Magnetic bead solid-phase ELISA (enzyme-linked immuno sorbent assay) kit for detecting giardia cysts and preparation method of magnetic bead solid-phase ELISA kit

The enrichment of Giardia cysts using an immunomagnetic bead process based on biotin-streptavidin coupling reaction, combined with ELISA plate detection, solves the problems of low sensitivity and complex operation in the diagnosis of Giardiasis in existing technologies, and realizes a rapid and simple detection method.

CN120992936APending Publication Date: 2025-11-21JILIN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511203839.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-27
Publication Date
2025-11-21

AI Technical Summary

Technical Problem

Existing technologies for diagnosing giardiasis suffer from problems such as low sensitivity, high subjectivity in result interpretation, long detection cycle, and complex operation, making it difficult to meet the screening needs at the grassroots level.

Method used

An immunomagnetic bead process using biotin-streptavidin coupling reaction was employed to enrich Giardia cysts in feces using immunomagnetic beads. The process involved magnetic bead enrichment, targeted adsorption, and direct detection in an ELISA plate. A magnetic bead solid-phase ELISA kit was prepared using Giardia-specific antigen CWP1 and BG protein.

Benefits of technology

It achieves high sensitivity and rapid detection, simplifies the operation process, is suitable for on-site diagnosis and large-scale epidemiological investigation, and reduces the risk of Giardia transmission.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120992936A_ABST
    Figure CN120992936A_ABST
Patent Text Reader

Abstract

The invention provides a magnetic bead solid-phase ELISA (enzyme-linked immunosorbent assay) kit for detecting giardia cysts and a preparation method thereof, the magnetic bead solid-phase ELISA kit is prepared by using an immunomagnetic bead process of biotin-streptavidin coupling reaction, the giardia cysts in faeces are enriched through immunomagnetic beads, and the concentration of the giardia cysts in the faeces is increased; the enriched magnetic bead-giardia capsule compound is added into an elisa plate coated with an antibody, so that an integrated process of magnetic bead enrichment, targeted adsorption and direct detection is realized.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application discloses a magnetic bead solid-phase ELISA kit for detecting giardia cysts, and simultaneously provides a preparation method of the kit. BACKGROUND

[0002] Giardiasis is a zoonosis caused by the intestinal parasite Giardia duodenalis. Giardia duodenalis The infectious cysts of the pathogen are ingested by the host and then form trophozoites in the duodenum, which colonize the small intestinal epithelium and cause osmotic diarrhea, malabsorption and developmental retardation by damaging the intestinal barrier function. In addition, the pathogen can infect livestock and companion animals across species, posing a major public health threat.

[0003] Current etiological diagnosis takes fecal cyst microscopic examination as the gold standard, which has the advantages of simple operation and economy, but has technical bottlenecks such as low sensitivity (missed detection rate > 30%), strong subjectivity of result interpretation and long detection period, and is difficult to meet the screening needs of primary units. Existing alternatives such as nested PCR have good specificity, but are limited by the dependence on precision instruments and the complexity of operation; immunological detection technology has made breakthroughs in sensitivity, but still faces problems such as large sample matrix interference. Therefore, there is an urgent need to develop a field-applicable diagnostic method with high sensitivity, rapid detection and simplified equipment.

[0004] Immunomagnetic bead technology is an immunological enrichment detection technology with rapid detection, strong specificity and high sensitivity. Traditional ELISA includes direct ELISA, indirect ELISA, double antibody sandwich ELISA detection method, etc., which has the characteristics of strong specificity, simple operation and easy group detection, and is outstanding in immunological detection methods, but these ELISA detection methods can only target a protein of the pathogen as the detection target, and need to extract the protein of the giardia cyst in the sample for detection. SUMMARY

[0005] The application provides a magnetic bead solid-phase ELISA kit for detecting giardia cysts and a preparation method thereof, which is prepared by using the immunomagnetic bead process of biotin-streptavidin coupling reaction.

