Molecular marker related to low caffeine in defensive tea based on liquid phase chip and application of molecular marker

Abstract

The invention relates to the technical field of tea tree biology, in particular to a Qingcheng tea low-caffeine related molecular marker based on a liquid phase chip and application of the molecular marker. According to the invention, 16 different types of tea tree resources including the defensive tea are detected by using a liquid phase chip developed at an early stage, and the content of related alkaloid indexes is detected at the same time, so that 6 sense SNP mutations distributed on the defensive tea caffeine synthetase CfTCS1 gene are identified, and the germplasm resources of the defensive tea can be accurately and efficiently identified at low cost by using the 6 mutations, so that the method has a wide application prospect. The mutations are closely related to the caffeine content and the theobromine content of the tea trees, and low-caffeine and high-theobromine germplasm resources can be rapidly screened according to the genotypes of the tea trees. The result of the specific embodiment of the invention shows that when the tea tree resource of which the genotypes of the six SNP molecular markers are AA / AA / TT / GG / TT / GG in sequence corresponds to the Guangcheng tea germplasm resource with high theobromine-low caffeine content.

Description

Technical Field

[0001] This invention relates to the field of tea plant biotechnology, and in particular to molecular markers related to low caffeine in Fangcheng tea based on liquid phase chips and their applications. Background Technology

[0002] Caffeine is one of the important flavor compounds in tea, possessing physiological functions such as stimulating the mind, reducing inflammation, and combating allergies. However, its excitatory effect on the central nervous system can easily cause side effects such as insomnia and palpitations, limiting tea consumption for some people. Therefore, to meet market demand, breeding low-caffeine tea trees and developing low-caffeine teas has become an important direction for the innovative development of the tea industry.

[0003] Fangcheng tea (Camellia fangchengensis Liang et Zhong) belongs to the Camellia section of the Camellia genus in the Theaceae family. Due to its uniqueness among Camellia plants, Fangcheng tea is included as a new species in Min Tianlu's classification system of Camellia plants. Due to its narrow distribution range and similar morphological characteristics to the Camellia plant Bai Mao Cha, it is classified as a variety of Bai Mao Cha in Chen Liang's classification system of Camellia plants. At present, whether based on morphological characteristics or biochemical component detection, the identification of Fangcheng tea will have the following problems: (1) Traditional morphological identification methods are highly subjective and it is not easy to distinguish specific resource types; (2) Biochemical component detection requires a lot of manpower, material resources and costs.

[0004] Liquid-phase microarrays based on targeted sequencing genotyping technology are a commonly used technique for breeding and identifying varieties of crops and horticultural plants. This technology uses SNPs (Special Novel Participant) genetic markers, which directly reflect DNA differences, to genotype targeted marker sites on the genome. Compared to traditional SSR markers, it offers advantages such as high throughput, automation, speed, extremely low cost, and the ability to integrate and compare data from different batches and laboratories. To date, no functional markers have been reported that are simultaneously associated with identifying the authenticity of Fangcheng tea and determining the alkaloid content of tea plants. Summary of the Invention

[0005] The purpose of this invention is to provide molecular markers, primer pairs, and their applications related to the alkaloid content of Fangcheng tea, in order to solve the problems existing in the prior art.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides molecular markers related to the alkaloid content of Fangcheng tea, the molecular markers including molecular markers 1-5;

[0008] The nucleotide sequence of molecular marker 1 is shown in SEQ ID NO.5, and there is a G / A mutation at the 100th base and a C / A mutation at the 101st base in the nucleotide sequence.

[0009] The nucleotide sequence of molecular marker 2 is shown in SEQ ID NO.10, and a G / T mutation exists at the 58th base of this nucleotide sequence;

[0010] The nucleotide sequence of molecular marker 3 is shown in SEQ ID NO.15, and an A / G mutation exists at the 58th base of this nucleotide sequence;

[0011] The nucleotide sequence of molecular marker 4 is shown in SEQ ID NO.20, and a G / T mutation exists at the 97th base of this nucleotide sequence;

[0012] The nucleotide sequence of molecular marker 5 is shown in SEQ ID NO.25, and a T / G mutation exists at the 50th base of this nucleotide sequence;

[0013] The alkaloids include caffeine and / or theobromine.

[0014] The present invention provides a probe combination for detecting the above-mentioned molecular markers, wherein the probe sequence includes a probe sequence for detecting molecular marker 1, a probe sequence for detecting molecular marker 2, a probe sequence for detecting molecular marker 3, a probe sequence for detecting molecular marker 4, and a probe sequence for detecting molecular marker 5.

