGCTTAAATTATCTGGAAGAGAACCTCATTTGTCCTGTGATCAGACTTAAGATTAGAGCATGTTGGGATATAATGA[C / A]GTGACACAGCCAGTGTGATCTGTGATGAATGACTGTAACCTACAGTCAAAGACACGAGTTCAGCTCTCTGCTGCTTCAGCTCATGGCTTTATTACTGAAG
[0061] The second scenario: Position 17586713 of the carp genome NC_056582.1 is heterozygous or homozygous for a mutation, and its flanking sequence is SEQ ID NO: 2, as shown below:
[0062] CGGCACCATCACCTCCACCTTGTCAGTTGGAAAGATGATTCTTACAGTGTCTAATTTCCTCTTGTGTCCTTTTTATTGCATGAATCAGTATTTTCTGTCT[G / A]CTTGCACGTACATTGTGTTGTCTTATTTCAGTCAAGCGTGCTGCTTACAGCACACAGCTCATATCTGGTAGTGATTGGACAGTTGATGTGAGTGTCAGAG
[0063] The third scenario: Position 18667178 of the carp genome NC_056592.1 is heterozygous or homozygous for a mutation, and its flanking sequence is SEQ ID NO: 3, as shown below:
[0064] TCGATTGCCAATCCCACTATCATGAAGTCTAGCTTGGCATTGAAACAGCCAAAGAATAGACTCAACTCTGTGATAGCATGCAAGTTTGTTTGTGGTCATG[C / G]CAGTAAATGTACAACTTTTGTGCCTGAGTGATGTGGCGGGCCGCCACAAATAGATTTTTGAAAGGCTTTGACTTTGTTGAATAAGTATAAGCACTGCACT
[0065] The fourth scenario: The mutation at position 23541881 of the carp genome NC_056612.1 is homozygous, and its flanking sequence is SEQ ID NO: 4, as shown below:
[0066] ATGTGGCAGGATGTTTTGTGTTCTCTGTTTTCCCCTTTTAAGTGTGTCTCCCTGCTGTTAACAATCCTGTGAAAATGTCTGCAACACTTTAAAATTAATT[A / G]CCCATGCTCAAGCAGGTAAGACAAGGTGCCCTGATATTCCAGGAACACACTCAGCGTCTGGTAAATGAAGAGTAACCACTCACACACGGCATAATGTGAG
[0067] The fifth scenario: Position 25898489 of the carp genome NC_056597.1 is heterozygous or homozygous for a mutation, and its flanking sequence is SEQ ID NO: 5, as shown below:
[0068] TAAAAAATGCACCTGTAAATCAGTTTAAGGAGGCAAATATTATCTCTTAATGGAAAAGGTGTGACTGCGATCTAATTTTAAATGCACCGGGGGAGCGCTG[C / G]TGTTTGGGGTTTGAGAAGCACTGGTTCAGAGCATCGGACCCAGTATAGAGCGGCTGTACCGGCCTTGCTGCGGGAGTGCAGGTAATCATGCAGCGGCGCC
[0069] The sixth scenario: Position 49224 of the carp genome NW_024879353.1 is heterozygous or homozygous for a mutation, and its flanking sequence is SEQ ID NO: 6, as shown below:
[0070] TCACACAGAGTTTCCGCTCTTGTAATTAAAGTCTCTGTAGGACTCTTAAGAAAATGAAACTCCAGACAGTCTGGAATCATCAGCTGATTAAAGCACATGT[T / A]TTATTTACTCATCCCATCATTAAACGCTCGTGTCAATAACAAGCAGCTCGTCGCTTCATCCGCCGAGGGCTTCATCTTGCTTTGGGAATAGACAGCCTCA
[0071] Example 1
[0072] The specific procedure for screening carp parents with high relative ovarian weight advantage is as follows:
[0073] S10. Obtain the variation information and relative ovarian weight of the reference population. The variation information includes the locus and variation type of the reference sample.