[0006] The preparation method of the magnetic bead solid-phase ELISA kit for detecting giardia cysts provided by the application adopts the following technical solutions: The immunomagnetic bead process using a biotin-streptavidin coupling reaction is used for preparation, and through immunomagnetic beads, Giardia cysts in feces are enriched, the enriched magnetic bead-Giardia cyst complex is added to an antibody-coated enzyme label plate, and the integration process of "magnetic bead enrichment-targeted adsorption-direct detection" is realized; the magnetic bead-cyst complex is directly added to the enzyme label plate coated with the antibody in advance, and the magnetic bead enrichment and cleaning are completed in the hole by using a 96-hole plate magnetic frame, and the immunomagnetic bead technology is solidified into the ELISA kit preparation process.

[0007] The magnetic bead solid-phase ELISA kit for detecting Giardia cysts provided by the application comprises a magnetic device, a multi-well plate, solution A, solution B, solution C, solution D, solution E, solution F, and solution G. Solution A: Anti-BG immunomagnetic beads, 1 mL; Solution B: CWP1 antibody coating solution, 1.465 g of NaHCO3 and 0.795 g of Na2CO3 are weighed and diluted to 500 mL, and the pH is adjusted to 9.5, and the solution is stored at 4 DEG C; Solution C: Washing solution, 0.05% PBST (0.5 mL of Tween dissolved in 1000 mL of 1xPBS), and the solution is stored at room temperature; Solution D: Blocking solution, 5% skimmed milk powder (0.05 g of dehydrated milk powder is dissolved in 1 mL of PBST), and the solution is stored at room temperature; Solution E: Termination solution, 1 mol / L sulfuric acid, and the solution is stored at 4 DEG C; Solution F: Anti-mouse HRP enzyme label secondary antibody, 50 μL, and the solution is stored at 4 DEG C; Solution G: TMB color developing substrate solution, 100 mL, and the solution is stored at 4 DEG C; Positive control: feces of C57BL / 6 mice artificially infected with Giardia; Negative control: feces of SPF C57BL / 6 mice.

[0008] The application takes Giardia specific antigens CWP1 (cyst wall protein 1, Gene ID: 5697748) and BG (beta-giardin, Gene ID: 5698276) as detection targets. The CWP1 target fragment is 726 bp, encodes 241 amino acids, the predicted molecular weight is 26.04 kDa, the theoretical isoelectric point is 3.79, and there is no signal peptide; the BG target fragment is 819 bp, encodes 272 amino acids, the molecular weight is 30.9 kDa, the theoretical isoelectric point is 5.25, and there is also no signal peptide.

[0009] This invention discloses a method for preparing a magnetic bead solid-phase ELISA kit for detecting Giardia lamblia cysts. The method involves expressing and purifying CWP1 and BG proteins and preparing corresponding polyclonal antibodies, which are then used to construct anti-BG immunomagnetic beads. Key parameters such as antibody coating concentration, reaction time, and working concentration of the enzyme-labeled secondary antibody are systematically optimized to establish a magnetic bead solid-phase ELISA kit for detecting Giardia lamblia infection. The specific preparation process includes the following steps: 1. Preparation of anti-BG immunomagnetic beads Add the resuspended magnetic bead-encapsulation complex to the microplate, place the magnetic rack of the 96-well plate under the microplate to enrich the magnetic beads, shake slowly in a shaker at room temperature for 1 hour, add 200 μL of washing solution to each well, let stand for 1 minute, discard the washing solution completely, and repeat 3 times. 2. Preparation of CWP1 antibody coating solution The purified CWP1 polyclonal antibody was used as the capture antigen (coating antibody) and diluted to 5 μg / mL with CWP1 antibody coating solution. 100 μL of the diluent was added to each well of the ELISA plate, the plate was capped, and incubated at 4°C for 12 h. The liquid in the wells was discarded, and 200 μL of washing solution was added to each well. After standing for 1 min, the washing solution was completely discarded. This process was repeated 3 times. Blocking solution was added to each well, and the plate was incubated at 37°C for 1 h. After incubation, the blocking solution was discarded, and 200 μL of washing solution was added. After standing for 1 min, the washing solution was completely discarded. This process was repeated 3 times.