[0015] The probe sequence for detecting molecular marker 1 includes nucleotides as shown in SEQ ID NO. 6;

[0016] The probe sequence for detecting molecular marker 2 includes nucleotides as shown in SEQ ID NO. 11;

[0017] The probe sequence used to detect molecular marker 3 includes nucleotides as shown in SEQ ID NO. 16;

[0018] The probe sequence used to detect molecular marker 4 includes nucleotides as shown in SEQ ID NO.21;

[0019] The probe sequence used to detect molecular marker 5 includes nucleotides as shown in SEQ ID NO.26.

[0020] The present invention provides a primer set for detecting the above-mentioned molecular markers, the primer set including a primer pair for detecting molecular marker 1, a primer pair for detecting molecular marker 2, a primer pair for detecting molecular marker 3, a primer pair for detecting molecular marker 4, and a primer pair for detecting molecular marker 5;

[0021] The primer pair used to detect molecular marker 1 includes upstream primer 1 with nucleotide sequence as shown in SEQ ID NO.7, upstream primer 2 with nucleotide sequence as shown in SEQ ID NO.8, and downstream primer with nucleotide sequence as shown in SEQ ID NO.9;

[0022] The primer pair used to detect molecular marker 2 includes upstream primer 1 with nucleotide sequence as shown in SEQ ID NO. 12, upstream primer 2 with nucleotide sequence as shown in SEQ ID NO. 13, and downstream primer with nucleotide sequence as shown in SEQ ID NO. 14;

[0023] The primer pair used to detect molecular marker 3 includes upstream primer 1 with nucleotide sequence as shown in SEQ ID NO. 17, upstream primer 2 with nucleotide sequence as shown in SEQ ID NO. 18, and downstream primer with nucleotide sequence as shown in SEQ ID NO. 19;

[0024] The primer pair used to detect molecular marker 4 includes upstream primer 1 with nucleotide sequence as shown in SEQ ID NO. 22, upstream primer 2 with nucleotide sequence as shown in SEQ ID NO. 23, and downstream primer with nucleotide sequence as shown in SEQ ID NO. 24;

[0025] The primer pair used to detect molecular marker 5 includes upstream primer 1 with nucleotide sequence as shown in SEQ ID NO. 27, upstream primer 2 with nucleotide sequence as shown in SEQ ID NO. 28, and downstream primer with nucleotide sequence as shown in SEQ ID NO. 29.

[0026] This invention provides the application of the above-mentioned probe combination or primer pair in the preparation of products for identifying the authenticity of Fangcheng tea and / or identifying the content of tea plant alkaloids, wherein the alkaloids include caffeine and / or theobromine.

[0027] More preferably, the product includes chip detection reagents or kits.

[0028] This invention provides a product for identifying the authenticity of Fangcheng tea and / or for determining the content of alkaloids in tea trees. The product includes the probe combination or primer pair described above, and the alkaloids include caffeine and / or theobromine.

[0029] More preferably, the product includes chip detection reagents or kits.

[0030] This invention provides the use of the above-described molecular markers, probe combinations, primer pairs, or products in any one or more of the following:

[0031] (1) Identifying the authenticity of Fangcheng tea;

[0032] (2) To determine the content of alkaloids in tea plants; the alkaloids include caffeine and / or theobromine.

[0033] This invention provides a method for identifying the authenticity of Fangcheng tea, comprising the following steps:

[0034] Using the genomic DNA of the tea plant sample to be tested as a template, the template is constructed and sequenced using the probe sequence described above, and genotyping is performed based on the sequencing results; or using the genomic DNA of the tea plant sample to be tested as a template, the template is amplified by PCR using the primer set described above, and genotyping is performed based on the amplification results.

[0035] Preferably, when the genotype of molecular marker 1 is AA and AA, the genotype of molecular marker 2 is TT, the genotype of molecular marker 3 is GG, the genotype of molecular marker 4 is TT, and the genotype of molecular marker 5 is GG, the tea tree sample to be tested is Fangcheng tea.

[0036] When the genotype of molecular marker 1 is GG and CC, the genotype of molecular marker 2 is GG, the genotype of molecular marker 3 is AA, the genotype of molecular marker 4 is GG, and the genotype of molecular marker 5 is TT, the tea tree sample to be tested is non-Fangcheng tea.