[0074] S20. Using the variant sites and variant types to perform correlation analysis with relative ovarian weight, variant sites closely associated with relative ovarian weight are obtained.
[0075] S30, Obtain variant types that are highly specific to ovarian weight.
[0076] S40. Select closely related sites and their variant types from all genomic variation information of the sample to be tested.
[0077] S50. If all the variant sites related to relative ovarian weight in the sample to be tested conform to the variant type of high relative ovarian weight, the sample to be tested is a dominant parent of carp with high relative ovarian weight.
[0078] Step S10, the steps for obtaining whole-genome variation information of the reference sample, include:
[0079] S101. For each reference carp, whole-genome resequencing was performed using next-generation sequencing technology.
[0080] S102. Using BWA software, the whole-genome resequencing data of the reference carp was aligned to the carp reference genome sequence (GCF_018340385.1). SAMtools software was used to perform population variation detection to obtain the VCF file storing the SNP genotyping data.
[0081] S103. Using Plink and VCFtools software, genotype filtering was performed based on the criteria of sequencing depth 10×, minimum allele frequency ≥0.1, and deletion rate and heterozygosity <10% to obtain the first set of variant sites within the genome.
[0082] Step S20, which involves obtaining variant sites closely associated with ovarian weight, includes:
[0083] S201. Principal component analysis and kinship analysis were performed on the first group of variant sites using GCTA software to obtain the eigenvector matrix of the first 5 principal components of the reference population and the kinship matrix between each pair of individuals, in order to control for false positives in association analysis caused by population structure.
[0084] S202. A mixed linear model was used to perform association analysis between variant sites and variant types and ovarian weight to obtain closely associated sites. Based on the filtered SNP sites, using relative ovarian weight in carp as phenotypic data, an association analysis was performed using GEMMA software with a linear mixed model (LMM). The population structure and kinship obtained in step S201 were used as covariance to estimate the p-value and phenotypic variance explained for each variant site.
[0085] S203. Using a threshold of 10⁻⁷, SNP sites that are significantly associated with relative ovarian weight are screened as the second group of variant sites.
[0086] Step S30, which involves obtaining the variant types at closely associated loci that are highly specific for ovarian weight, includes:
[0087] S301. For the second group of variant sites, the variant types are divided into homozygous non-mutant, heterozygous, and homozygous mutant, respectively labeled as 0 / 0 for reference homozygous genotype, 0 / 1 for heterozygous genotype, and 1 / 1 for mutant homozygous genotype.
[0088] S302. The reference population is divided into three subgroups based on ovarian weight: high relative ovarian weight, medium relative ovarian weight, and low relative ovarian weight.
[0089] S303. For each type at each locus, the frequency is counted in each subpopulation. If the frequency of a type in the high relative ovarian weight subpopulation is more than twice that in the other two subpopulations, then this type is considered a subpopulation-specific variant of high relative ovarian weight. All subpopulation-specific variants of high relative ovarian weight are categorized into a set of high ovarian weight-specific genetic variant loci and types.
[0090] Example 2
[0091] A total of 173 carp from different sources and without direct kinship were selected. 143 samples were used as a reference group, and 30 samples were used as the test group to verify the accuracy of the mutation sites and mutation types. The specific steps are as follows:
[0092] 1) Test materials
[0093] The carp used in the experiment were one-winter-old females. This group was raised in the same pond. 173 carp samples were dissected, and the ovarian weight and body weight were measured. The samples were then stored at -80°C. Fins were removed, DNA was extracted, and paired-end PE150 sequencing was performed on these individuals using next-generation genome sequencing technology.
[0094] 2) Relative ovarian weight measurement: Relative ovarian weight = ovarian weight / body weight × 100%. From 173 carp, 143 samples were selected as a reference group, with 46 carp having low relative ovarian weight, 47 having medium relative ovarian weight, and 50 having high relative ovarian weight. The remaining 30 carp were used as the test samples, with 10 carp in each group.