[0010] 3. ELISA Antibody Incubation and Color Development Procedure Dilute the anti-mouse HRP enzyme-labeled secondary antibody 1:5000 using antibody dilution buffer. Add 100 μL of the diluted antibody solution to each well, cover the plate, and incubate at 37°C for 1 hour. After incubation, discard the liquid in the wells. Add 200 μL of wash solution to each well, let stand for 1 minute, and then discard the wash solution completely. Wash the solution, repeat 3 times; Under light-protected conditions, add 100 μL of fresh TMB substrate solution to each well, cover the plate, and incubate at room temperature in the dark for 15 min. When the color development reaches the expected intensity, add 100 μL of solution E to terminate the reaction, and gently shake the plate to mix it evenly. After terminating the reaction, read the absorbance at the main wavelength of 450 nm on a microplate reader. The conditions for the ELISA experiment to be successful are that the OD value of the positive control is greater than 0.8 and the OD value of the negative control is less than 0.2.

[0011] The Giardia magnetic bead solid-phase ELISA prepared based on the Giardia CWP1 and BG protein can directly enrich and detect the Giardia cysts in feces, without further extracting the fecal protein for ELISA detection, and has the advantages of high sensitivity, strong specificity, good stability, high-throughput detection and the like. The detection result is intuitive and easy to judge, and is suitable for rapid diagnosis in clinical field and application in large-scale epidemiological investigation, and can effectively reduce the risk of occurrence and transmission of Giardia.

[0012] The positive effect of the present application is that: the Giardia cysts in feces are enriched by immunomagnetic beads, and the enriched magnetic bead-Giardia cyst complex is added to the enzyme-labeled plate coated with antibodies, realizing the integration process of "magnetic bead enrichment-targeted adsorption-direct detection". The present application realizes the fixation of cysts by using two kinds of solid carriers of magnetic beads and enzyme-labeled plates through the process of "double antibody sandwich", overcomes the problem that the traditional ELISA is difficult to fix due to the large size of pathogens, and at the same time, the combined design breaks through the limitation that the traditional ELISA needs to extract pathogen protein in advance, so that the magnetic bead-cyst complex can be directly transferred to the enzyme-labeled plate for detection, significantly simplifying the operation steps and improving the sensitivity, and has a wide application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 PCR amplification of CWP1 and BG genes (M: DNA marker (DL1000); 1: BG PCR product); Figure 2 Double enzyme digestion identification map of expression vectors pGEX-4T-1-CWP1 and pGEX-4T-1-BG (M: DNA marker (DL1000); 1: double enzyme digestion product of pGEX-4T-1-CWP1 and pGEX-4T-1-BG expression vectors); Figure 3 Induced expression map of recombinant proteins pGEX-4T-1-CWP1 and pGEX-4T-1-BG (M: protein marker; 1: induced supernatant of recombinant proteins pGEX-4T-1-CWP1 and pGEX-4T-1-BG; 2: induced precipitate of recombinant proteins pGEX-4T-1-CWP1 and pGEX-4T-1-BG; 3: uninduced whole bacteria of recombinant proteins pGEX-4T-1-CWP1 and pGEX-4T-1-BG; 4: pGEX-4T-1 vector); Figure 4 Western blot identification map of recombinant proteins pGEX-4T-1-CWP1 and pGEX-4T-1-BG (1: induced precipitate of recombinant protein pGEX-4T-1-BG; 2: whole trophozoite protein of Giardia); Figure 5 It is a kit principle abstract map of the present application; Figure 6 Figure 1 shows the microscopic examination of Giardia cysts in a Giardia positive clinical sample. DETAILED DESCRIPTION

[0014] The present application is further illustrated by the following examples, which in no way should be construed as limiting the present application. Any modification and / or change made to the present application by a person of ordinary skill in the art without departing from the technical solutions of the present application shall fall within the scope of the claims of the present application.

[0015] Example 1

[0016] 1. PCR amplification of Giardia CWP1, BG gene According to the gene sequences of Giardia CWP1 (Gene ID: 5697748), BG (Gene ID: 5698276), the specific primer sequences are designed as follows: CWP1-F: CGG CCGGAATTC ATGATGCTCGCTCTCCT; CWP1-R: CGG CCGCTCGAG TCAAGGCGGGGTGAGGCA; BG-F: CGG CCGGAATTC ATGTCTATGTTCACCTCCACCC; BG-R: CGG CCGCTCGAG TTAGTGCTTTGTGACCATCGAGAG; The target fragments of Giardia CWP1, BG are amplified by polymerase chain reaction (PCR). The results show that the 726 bp and 819 bp fragments (including the CWP1, BG target fragments, enzyme cutting sites and protective bases) are successfully amplified as shown in Figure 1 .