[0037] This invention provides a method for identifying the alkaloid content of tea plants, comprising the following steps:

[0038] Using the genomic DNA of the tea plant sample to be tested as a template, the template is constructed and sequenced using the probe sequence described above, and genotyping is performed based on the sequencing results; the alkaloids include caffeine and / or theobromine; or using the genomic DNA of the tea plant sample to be tested as a template, the template is amplified by PCR using the primer set described above, and genotyping is performed based on the amplification results.

[0039] Preferably, when the genotype of molecular marker 1 is AA and AA, the genotype of molecular marker 2 is TT, the genotype of molecular marker 3 is GG, the genotype of molecular marker 4 is TT, and the genotype of molecular marker 5 is GG, the tea tree sample to be tested is a tea tree variety with low caffeine content and / or high theobromine content.

[0040] When the genotype of molecular marker 1 is GG and CC, the genotype of molecular marker 2 is GG, the genotype of molecular marker 3 is AA, the genotype of molecular marker 4 is GG, and the genotype of molecular marker 5 is TT, the tea tree sample to be tested is a tea tree variety with high caffeine content and / or low theobromine content.

[0041] The present invention discloses the following technical effects:

[0042] This invention utilizes a previously developed liquid-phase chip to detect 16 different types of tea tree resources, including Fangcheng tea, and simultaneously detects the content of relevant indicators. Six meaningful SNP mutations were identified on the CfTCS1 gene of Fangcheng tea caffeine synthase. These six mutations can accurately, efficiently, and cost-effectively identify Fangcheng tea germplasm resources. Furthermore, these mutations are closely related to the caffeine and theobromine content of tea trees, and their genotypes can be used to quickly screen for low-caffeine and high-theobromine germplasm resources. Specific embodiments of this invention show that tea tree resources with genotypes of AA / AA / TT / GG / TT / GG in that order correspond to Fangcheng tea germplasm resources with high theobromine and low caffeine content. In summary, by using this technology to detect and analyze different tea tree resources, Fangcheng tea resources with low-caffeine and high-theobromine content can be identified. Therefore, the six SNP molecular markers described in this invention can be applied to the identification of genuine Fangcheng tea resources and the detection of alkaloid (caffeine and theobromine) content in tea trees. This invention also proves that Fangcheng tea is a high-thecobromine, low-caffeine resource, and provides a theoretical basis for exploring rare allelic variants of caffeine synthase TCS1. Attached Figure Description

[0043] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0044] Figure 1 This is the metabolic pathway of caffeine synthase;

[0045] Figure 2 Statistical analysis of genotype and alkaloid content; where A is a statistical analysis graph of genotype and caffeine content; and B is a statistical analysis graph of genotype and theobromine content.

[0046] Figure 3 For the alignment of the TCS gene and TCS amino acid sequence. Detailed Implementation

[0047] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0048] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0049] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0050] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0051] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0052] The caffeine synthase metabolic pathway, such as Figure 1 As shown, the location of the caffeine synthase TCS gene in the caffeine metabolic pathway.

[0053] Example 1: Development of SNP sites

[0054] 1. Sampling:

[0055] In the spring of 2024, one-bud-two-leaf shoots of various tea varieties, including Shucha Zao (SCZ), Fangcheng Tea (FCC), Longjing 43 (LJ43), Houzhou Tea (HZC), Dali Tea (DLC), Tieguanyin (TGY), Baiye No. 1 (BY1), Danxia No. 5 (DX5H), Danxia No. 8 (DX8H), Guihong No. 3 (GH3H), Huangjinya (HJY), Jin Guanyin (JGY), Jin Mudan (JMD), Lingtou Dancong (LTDC), Qilan No. 10 (QL10H), and Wuyi Shuixian (WYSX), were collected from the National Hangzhou Tea Nursery. After being flash-frozen with liquid nitrogen, the shoots were stored at -80℃. Some samples were used for DNA extraction for functional liquid chromatography-microarray analysis of tea trees, while others were used for biochemical component analysis.

[0056] 2. Detection of caffeine and theobromine content:

[0057] The above samples were first freeze-dried and then ground into powder using a high-throughput grinder. 0.1 g of the powder was weighed into a 15 mL centrifuge tube, and 10 mL of preheated 70% (v / v) methanol was added. After mixing, the mixture was extracted in a 70°C water bath for 10 min, shaking every 5 min. After cooling to room temperature, the mixture was centrifuged at 4000 rpm for 10 min. The supernatant was filtered through a 0.22 μm organic filter membrane, and 1 mL was transferred to a liquid chromatography bottle for HPLC detection. The detection wavelength was 278 nm, the flow rate was 1 mL / min, and the column temperature was 35°C. 18 The chromatographic column (5 μm particle size, 250 mm × 4.6 mm) was used, with an injection volume of 10 μL. The mobile phase consisted of 1% (v / v) formic acid and pure acetonitrile. The mobile phase gradient conditions were as follows: 0–1 min: 96% 1% (v / v) formic acid; 1–42 min: the proportion of 1% formic acid decreased from 96% to 81.3%; 42–43 min: the proportion of 1% (v / v) formic acid returned to 96%.