[0095] 3) Discovering high-quality variant sites and variant types
[0096] For each carp, resequencing data was used, and sequence alignment was performed with the carp genome (GCF_018340385.1) as a reference. Following steps S102 and S103, 28,062,245 high-quality variant sites were obtained.
[0097] 4) Obtain variant information with high relative ovarian reassociation.
[0098] Following step S201, construct the eigenvector matrix of five principal components and the Kinship matrix among the 143 reference samples; following step S202, calculate the p-value of the aforementioned high-quality variant sites for the relative ovarian severity trait; following step S203, using 10⁻⁷ as a threshold, obtain 109 variant sites significantly associated with relative ovarian severity.
[0099] 5) Obtain specific variant sites with high relative ovarian weight
[0100] Following step S30, six specific variant sites and their variant types for high relative ovarian weight were obtained, as shown in Table 1. Table 1 shows that NC_056612.1:23541881 is a homozygous mutation, representing a variant type specific to high relative ovarian weight. The remaining five variant sites were either heterozygous or homozygous mutations, also representing variant types specific to high relative ovarian weight. The proportion of these six variant sites in heterozygous / homozygous individuals with high relative ovarian weight ranged from 22% to 34%, while the proportion in those with medium to low relative ovarian weight ranged from only 2.15% to 6.45%. The distribution of these six variant sites differed significantly between the two populations.
[0101] Table 1. Variants and variant types closely related to relative ovarian weight.
[0102]
[0103] 6) Validate the accuracy of the six specific variant sites in the target population.
[0104] In step 3), whole-genome variation sites were obtained from 30 test samples, including 6 specific variation sites and their variation types for high relative ovarian weight. The accuracy of the 6 specific variation sites was evaluated using four indicators: true positive (actually high relative ovarian weight individuals were identified as such after testing with this variation site), false positive (actually medium to low relative ovarian weight individuals were identified as such after testing with this variation site), true negative (actually medium to low relative ovarian weight individuals were identified as such after testing with this variation site), and false negative (actually high relative ovarian weight individuals were identified as such after testing with this variation site). The results are shown in Table 2. Table 2 shows that the true positive rate, false positive rate, and true negative rate for these 6 variation sites were 100%, 0%, and 100%, respectively, while the false negative rate ranged from 50% to 70%. These results indicate that carp broodstock with positive test results using these sites have a very high accuracy rate in identifying females with high relative ovarian weight.
[0105] Table 2. Prediction accuracy based on 30 individuals and 6 variant sites.
[0106]
[0107] sequence list
[0108] SEQ ID NO: 1
[0109] GACCAACACTGAATACTGTAAACATGCTTAAATTATCTGGAAGAGAACCTCATTTGTCCTGTGATCAGACTTAAGATTAGAGCATGTTGGGATATAATGA[C / A]GTGACACAGCCAGTGTGATCTGTGATGAATGACTGTAACCTACAGTCAAAGACACGAGTTCAGCTCTCTGCTGCTTCAGCTCATGGCTTTATTACTGAAG
[0110] SEQ ID NO: 2
[0111] CGGCACCATCACCTCCACCTTGTCAGTTGGAAAGATGATTCTTACAGTGTCTAATTTCCTCTTGTGTCCTTTTTATTGCATGAATCAGTATTTTCTGTCT[G / A]CTTGCACGTACATTGTGTTGTCTTATTTCAGTCAAGCGTGCTGCTTACAGCACACAGCTCATATCTGGTAGTGATTGGACAGTTGATGTGAGTGTCAGAG
[0112] SEQ ID NO: 3