[0017] 2. Construction of pGEX-4T-1-CWP1, pGEX-4T-1-BG expression vectors The recombinant plasmids pGEX-4T-1-CWP1, pGEX-4T-1-BG are double enzyme cut identified by using BamH I and EcoR I two endonucleases, and are separated and identified by 1% agarose gel electrophoresis. The results show that the pGEX-4T-1-CWP1, pGEX-4T-1-BG expression vectors are successfully constructed as shown in Figure 2 .

[0018] 3. Induced expression of recombinant protein pGEX-4T-1-CWP1, pGEX-4T-1-BG The bacteria liquid of pGEX-4T-1 and the recombinant expression vector pGEX-4T-1-CWP1 and pGEX-4T-1-BG which are sequenced correctly are respectively cultured in 6 mL LB medium, when the OD600 is 0.6, one thousandth of IPTG is added to induce 6 hours, and the ultrasonic is used to analyze and identify the expressed protein by SDS-PAGE. The results show that the expression amount of the recombinant protein pGEX-4T-1-CWP1 and pGEX-4T-1-BG is high in the induced precipitation, the target band of pGEX-4T-1-CWP1 is visible at about 52 kDa, and the target band of pGEX-4T-1-BG is visible at about 61 kDa, which indicates that the recombinant protein pGEX-4T-1-CWP1 and pGEX-4T-1-BG is successfully induced and expressed, as shown in the following figure: Figure 3 4. Preparation of Giardia CWP1 and BG polyclonal antibodies The recombinant protein pGEX-4T-1-BG which is successfully induced and expressed in a large amount is purified by the gel cutting purification method, 100 μg of the recombinant protein pGEX-4T-1-CWP1 and pGEX-4T-1-BG is diluted into 100 μL solution, and then mixed with an equal volume of Freund's complete adjuvant to emulsify, so as to immunize a New Zealand white rabbit and a 6-8 week old BALB / c mouse for the first time by subcutaneous injection at multiple points. Seven days later, the same dose of protein is mixed with Freund's incomplete adjuvant to emulsify, so as to immunize the animals for the second time, and 14 days later, the animals are immunized for the third time. Seven days after the third immunization, the animals are bled, the serum is collected, the titer is determined, and the serum is stored at-40℃.

[0019] 5. Determination of the titer and concentration of Giardia CWP1 and BG polyclonal antibodies The serum of the immunized animals is used to determine the antibody titer by the indirect ELISA method, and the results show that the antibody titer of CWP1 reaches 1:256000, and the antibody titer of BG reaches 1:128000.

[0020] BCA method is used to determine the protein content of the Giardia BG polyclonal antibody prepared by the method, and the results show that the content concentration of the Giardia BG polyclonal antibody is 30 mg / mL, and the content concentration of the CWP1 polyclonal antibody is 26 mg / mL.

[0021] 6. Western-blot analysis and identification of the recombinant protein pGEX-4T-1-CWP1 and pGEX-4T-1-BG ​The animal serum samples immunized with the recombinant proteins pGEX-4T-1-CWP1 and pGEX-4T-1-BG were detected by using the Western-blot detection method with the recombinant proteins pGEX-4T-1-CWP1, pGEX-4T-1-BG and the whole protein of the Giardia trophozoite as antigens. The results showed that when the recombinant proteins pGEX-4T-1-CWP1 and pGEX-4T-1-BG were detected, clear bands were observed at about 61 kDa, and when the whole protein of the Giardia trophozoite was detected, clear bands were observed at about 35 kDa (as shown in Figure 4 FIG. 1), indicating that the recombinant proteins pGEX-4T-1-CWP1 and pGEX-4T-1-BG have good immunogenicity.

[0022] Example 2

[0023] After 100 μg of the recombinant protein pGEX-4T-1-BG was diluted into a 100 μL solution, it was mixed and emulsified with an equal volume of Freund's complete adjuvant, and then the 6-8 week old BALB / c mice were immunized for the first time by subcutaneous injection at multiple points. Seven days later, the same dose of the protein was mixed and emulsified with Freund's incomplete adjuvant, and then the mice were immunized for the second time. Fourteen days later, the mice were immunized for the third time. Seven days after the third immunization, the mice were subjected to fundus plexus blood collection. The collected serum was detected for titer and stored at -40 °C.