[0058] 3. Using liquid phase chips to detect different tea tree resources:

[0059] The aforementioned tea plant resources were first rapidly ground into powder using liquid nitrogen, and DNA was extracted using a modified CTAB plant genomic DNA rapid extraction kit (Adley Biotechnology). DNA quality was then assessed using 1% agarose gel electrophoresis, and DNA concentration was determined using Nanodrop 2000. Probe sequences were designed using the GenoBaits Probe Designer platform. Subsequently, DNA samples that passed quality inspection were used to construct sequencing libraries using a tea tree functional liquid phase chip detection reagent (other components of this reagent were provided by Shijiazhuang Borui Biotechnology Co., Ltd., and the probe sequences are shown in SEQ ID NO.5, SEQ ID NO.10, SEQ ID NO.15, SEQ ID NO.20 and SEQ ID NO.25). Sequencing was performed using the MGISEQ-2000 platform, and the raw sequencing data was filtered using FastQ to form clean data. The clean data was then aligned to the 'Shuchazao' reference genome (http: / / tpia.teaplants.cn / web / Download / Genomic_data / shuchazao_V2.genome.fas.gz) using BWA software. Finally, the variant sites in the target region were analyzed using GATK software. Subsequently, based on the annotation information, six mutation sites on caffeine synthase (TCS1) were identified, namely Chr01_36769734, Chr01_36769735, Chr01_36771727, Chr01_36771787, Chr01_36771907 and Chr01_36771974. These sites are located at positions 36769734, 36769735, 36771727, 36771787, 36771907 and 36771974 on chromosome 1 of the 'Shuchazao' reference genome of the tea tree.

[0060] A mutation from GC to AA at Chr01_36769734 and Chr01_36769735 results in a change in the encoded amino acid from alanine A (GCT) to asparagine N (AAT); a mutation from G to T at Chr01_36771727 results in a change in the encoded amino acid from aspartic acid D (GAT) to threonine Y (TAT); a mutation from A to G at Chr01_36771787 results in a change in the encoded amino acid from isoleucine I (ATA) to valine V (GTA); a mutation from G to T at Chr01_36771907 results in a change in the encoded amino acid from alanine A (GCC) to serine S (TCC); and a mutation from T to G at Chr01_36771974 results in a change in the encoded amino acid from phenylalanine F (TTC) to cysteine ​​C (TGC). This mutation only occurs in Fangcheng tea resources. Figure 3 Therefore, the aforementioned SNP sites can be used to identify the authenticity of Fangcheng tea.

[0061] This invention also found a certain correlation between the above-mentioned SNP sites and the caffeine and theobromine content in tea plants. When the genotypes of the six SNP sites in the material were AA / AA / TT / GG / TT / GG, the caffeine content was low (0.67%) and the theobromine content was high (3.42%); when the genotypes of the six SNP sites in the material were GG / CC / GG / AA / GG / TT, the caffeine content was high (mean 3.58%) and the theobromine content was low (mean 0.77%). Figure 2 (and Table 1)

[0062] Table 1. Genotypes and alkaloid content of different tea tree resources

[0063]

[0064]

[0065] The amino acid sequence of caffeine synthase CfTCS1 in Fangcheng tea is shown in SEQ ID NO.2, and is as follows: MEIATTGKVNEVLFMNRGEGESSYAQNSSFTQQVASMATPALENAVETLFSKDFHLQNLNATDLGCAAGPNTFAVISTIKRMMEKKCRELNCQTLELQVYLNDLFGNDFNTLFKGLLSEVIGNKCEEVPCYVMGVPGSFHGRLFPRNSLHLVHSSYSVHWLTQAPKGLTNREGLALNKGKIYISKTSPPIVSEAYLSQFHEDFTMFLNARSQEVVPNGCMVLILRGRQSSDPSDMQSCFTWELLAMAIAELVSQGLIDEYKLDTFNIPCYFPSLEEVKDVVERDGSFTIDHMEGFDLDSLQMQENDKWVRGEKFTKVVRSFTEPIISNQFGHEIMDKLYDKCTHIVVSDLEAKLPKTTSIILVLSKIDG.

