Mycobacterium tuberculosis rpoB gene mutation detection method and kit based on CRISPR-Cas12a technology

Abstract

The invention discloses a mycobacterium tuberculosis rpoB gene mutation detection method based on a CRISPR-Cas12a technology and a kit, and relates to the technical field of molecular biological detection. According to the present invention, through the design and the screening of the specific crRNA, the 531-crRNA4 with the nucleotide sequence represented by SEQ ID NO. 4 is successfully obtained; the sequence is combined with CRISPR-Cas12a and a PCR (Polymerase Chain Reaction) technology, can efficiently detect the rifampicin drug-resistant mutation site S531L, and has the remarkable advantages of high sensitivity, strong specificity, simplicity and convenience in operation and the like. The detection result of a clinical sample is highly consistent with the Sanger sequencing result, the detection time is shortened to be within 2 hours, and the method is suitable for rapid screening of clinical drug resistance. According to the technology, the time for doctors and patients to obtain detection reports is remarkably shortened, and the medical efficiency is effectively improved.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology detection technology, specifically relating to a method and kit for detecting Mycobacterium tuberculosis rpoB gene mutations using CRISPR-Cas12a technology. Background Technology

[0002] Rifampicin resistance in Mycobacterium tuberculosis (MTB) is primarily caused by mutations in its rpoB gene, with S531L (serine 531 → leucine) being the most common resistance mutation site. Traditional detection methods (such as sequencing and probe hybridization) suffer from complexity, time consumption, and insufficient sensitivity in mixed samples (coexistence of mutant and wild-type). CRISPR-Cas12a technology, due to its high specificity and trans-cleavage activity, shows potential in nucleic acid detection, but its application in detecting drug resistance gene mutations still faces challenges such as crRNA design optimization and reaction system compatibility. However, no natural PAM sequence exists near the S531L site, yet the presence of a PAM site is necessary to activate Cas12a activity when recognizing dsDNA. This significantly limits the application of the CRISPR-Cas12 system in detecting drug resistance mutations in Mycobacterium tuberculosis. In patent CN118895376A, artificial PAM sequences were inserted into PCR primers to force the generation of PAM near the target site. This, combined with nested PCR and CRISPR-Cas12a, enabled the recognition of the S531L site of Mycobacterium tuberculosis.

[0003] Since most drug-resistant bacteria are often mixed with wild-type sensitive bacteria, the genome of the extracted bacteria often contains a large amount of wild-type background. Therefore, the designed crRNA for detecting mutation regions must be tightly paired with the mutation site region of the gene being detected, forming a ternary complex in the presence of LbCas12a enzyme to activate trans-cleavage activity, cleaving the reporter probe to emit a strong fluorescent signal. However, if this crRNA cannot be completely paired with the wild-type gene, it cannot activate the trans-cleavage activity of the nuclease and cannot cleave the reporter probe to emit a strong fluorescent signal. Summary of the Invention

[0004] [Technical Issues] This invention provides a novel method and kit for detecting rpoB gene mutations in Mycobacterium tuberculosis based on CRISPR-Cas12a technology.

[0005] [Technical Solution] This invention provides a method and kit for detecting rpoB gene mutations based on CRISPR-Cas12a technology, enabling rapid, sensitive, and specific detection of drug-resistant mutations in Mycobacterium tuberculosis (such as S531L), and is particularly suitable for detecting low-abundance mutations in mixed samples.

[0006] The first objective of this invention is to provide a crRNA for detecting drug-resistant mutations in Mycobacterium tuberculosis, the nucleotide sequence of which is shown in SEQ ID NO. 4.

[0007] A second object of the present invention is to provide a composition for detecting drug-resistant mutations in Mycobacterium tuberculosis, the composition comprising the crRNA and rpoB primers, the rpoB primers comprising a forward primer with a nucleotide sequence as shown in SEQ ID NO. 9 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO. 10.

[0008] A third objective of this invention is to provide a kit for detecting drug-resistant mutations in Mycobacterium tuberculosis, the kit comprising the crRNA and / or the composition.

[0009] In one embodiment, the kit further includes Cas12a protein and a fluorescent probe.

[0010] In one embodiment, the Cas12a protein includes LbCas12a or AapCas12b.

[0011] In one embodiment, the kit further includes PCR amplification system reagents and CRISPR-Cas12a detection system reagents.