[0024] After the streptavidin magnetic beads were mixed well by using a vortex mixer, 2 mg of the magnetic beads were taken into a 1.5 mL centrifuge tube by using a pipette. The centrifuge tube was placed on a magnetic stand for solid-liquid complete separation, and the supernatant was removed. The magnetic beads were mixed and washed for 2-3 times with PBST, and then stored at 4 °C.

[0025] Antibody diluent: 3% BSA, 3 g of bovine serum albumin BSA was added to 100 mL of PBST.

[0026] After the prepared polyclonal antibody was diluted into a 1 mL solution at a certain multiple, biotin N-hydroxysuccinimide ester (NHS-biotin) was added to adjust the final concentration to 2 mM, and then the mixture was incubated at 4 °C for 1 h with inversion mixing.

[0027] The biotinylated antibody in step (4) was coupled with the streptavidin magnetic beads in step (2) at room temperature, and then the mixture was incubated for 1 h with inversion mixing to prepare streptavidin-biotin anti-BG immunomagnetic beads.

[0028] Example 3, preparation process of magnetic bead solid-phase ELISA

[0029] Sample processing: Dissolve the fecal sample with appropriate amount of water, use pestle to crush the fecal sample in the sample tube, make the fecal sample fully dissolved in water. Then centrifuge the fecal solution, 3000 rpm, 10 min, collect the precipitate after centrifugation, dissolve with appropriate amount of water and then detect.

[0030] Take an appropriate amount of diluted fecal sample into a new EP tube, take an appropriate amount of coupled solution A (pre-mixed gently) and mix it, place it on a rotator, react for 60 min at room temperature. After enrichment, place it on a magnetic stand, after 2-3 min, the magnetic beads are adsorbed to the magnetic stand, gently suck the supernatant in the EP tube to another EP tube. Then use 500 μL PBST to gently wash the immunomagnetic beads 3 times, resuspend the magnetic beads with 200 μL PBST and mix well.

[0031] Dilute the purified CWP1 polyclonal antibody as a capture antigen (coating antibody) with solution B to 5 μg / mL, add 100 μL of the diluent to each well of the enzyme-labeled plate, cover the plate, and incubate at 4°C for 12 h. The next day, carefully discard the liquid in the wells, add 200 μL of solution C to each well, stand for 1 min, and completely discard solution C, repeat 3 times. Add solution D to each well, incubate at 37°C for 1 h, discard solution D after incubation, add 200 μL of solution C, stand for 1 min, and completely discard solution C, repeat 3 times.

[0032] Add the resuspended magnetic bead-capsule complex to the enzyme-labeled plate, place the 96-well plate magnetic stand under the enzyme-labeled plate to enrich the magnetic beads, slowly shake in the shaking bed at room temperature for 1 h, then add 200 μL of solution C to each well, stand for 1 min, and completely discard solution C, repeat 3 times.

[0033] Dilute solution F (anti-mouse HRP enzyme-labeled secondary antibody) to the appropriate concentration with the antibody diluent, add 100 μL of the diluted detection antibody solution to each well, cover the plate, incubate at 37°C for 1 h, discard the liquid in the wells after incubation, add 200 μL of solution C to each well, stand for 1 min, and completely discard solution C, repeat 3 times.

[0034] Under light-proof conditions, add 100 μL of fresh solution G (TMB color developing substrate solution) to each well, cover the plate, and incubate at room temperature in the light-proof condition for 15 min. When the color development reaches the expected intensity, add 100 μL of solution E to terminate the reaction, and gently shake the plate to mix evenly. After termination of the reaction, read the absorbance at the main wavelength of 450 nm on the enzyme-labeled instrument. The conditions under which the ELISA experiment is established are that the OD value of the positive control is greater than 0.8 and the OD value of the negative control is less than 0.2, as shown in Figure 5

[0035] Experimental Example 1

[0036] ​21 cases of feces collected from beef cattle farms were detected by the kit prepared by the application, each sample was repeated for 3 times, 1 case of positive sample and 20 cases of negative sample were detected. The 1 case of positive sample detected was observed by microscopy, the presence of giardia cysts could be observed, and the giardia cysts could not be detected in other negative samples (as shown in Table 1, Figure 6