[0066] Example 2: Development of Molecular Markers and KASP Primer Pairs

[0067] This embodiment is based on the SNP sites discovered in Example 1, and involves the development of molecular markers and KASP primer pairs, as detailed below:

[0068] The FAM fluorescent group linker sequence is shown in SEQ ID NO.3, specifically: GAAGGTGACCAAGTTCATGCT.

[0069] The HEX fluorescent linker sequence is shown in SEQ ID NO.4, specifically: GAAGGTCGGAGTCAACGGATT.

[0070] (1) Chr01_36769734 (G / A) and Chr01_36769735 (C / A)

[0071] 1) Sequence of molecular marker 1: AGTTGTTCTCTCTTGCAGCAAACAGTGACCTCAATGACAATGCCAGTGCTAGAAAATGCAGTTGAAACCCTCTTCTCTCCAAAGATTTCCACCTTCTTCAARMTCTTAACGCAGTGGACTTGGGTTGTGCAGCAGGTCCA, SEQ ID NO.5, where R is A or G and M is C or A.

[0072] 2) Probe sequence: TGGACCTGCTGCACAACCCAAGTCCACTGCGTTAAGAGCTTGAAGAAGGTGGAAATCTTTGGAGAAGAGGTTTCAACTGCATTTTCTAGCACTGGCATTGTCATTGAGGTCACTGTTTGCTGCAAGAGAGAACAACT, SEQ ID NO.6.

[0073] 3) KASP primer pair sequence:

[0074] Primer_AlleleFAM: FAM-AGTCCACTGCGTTAAGAGCTTGA, SEQ ID NO.7, has a 5' end modified with a FAM fluorescent group.

[0075] Primer_AlleleHEX: HEX-AGTCCACTGCGTTAAGATTTTGA, SEQ ID NO.8, has a 5' end modified with a HEX fluorescent group.

[0076] Primer_Common: AGAAAATGCAGTTGAAACCCTCTTCTCCAA, SEQ ID NO.9.

[0077] (2) Chr01_36771727 (G / T)

[0078] 1) Sequence of molecular marker 2: ATTCCAATCTATTGATTTTCTCTCTTTCCTTCGCGATAATAGGGATTGATAGATGAAKATAAATTAGACACCTTCAATGTACCTAGCTATTTTCCATCACTTGAGGAAGTG, SEQ ID NO.10, where K is T or G.

[0079] 2) Probe sequence: CACTTCCTCAAGTGATGGAAAATAGCTAGGTACATTGAAGGTGTCTAATTTATCTTCATCTATCAATCCCTATTATCGCGAAGGAAAGAGAGAAAATCAATAGATTGGAAT, SEQ ID NO. 11.

[0080] 3) KASP primer pair sequence:

[0081] Primer_AlleleFAM: FAM-TGAAGGTGTCTAATTTATCTTCAT, SEQ ID NO.12, has its 5' end modified with a FAM fluorescent group.

[0082] Primer_AlleleHEX: HEX-TGAAGGTGTCTAATTTATATTCAT, SEQ ID NO.13, has a 5' end modified with a HEX fluorescent group.

[0083] Primer_Common: CTCTTTCCTTCGCGATAATAGGGAT, SEQ ID NO.14.

[0084] (3) Chr01_36771787 (A / G)

[0085] 1) Sequence of molecular marker 3: AAATTAGACACCTTCAATGTACCTAGCTATTTTCCATCACTTGAGGAAGTGAAAGACRTAGTGGAGAGGAACGGATCATTCACAATTGATCATATGGAGGGGTTTGAACTTGATAGCCCA, SEQ ID NO.15, where R is A or G.

[0086] 2) Probe sequence: TGGGCTATCAAGTTCAAACCCCTCCATATGATCAATTGTGAATGATCCGTTCCTCTCCACTATGTCTTTCACTTCCTCAAGTGATGGAAAATAGCTAGGTACATTGAAGGTGTCTAATTT, SEQ ID NO. 16.

[0087] 3) KASP primer pair sequence:

[0088] Primer_AlleleFAM: FAM-GATCCGTTCCTCTCCACTATGTCT, SEQ ID NO.17, has a 5' end modified with a FAM fluorescent group.

[0089] Primer_AlleleHEX: HEX-GATCCGTTCCTCTCCACTACGTCT, SEQ ID NO.18, has a 5' end modified with a HEX fluorescent group.

[0090] Primer_Common:TCAATGTACCTAGCTATTTTCCATCACTTGA, SEQ ID NO.19.