[0012] In one embodiment, the PCR amplification system reagents include buffer, dNTP / dUTP, Mega TaqHS enzyme, and UDG enzyme.

[0013] In one embodiment, the reagents of the CRISPR-Cas12a detection system include a buffer solution.

[0014] In one embodiment, the fluorescent probe has a fluorescent group and a quenching group attached to both ends.

[0015] In one embodiment, the fluorescent group includes FAM, VIC, or Cy5, and the quenching group includes BHQ1 or BHQ2.

[0016] In one embodiment, the fluorescent probe is 5'-FAM-TTATT-BHQ1-3'.

[0017] A fourth objective of this invention is to provide a method for detecting drug-resistant mutations in *Bacillus cereus*, wherein the method involves detection using the aforementioned kit.

[0018] In one embodiment, the method includes the following steps: Extract DNA from the sample to be tested; Amplify the target sequence using rpoB primers; The PCR amplification product, crRNA, Cas12a protein, and fluorescent probe were incubated in the same buffer system, and the fluorescence value was used to determine the result.

[0019] A fifth object of the present invention is to provide the use of the said crRNA or the said composition in the preparation of a kit for the preparation of Mycobacterium tuberculosis drug resistance mutation.

[0020] Beneficial effects The crRNA for detecting drug-resistant Mycobacterium tuberculosis provided by this invention has a maximum fluorescence value of 4,250,000 and exhibits excellent reproducibility. In clinical sample testing, the detection method provided by this invention shows high consistency with Sanger sequencing results, and the detection time is significantly shorter than Sanger sequencing, thereby greatly reducing the time for doctors and patients to obtain test results. The detection method provided by this invention has the following advantages: High sensitivity: It can detect mutant genes as low as 0.1% in mixed samples.

[0021] (2) High specificity: crRNA design avoids interference from wild-type genes.

[0022] (3) Rapid detection: The whole process takes ≤2 hours and is suitable for clinical point-of-care testing. Attached Figure Description

[0023] Figure 1 Schematic diagram of crRNA screening test results; Figure 2 Schematic diagram of S531L mutation rate detection results; Figure 3 Specificity verification; Figure 4 Sensitivity detection; Figure 5 Repeatability verification. Detailed Implementation

[0024] The following embodiments further illustrate the present invention, but the scope of the invention is not limited thereto. The embodiments described in this specification are for illustrative purposes only and do not limit the scope of protection of the invention. The scope of protection of the invention is defined only by the claims, and any omissions, substitutions, or modifications made by those skilled in the art based on the disclosed embodiments will fall within the scope of protection of the invention.

[0025] The following examples use instruments and equipment conventional in the art. Experimental methods in the following examples, unless otherwise specified, are generally performed under standard conditions or as recommended by the manufacturer. All raw materials used in the following examples are conventional commercially available products unless otherwise stated.

[0026] Example 1: Design and Validation of Specific crRNA Specific crRNA design Six crRNAs (sequences shown in the table below) were designed targeting the S531L site of the rpoB gene. Their core region is completely complementary to the mutant gene but mismatched with the wild-type gene, ensuring that only the mutant triggers Cas12a trans-cleavage activity. The mutant gene fragment with nucleotide sequence as shown in SEQ ID NO.7 and the wild-type gene fragment with nucleotide sequence as shown in SEQ ID NO.8 were inserted into expression plasmids to construct the S531L plasmid and the rpoB wild-type plasmid. The expression plasmids were selected from conventional prokaryotic expression plasmids, such as E. coli expression plasmids, and can be arbitrarily replaced with other prokaryotic expression plasmids. In this invention, they are used for verification or as positive and negative control plasmids in the kit, respectively.

[0027] Table 1 crRNA sequence design S531L plasmid sequence (SEQ ID NO.7) GAGCGGGTGGTCCGGGAGCGGATGACCACCCAGGACGTGGAGGCGATCACACCGCAGACGTTGATCAACATCCGGCCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTGAGCCAATTCA TGGaCCAGAACAACCCGCTGTCGGGGTTGACCcACAAGCGCCGACTGTtGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGAT rpoB wild-type plasmid sequence (SEQ ID NO.8) GAGCGGGTGGTCCGGGAGCGGATGACCACCCAGGACGTGGAGGCGATCACACCGCAGACGTTGATCAACATCCGGCCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTGAGCCAATTCA TGGaCCAGAACAACCCGCTGTCGGGGTTGACCcACAAGCGCCGACTGTcGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGAT Table 2 rpoB primer sequences 2. Testing System (1) PCR system: containing 5×PCR Buffer, dNTP / dUTP, rpoB primer, Mega Taq HS enzyme and UDG enzyme, total system 15μL.