[0113] TCGATTGCCAATCCCACTATCATGAAGTCTAGCTTGGCATTGAAACAGCCAAAGAATAGACTCAACTGTGATAGCATGCAAGTTTGTTTGTGGTCATG[C / G]CAGTAAATGTACAACTTTTGTGCCTGAGTGATGTGGCGGCCGCCAAATAGATTTGACTGACTGATTAGTAGTT
[0114] SEQ ID NO: 4
[0115] ATGTGGCAGGATGTTTTGTGTTCTCTGTTTTCCCCTTTTAGTGTGTCTCCCTGCTGTTAACAATCCTGTGAAAATGTCTGCAACACTTTAAAATTAATT[A / G]CCATGCTCAAGCAGGTAAGACAAGGTGCCCTGATATTCCAGGACACTCAGCGTCTGGAGTACACTCAAGCAAGCAAG
[0116] SEQ ID NO: 5
[0117] TAAAAAATGCACCTGTAAATCAGTTTAAGGAGCAAATTATCTCTTAATGGAAAAGGTGTGACTGCGATCTAATTTTAATTAATGCACCGGGGGAGGCCTG[C / G]TGTTTGGGGTTTGAGAAGCACTGGTTCAGAGCATCGGACCCAGTAGAGCCGGACTGGTGCCGTT
[0118] SEQ ID NO: 6
[0119] TCACACAGAGTTTCCGCTCTTGTAATTAAAGTCTCTGTAGGACTCTTAAGAAAATGAAACTCCAGACAGTCTGGAATCATCAGCTGATTAAAGCACATGT[T / A]TTATTTACTCATCCCATCATTAAACGCTCGTGTCAATAACAAGCAGCTCGTCGCTTCATCCGCCGAGGGCTTCATCTTGCTTTGGGAATAGACAGCCTCA
[0120] The number of devices and processing scale described herein are for the purpose of simplifying the description of the invention. Applications, modifications, and variations of the invention will be readily apparent to those skilled in the art.
[0121] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details.
Claims
1. The application of a SNP locus in identifying parent carp with high relative ovarian weight, characterized in that, SNP sites are selected from any of the following sites: a) The SNP located at position 1914515 of sequence NC_056581.1 has a reference base of C and a variant base of A; b) The SNP located at position 17586713 of sequence NC_056582.1, with reference base G and variant base A; c) The SNP located at position 18667178 of sequence NC_056592.1, with reference base C and variant base G; d) The SNP located at position 23541881 of sequence NC_056612.1, with reference base A and variant base G; e) The SNP located at position 25898489 of sequence NC_056597.1, with reference base C and variant base G; f) The SNP located at position 49224 of sequence NW_024879353.1, with reference base T and variant base A; If the genotype of the detected loci a), b), c), e), or f) is heterozygous or homozygous for mutation, then the individual to be tested is determined to be a parent with high relative ovarian weight. If the genotype of the detected locus d) is homozygous for mutation, then the individual to be tested is determined to be a parent with high relative ovarian weight.
2. The application of the SNP site as described in claim 1 in identifying parent carp with high relative ovarian weight, characterized in that, Includes the following steps: (1) Obtain the genomic DNA of the carp to be tested; (2) Detect the genotype of genomic DNA at any SNP molecular marker site from a) to f); (3) Based on the detected genotype, determine whether the individual being tested is a parent with a high relative ovarian weight: If the genotype of the detected loci a), b), c), e), or f) is heterozygous or homozygous for mutation, then the individual to be tested is determined to be a parent with high relative ovarian weight. If the genotype of the detected locus d) is homozygous for mutation, then the individual to be tested is determined to be a parent with high relative ovarian weight.
3. The application of the SNP site as described in claim 2 in identifying parent carp with high relative ovarian weight, characterized in that, In step (2), the genotype of the SNP site is detected by high-throughput sequencing.
Citation Information
Patent Citations
SNP molecular marker related to grass carp traits and application thereof
CN109554486A
SNP (Single Nucleotide Polymorphism) molecular marker related to carp hypoxia resistance character and application thereof
CN117625797A