[0091] (4) Chr01_36771907 (G / T)

[0092] 1) Sequence of molecular marker 4: ACAATTGATCATATGGAGGGGTTTGAACTTGATAGCCCAGAGATGCAAGAAAATGATAAATGGGTTAGAGGGGAAAAGTTTGCCACGGTTGCCAGGKCCTTCACAGAGCCTATAATTT, SEQ ID NO.20, where K is G or T.

[0093] 2) Probe sequence: AAATTATAGGCTCTGTGAAGGCCCTGGCAACCGTGGCAAACTTTTCCCCTCTAACCCATTTATCATTTTCTTGCATCTCTGGGCTATCAAGTTCAAACCCCTCCATATGATCAATTGT, SEQ ID NO. 21.

[0094] 3) KASP primer pair sequence:

[0095] Primer_AlleleFAM: FAM-GTGAAGGCCCTGGCAACCGT, SEQ ID NO.22, has a 5' end modified with a FAM fluorescent group.

[0096] Primer_AlleleHEX: HEX-GTGAAGGACCTGGCAACCGT, SEQ ID NO.23, has a 5' end modified with a HEX fluorescent group.

[0097] Primer_Common: ACTTGATAGCCCAGAGATGCAAGAAAATGATAAAT, SEQ ID NO.24.

[0098] (5) Chr01_36771974 (T / G)

[0099] 1) Sequence of molecular marker 5: ATTTCAAACCAGTTTGGACATGAAATCATGGACAAACTATATGAGAAGTKCACTCACATTGTAGTTTCAGATTTGGAAGCAAAGATACCGAAGATCACAAGTATCATTCTAGTGCTTT, SEQ ID NO.25, where K is T or G.

[0100] 2) Probe sequence: AAAGCACTAGAATGATACTTGTGATCTTCGGTATCTTTGCTTCCAAATCTGAAACTACAATGTGAGTGAACTTCTCATATAGTTTGTCCATGATTTCATGTCCAAACTGGTTTGAAAT, SEQ ID NO. 26.

[0101] 3) KASP primer pair sequence:

[0102] Primer_AlleleFAM: FAM-ACAATGTGAGTGAACTTCT, SEQ ID NO.27, has a 5' end modified with a FAM fluorescent group.

[0103] Primer_AlleleHEX: HEX-ACAATGTGAGTGCACTTCT, SEQ ID NO.28, has a 5' end modified with a FAM fluorescent group.

[0104] Primer_Common: AAACCAGTTTGGACATGAAATCAT, SEQ ID NO. 29.

[0105] Example 3: Establishment of the detection method

[0106] A method for identifying the authenticity of Fangcheng tea and detecting the levels of caffeine and theobromine in tea leaves, comprising the following steps:

[0107] Method 1, DNA extraction: DNA was extracted from the one-bud-two-leaf shoots of the tea plant to be tested using the modified CTAB plant genomic DNA rapid extraction kit (Adley Biotechnology Co., Ltd.).

[0108] Molecular marker detection: Quality-tested DNA samples were used to construct sequencing libraries using a tea tree functional liquid chromatography-mass spectrometry kit (other components of this kit were provided by Shijiazhuang Borui Biotechnology Co., Ltd., and the probe sequences are shown in SEQ ID NO. 5, SEQ ID NO. 10, SEQ ID NO. 15, SEQ ID NO. 20, and SEQ ID NO. 25). Sequencing was performed using the MGISEQ-2000 platform. Raw sequencing data was filtered using FastQ to form clean data, which was then further processed using BWA software. The data were aligned to the 'Shuchazao' reference genome (http: / / tpia.teaplants.cn / web / Download / Genomic_data / shuchazao_V2.genome.fas.gz). Finally, the GATK software was used to analyze the six mutation sites (Chr01_36769734, Chr01_36769735, Chr01_36771727, Chr01_36771787, Chr01_36771907 and Chr01_36771974) on caffeine synthase (TCS1) to obtain the genotyping information of the corresponding molecular marker sites (Table 1).

[0109] Determination of the authenticity of Fangcheng tea: When the genotype of molecular marker 1 is AA and AA, the genotype of molecular marker 2 is TT, the genotype of molecular marker 3 is GG, the genotype of molecular marker 4 is TT, and the genotype of molecular marker 5 is GG, the variety of the tea tree sample to be tested is Fangcheng tea; when the genotype of molecular marker 1 is GG and CC, the genotype of molecular marker 2 is GG, the genotype of molecular marker 3 is AA, the genotype of molecular marker 4 is GG, and the genotype of molecular marker 5 is TT, the variety of the tea tree sample to be tested is not Fangcheng tea.