[0028] Table 3 PCR reaction system (2) CRISPR system: containing 10×HOLMES Buffer1, crRNA (0.5μM), LbCas12a (50 pmol / μL), fluorescent probe (1 μM, FAM-TTATT-BHQ1), total system 20 μL.

[0029] Table 4 CRISPR reaction system 3. Detection Method (1) PCR pre-amplification: The target region was amplified using specific primers (rpoB-8F / rpoB-10R). The reaction system contained dUTP and UDG enzymes to prevent contamination. The templates were S531L plasmid and rpoB wild-type plasmid.

[0030] The reaction conditions are: CRISPR detection: The PCR products of the two plasmids are mixed with LbCas12a enzyme, crRNA and fluorescent reporter probe (such as FAM-BHQ1 label) respectively, and the presence of mutation is determined by the ratio of fluorescence signal intensity.

[0031] The reaction conditions are: The results are as follows Figure 1 As shown, compared to 531-crRNA4, 531-crRNA2, 531-crRNA3, 531-crRNA5, and 531-crRNA6 exhibited lower amplification efficiency and lower fluorescence values. 531-crRNA2 and 531-crRNA5 also showed poor specificity, with non-specific binding to wild-type plasmids. 531-crRNA4, on the other hand, showed no extraneous peaks, high specificity, high fluorescence value, and a short plateau time, suggesting good sensitivity. Subsequent CRISPR-Cas12a detection steps all used 531-crRNA4.

[0032] 4. Mutation rate detection method: The S531L plasmid was mixed with the rpoB wild-type plasmid to prepare 100% S531L, 50% S531L, 10% S531L, 5% S531L, 1% S531L and 0.1% S531L.

[0033] Perform PCR amplification according to the PCR amplification methods and conditions in steps 1-3, and then use the CRISPR-Cas12a detection method and conditions for MTB detection. After the reaction, read the fluorescence value using a real-time quantitative PCR instrument.

[0034] The results showed that, compared with the wild-type sample rpoB wild-type plasmid (WT), the mutant sample S531L plasmid (strong fluorescence) was significantly different. Figure 2 It can be seen that when S531L contains 0.1%, it is still clearly distinguishable from wild type, R20 / R1>4, so the mutation rate of S531L is 0.1%.

[0035] Example 2 Specificity Detection Experimental Design Nucleic acid extraction was performed on sensitive reference materials (N1-N10) and drug-resistant reference materials (R1-IR-1, R2-IR-2, R3-IR-3, R4-IR-4, R5-IR-5, R6-IR-6, R7-IR-7, R8-IR-8, R9-IR-9, R10-IR-10, R11-IR-11, R12-IR-12, R13-IR-13, R14-IR-14, R15-R-1, R16-R-2 and R17-R-3) in the National Reference Materials for the Detection of Rifampicin Resistance Genes of Mycobacterium tuberculosis (hereinafter referred to as the National Reference Materials).

[0036] Testing system Refer to the testing system in Implementation Case 1.

[0037] Detection methods Refer to the testing method in Implementation Case 1.

[0038] Specificity test results as follows Figure 3 As shown: Sensitive reference standards N1-N10 from *Panax notoginseng* were all negative. Among the resistant reference standards, R1-IR-1, R3-IR-3, R7-IR-7, R9-IR-9, and R14-IR-14 all correspond to the S531L mutation type, and therefore tested positive for S531L. The remaining resistant reference standards were all negative. This demonstrates that the S531L detection system constructed in this method possesses good specificity.

[0039] Example 3 Sensitivity Detection Experimental Design Following the method in Implementation Case 1, the S531L plasmid was mixed with the rpoB wild-type plasmid (WT) to prepare mutation rates of 10% S531L, 5% S531L, 1% S531L and 0.1% S531L, and then 20-well replicates were performed.

[0040] Testing system Refer to the testing system in Implementation Case 1.

[0041] Detection methods Refer to the testing method in Implementation Case 1.