[0037] Table 1. ELISA absorbance detection of clinical samples

[0038] Conclusion: The kit of the application detects 200 cysts / mL of positive feces, the CV is less than 5%, the fixation of the cysts is realized, the problem that the traditional ELISA is difficult to fix due to the large volume of pathogens is overcome, the combination design breaks through the limitation that the traditional ELISA needs to extract pathogen protein in advance, the magnetic bead-cyst complex can be directly transferred to the enzyme-labeled plate for detection, and has good clinical application value.​

Claims

1. A magnetic bead solid-phase ELISA kit for detecting Giardia cysts, mainly composed of the following substances: a magnetic device, a multi-well plate, solution A, solution B, solution C, solution D, solution E, solution F, and solution G; wherein, Solution A: Anti-BG immunomagnetic beads, 1 mL; Solution B: CWP1 antibody coating solution, weigh 1.465 g NaHCO3 and 0.795 g Na2CO3, dilute to 500 mL, adjust pH to 9.5, and store at 4℃; Solution C: Washing solution, 0.05% PBST (0.5 mL Tween dissolved in 1000 mL 1×PBS), store at room temperature; Solution D: Blocked solution, 5% skim milk powder (0.05g dehydrated milk powder dissolved in 1mL PBST), stored at room temperature; Solution E: Termination solution, 1 mol / L sulfuric acid, stored at 4°C; Solution F: Anti-mouse HRP enzyme-labeled secondary antibody, 50 μL, stored at 4°C; Solution G: TMB chromogenic substrate solution, 100 mL, stored at 4°C; Positive control: Feces from C57BL / 6 mice artificially infected with Giardia lamblia; Negative control: SPF grade C57BL / 6 mouse feces.

2. The method for preparing a magnetic bead solid-phase ELISA kit for detecting Giardia cysts as described in claim 1, characterized in that: Immunomagnetic beads were prepared using a biotin-streptavidin coupling reaction process. The immunomagnetic beads were used to enrich Giardia cysts in feces. The enriched magnetic bead-Giardia cyst complex was then added to an antibody-coated ELISA plate, realizing an integrated process of magnetic bead enrichment, targeted adsorption, and direct detection.

3. The preparation method of the magnetic bead solid-phase ELISA kit for detecting Giardia cysts as described in claim 1, comprising the following steps: 1) Preparation of anti-BG immunomagnetic beads Add the resuspended magnetic bead-encapsulation complex to the microplate, place the magnetic rack of the 96-well plate under the microplate to enrich the magnetic beads, shake slowly in a shaker at room temperature for 1 hour, add 200 μL of washing solution to each well, let stand for 1 minute, discard the washing solution completely, and repeat 3 times. 2) Preparation of CWP1 antibody coating solution The purified CWP1 polyclonal antibody was used as the capture antigen (coating antibody) and diluted to 5 μg / mL with CWP1 antibody coating solution. 100 μL of the diluent was added to each well of the microplate, the plate was capped, and incubated at 4°C for 12 h. The liquid in the wells was discarded, and 200 μL of washing solution was added to each well. After standing for 1 min, the washing solution was completely discarded. This process was repeated 3 times. Blocking solution was added to each well, and the plate was incubated at 37°C for 1 h. After incubation, the blocking solution was discarded, and 200 μL of washing solution was added. After standing for 1 min, the washing solution was completely discarded. This process was repeated 3 times. 3) ELISA detection antibody incubation and color development procedure Dilute the anti-mouse HRP enzyme-labeled secondary antibody 1:5000 using antibody dilution buffer. Add 100 μL of the diluted detection antibody solution to each well, cover the plate, and incubate at 37°C for 1 h. After incubation, discard the liquid in the wells, add 200 μL of washing solution to each well, let stand for 1 min, and then discard the washing solution completely. Repeat 3 times. Under light-protected conditions, add 100 μL of fresh TMB substrate solution to each well, cover the plate, and incubate at room temperature in the dark for 15 min. When the color development reaches the expected intensity, add 100 μL of solution E to terminate the reaction, and gently shake the plate to mix it evenly. After terminating the reaction, read the absorbance at the main wavelength of 450 nm on a microplate reader. The conditions for the ELISA experiment to be successful are that the OD value of the positive control is greater than 0.8 and the OD value of the negative control is less than 0.2.