[0110] Determination of caffeine and theobromine content: When the genotype of molecular marker 1 is AA and AA, the genotype of molecular marker 2 is TT, the genotype of molecular marker 3 is GG, the genotype of molecular marker 4 is TT, and the genotype of molecular marker 5 is GG, the tea sample to be tested is a tea variety with low caffeine content and / or high theobromine content; when the genotype of molecular marker 1 is GG and CC, the genotype of molecular marker 2 is GG, the genotype of molecular marker 3 is AA, the genotype of molecular marker 4 is GG, and the genotype of molecular marker 5 is TT, the tea sample to be tested is a tea variety with high caffeine content and / or low theobromine content.

[0111] Method 2, DNA extraction: DNA was extracted from the one-bud-two-leaf shoots of the tea plant to be tested using the modified CTAB plant genomic DNA rapid extraction kit (Adley Biotechnology Co., Ltd.).

[0112] Detection of molecular markers: DNA from one-bud-two-leaf shoots of tea plants was amplified by PCR using the KASP primers developed in Example 3. The PCR amplification and program were the same as those of commercially available PCR amplification kits. After PCR, the fluorescence signal was read using the QuantStudio 6 real-time quantitative PCR system. Then, the fluorescence signal was analyzed and converted using the KlusterCaller analysis software to obtain a clear and intuitive genotyping diagram. The genotype results were output according to the different colors.

[0113] The results for judging the authenticity of Fangcheng tea and the levels of caffeine and theobromine are the same as those mentioned above.

[0114] Example 4: Validation and Application of Molecular Markers

[0115] Genotyping of 24 different tea tree resources (14 Fangcheng tea and 10 other tea tree resources (Anji Yellow Tea-AJHC, White Peony-BMD, Beicha 36-BC36, Benshan-BS, Bixiangzao-BXZ, Lifeng-LF, Longqu No.1-LQ1, Meizhan-MZ, Luyun No.1-LY1 and Qiancha No.1-QC1)) was performed using the probe sequence in Example 2 and the method in Example 3. The results are shown in Table 2.

[0116] The results showed that only in Fangcheng tea did the genotypes of the six SNP loci be AA / AA / TT / GG / TT / GG, and the materials with this genotype had low caffeine content and high theobromine content; the genotypes of the six SNP loci of other tea varieties were GG / CC / GG / AA / GG / TT, and the materials with this genotype had high caffeine content and low theobromine content (Table 2).

[0117] Table 2. Genotype information and alkaloid content of tea tree validation materials

[0118]

[0119] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A molecular marker associated with the alkaloid content of Fangcheng tea, characterized in that, The molecular markers include molecular markers 1-5; The nucleotide sequence of molecular marker 1 is shown in SEQ ID NO.5, and there is a G / A mutation at the 100th base and a C / A mutation at the 101st base in the nucleotide sequence. The nucleotide sequence of molecular marker 2 is shown in SEQ ID NO.10, and a G / T mutation exists at the 58th base of this nucleotide sequence; The nucleotide sequence of molecular marker 3 is shown in SEQ ID NO.15, and an A / G mutation exists at the 58th base of this nucleotide sequence; The nucleotide sequence of molecular marker 4 is shown in SEQ ID NO.20, and a G / T mutation exists at the 97th base of this nucleotide sequence; The nucleotide sequence of molecular marker 5 is shown in SEQ ID NO.25, and a T / G mutation exists at the 50th base of this nucleotide sequence; The alkaloids include caffeine and / or theobromine.

2. A probe assembly for detecting the molecular marker of claim 1, characterized in that, The probe sequences include probe sequences for detecting molecular marker 1, probe sequences for detecting molecular marker 2, probe sequences for detecting molecular marker 3, probe sequences for detecting molecular marker 4, and probe sequences for detecting molecular marker 5. The probe sequence for detecting molecular marker 1 includes nucleotides as shown in SEQ ID NO. 6; The probe sequence used to detect molecular marker 2 includes nucleotides as shown in SEQ ID NO. 11; The probe sequence used to detect molecular marker 3 includes nucleotides as shown in SEQ ID NO. 16; The probe sequence used to detect molecular marker 4 includes nucleotides as shown in SEQ ID NO.21; The probe sequence used to detect molecular marker 5 includes nucleotides as shown in SEQ ID NO.

26.