[0042] Sensitivity test results are as follows Figure 4 As shown, 10% S531L, 5% S531L, 1% S531L and 0.1% S531L can all be significantly distinguished from wild-type plasmid WT, and R20 / R1>4. Therefore, the detection limit of this method for the mutation rate of S531L is 0.1%.

[0043] Example 4 Repeatability Test Experimental Design Following the method in Implementation Case 1, the S531L plasmid was mixed with the rpoB wild-type plasmid (WT) to prepare two samples with high and low mutation rates, namely 10% S531L and 1% S531L. Then, 10-well replicate detections were performed for each sample, and the CV of the R20 / R1 ratio was calculated.

[0044] Testing system Refer to the testing system in Implementation Case 1.

[0045] Detection methods Refer to the testing method in Implementation Case 1.

[0046] Repeatability test results as follows Figure 5 As shown: the R20 / R1 ratios of 10% S531L in 10 wells were all greater than 4, and the corresponding CV was 2.53%; the R20 / R1 ratios of 1% S531L in 10 wells were all greater than 4, and the corresponding CV was 1.82%. The CVs of both high and low mutation rates were ≤5%, so the method has good reproducibility for S531L.

[0047] Example 5: Actual Sample Detection and Analysis Experimental Design Following the method described in Case 1, nucleic acids were extracted from 50 sputum samples collected in our hospital (5 negative for Mycobacterium tuberculosis complex, 45 positive for Mycobacterium tuberculosis complex, including 28 cases of drug-resistant Mycobacterium tuberculosis and 17 cases of sensitive Mycobacterium tuberculosis). The extracted nucleic acids were then tested using the S531L detection system established in this paper, and Sanger sequencing was performed simultaneously.

[0048] Testing system Refer to the testing system in Implementation Case 1.

[0049] Detection methods Refer to the testing method in Implementation Case 1.

[0050] The results of Sanger sequencing and the detection method established in this invention show that among the 28 drug-resistant Mycobacterium tuberculosis samples, 15 samples were S531L positive, and Sanger sequencing confirmed that they were all S531L mutations. The remaining 13 drug-resistant samples were S531L negative, and Sanger sequencing confirmed that they were non-S531L mutation types. The 17 drug-sensitive Mycobacterium tuberculosis samples were all S531L negative, and Sanger sequencing confirmed that they were wild-type. The 5 samples that were negative for Mycobacterium tuberculosis complex were S531L negative, and Sanger sequencing confirmed that the target band was not amplified. Therefore, the S531L detection system established in this invention has high accuracy and good specificity.

[0051] Table 5 Actual Sample Detection The above description is merely an embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent modifications made based on the content of the present invention specification, or direct or indirect applications in related technical fields, are similarly included within the patent protection scope of the present invention.

Claims

1. A crRNA for detecting drug-resistant mutations in Mycobacterium tuberculosis, characterized in that, The nucleotide sequence of the crRNA is shown in SEQ ID NO.

4.

2. A composition for detecting drug-resistant mutations in Mycobacterium tuberculosis, characterized in that, The composition comprises the crRNA and rpoB primers of claim 1, wherein the rpoB primers comprise a forward primer with a nucleotide sequence as shown in SEQ ID NO. 9 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.

10.

3. A kit for detecting drug-resistant mutations in Mycobacterium tuberculosis, characterized in that, The kit comprises the crRNA of claim 1 and / or the composition of claim 2.

4. The reagent kit according to claim 3, characterized in that, The kit also includes Cas12a protein and fluorescent probes.

5. The reagent kit according to claim 4, characterized in that, The Cas12a protein includes LbCas12a or AapCas12b.

6. The reagent kit according to claim 3, characterized in that, The kit also includes PCR amplification system and CRISPR-Cas12a detection system reagents.

7. The reagent kit according to claim 4, characterized in that, The fluorescent probe has a fluorescent group and a quenching group attached to both ends.

8. The reagent kit according to claim 7, characterized in that, The fluorescent group includes FAM, VIC or Cy5, and the quenching group includes BHQ1 or BHQ2.

9. A method for detecting drug-resistant mutations in *Bacillus cereus*, wherein the method comprises detection using the kit described in any one of claims 3 to 8.

10. The method according to claim 9, characterized in that, The method includes the following steps: Extract DNA from the sample to be tested; Amplify the target sequence using rpoB primers; The PCR amplification product, crRNA, Cas12a protein, and fluorescent probe were incubated in the same buffer system, and the fluorescence value was used to determine the result.

Images