3. A primer set for detecting the molecular marker of claim 1, characterized in that, The primer set includes primer pairs for detecting molecular marker 1, primer pairs for detecting molecular marker 2, primer pairs for detecting molecular marker 3, primer pairs for detecting molecular marker 4, and primer pairs for detecting molecular marker 5. The primer pair used to detect molecular marker 1 includes upstream primer 1 with nucleotide sequence as shown in SEQ ID NO.7, upstream primer 2 with nucleotide sequence as shown in SEQ ID NO.8, and downstream primer with nucleotide sequence as shown in SEQ ID NO.9; The primer pair used to detect molecular marker 2 includes upstream primer 1 with nucleotide sequence as shown in SEQ ID NO. 12, upstream primer 2 with nucleotide sequence as shown in SEQ ID NO. 13, and downstream primer with nucleotide sequence as shown in SEQ ID NO. 14; The primer pair used to detect molecular marker 3 includes upstream primer 1 with nucleotide sequence as shown in SEQ ID NO. 17, upstream primer 2 with nucleotide sequence as shown in SEQ ID NO. 18, and downstream primer with nucleotide sequence as shown in SEQ ID NO. 19; The primer pair used to detect molecular marker 4 includes upstream primer 1 with nucleotide sequence as shown in SEQ ID NO. 22, upstream primer 2 with nucleotide sequence as shown in SEQ ID NO. 23, and downstream primer with nucleotide sequence as shown in SEQ ID NO. 24; The primer pair used to detect molecular marker 5 includes upstream primer 1 with nucleotide sequence as shown in SEQ ID NO. 27, upstream primer 2 with nucleotide sequence as shown in SEQ ID NO. 28, and downstream primer with nucleotide sequence as shown in SEQ ID NO.

29.

4. The application of the probe combination of claim 2 or the primer pair of claim 3 in the preparation of products for identifying the authenticity of Fangcheng tea and / or identifying the content of tea tree alkaloids, characterized in that, The alkaloids include caffeine and / or theobromine.

5. A product for identifying the authenticity of Fangcheng tea and / or determining the content of alkaloids in tea trees, characterized in that, The product comprises the probe combination of claim 2 or the primer pair of claim 3, and the alkaloid comprises caffeine and / or theobromine.

6. The use of the molecular marker of claim 1, the probe combination of claim 2, the primer pair of claim 3, or the product of claim 5 in any one or more of the following: (1) Identifying the authenticity of Fangcheng tea; (2) To determine the content of alkaloids in tea plants; the alkaloids include caffeine and / or theobromine.

7. A method for identifying the authenticity of Fangcheng tea, characterized in that, Includes the following steps: Using the genomic DNA of the tea plant sample to be tested as a template, the template is constructed and sequenced using the probe combination described in claim 2, and genotyping is performed based on the sequencing results; or using the genomic DNA of the tea plant sample to be tested as a template, the template is amplified by PCR using the primer set described in claim 3, and genotyping is performed based on the amplification results.

8. The method according to claim 7, characterized in that, When the genotype of molecular marker 1 is AA and AA, the genotype of molecular marker 2 is TT, the genotype of molecular marker 3 is GG, the genotype of molecular marker 4 is TT, and the genotype of molecular marker 5 is GG, the tea tree sample to be tested is Fangcheng tea. When the genotype of molecular marker 1 is GG and CC, the genotype of molecular marker 2 is GG, the genotype of molecular marker 3 is AA, the genotype of molecular marker 4 is GG, and the genotype of molecular marker 5 is TT, the tea tree sample to be tested is non-Fangcheng tea.

9. A method for identifying the alkaloid content of tea plants, characterized in that, Includes the following steps: Using the genomic DNA of the tea plant sample to be tested as a template, the template is constructed and sequenced using the probe combination described in claim 2, and genotyping is performed based on the sequencing results; the alkaloids include caffeine and / or theobromine; or using the genomic DNA of the tea plant sample to be tested as a template, the template is amplified by PCR using the primer set described in claim 3, and genotyping is performed based on the amplification results.

10. The method according to claim 9, characterized in that, When the genotype of molecular marker 1 is AA and AA, the genotype of molecular marker 2 is TT, the genotype of molecular marker 3 is GG, the genotype of molecular marker 4 is TT, and the genotype of molecular marker 5 is GG, the tea tree sample to be tested is a tea tree variety with low caffeine content and / or high theobromine content. When the genotype of molecular marker 1 is GG and CC, the genotype of molecular marker 2 is GG, the genotype of molecular marker 3 is AA, the genotype of molecular marker 4 is GG, and the genotype of molecular marker 5 is TT, the tea tree sample to be tested is a tea tree variety with high caffeine content and / or low theobromine content.

Images