Young dilated cardiomyopathy related SNP (Single Nucleotide Polymorphism) site, primer pair and application thereof
By identifying 12 SNP sites associated with dilated cardiomyopathy in young people and their PCR amplification primer pairs, a predictive model was constructed, which solved the problem that existing technologies could not accurately predict the risk of dilated cardiomyopathy and achieved highly accurate risk assessment, suitable for early screening of healthy people.
Patent Information
- Application Number
- CN202511112057.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-08
- Publication Date
- 2025-11-25
AI Technical Summary
Current technologies have not yet found single nucleotide polymorphism sites that can accurately predict the risk of developing dilated cardiomyopathy, making it difficult to identify young patients with dilated cardiomyopathy in the early stages and increasing the difficulty of prevention and treatment.
Twelve SNP loci associated with dilated cardiomyopathy in young adults and their PCR amplification primer pairs were provided. Combined with MassARRAY nucleic acid sequencing technology, a predictive model was constructed. The individual's risk of developing the disease was assessed by calculating the S value. The predictive model used an S value ≤ 4.4 as low risk, S > 8.2 as high risk, and 4.4 < S ≤ 8.2 as intermediate risk.
It achieved accurate prediction of the risk of dilated cardiomyopathy in young people, with an AUC value as high as 0.912 and a specificity and sensitivity of over 90%, significantly improving the accuracy and reliability of the prediction.
Smart Images

Figure BDA0005540150740000121 
Figure BDA0005540150740000122 
Figure BDA0005540150740000131
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of gene detection, in particular to SNP sites related to young dilated cardiomyopathy, primer pairs and application thereof. BACKGROUND
[0002] Dilated cardiomyopathy (DCM) is a kind of cardiomyopathy characterized by left ventricular or biventricular enlargement and systolic dysfunction. Its causes are numerous, which may be infection, immune response, or genetic disease, poison or metabolic disorder, etc. In addition, the causes of a part of DCM are still unknown. Among them, there is a special type, which appears significant biventricular enlargement in young people, which is called young dilated cardiomyopathy. This disease, because of early onset, often has very poor prognosis and very high risk of sudden death. Therefore, how to accurately identify the risk of such disease in the population as early as possible, and prevent and treat such patients in advance, is very important.
[0003] Most of the causes of dilated cardiomyopathy are unknown, and the known causes include infection, non-infectious inflammation, poisoning, endocrine and metabolic disorders, etc. With the development of gene detection in recent years, more and more dilated cardiomyopathy is determined to be caused by genetic factors. Especially the young dilated cardiomyopathy, multiple genetic variations have been confirmed to significantly increase the risk of this disease.
[0004] Therefore, if a genetic factor is used to construct a prediction model, the accuracy of the disease prediction can be significantly improved. The risk score prediction model based on single nucleotide polymorphism sites (SNP) can achieve this purpose. This model requires first screening SNP sites related to young dilated cardiomyopathy, and then using these SNP sites to construct a risk score model by assigning scores respectively through appropriate statistical methods, and finally verifying the prediction effect of the model in the population.
[0005] However, so far, a single nucleotide polymorphism site with high accuracy for predicting the risk of dilated cardiomyopathy has not been found. SUMMARY
[0006] Therefore, the main purpose of the present application is to provide a SNP site related to young dilated cardiomyopathy and a set thereof, and on this basis, a prediction model for predicting the risk of young dilated cardiomyopathy is constructed, which has high accuracy in predicting the risk of young dilated cardiomyopathy.
[0007] To achieve the above purpose, the technical solutions of the present application are as follows:
[0008] One of the purposes of the present application is to provide a SNP site related to youth dilated cardiomyopathy, the SNP site comprising one or more combinations of numbers 1 to 12, wherein the SNP site of number 1 is located at position 207684579 on chromosome 2, the SNP site allele is C or T, and the risk allele is T; the SNP site of number 2 is located at position 197084089 on chromosome 2, the SNP site allele is G or A, and the risk allele is A; the SNP site of number 3 is located at position 155532795 on chromosome 5, the SNP site allele is C or T, and the risk allele is T; the SNP site of number 4 is located at position 70408568 on chromosome 12, the SNP site allele is C or A, and the risk allele is A; the SNP site of number 5 is located at position 96217325 on chromosome 14, the SNP site allele is T or C, and the risk allele is C; the SNP site of number 6 is located at position 27418298 on chromosome 9, the SNP site allele is C or T, and the risk allele is T; the SNP site of number 7 is located at position 57574238 on chromosome 7, the SNP site allele is C or G, and the risk allele is G; the SNP site of number 8 is located at position 94935442 on chromosome 9, the SNP site allele is C or T, and the risk allele is T; the SNP site of number 9 is located at position 76453904 on chromosome 7, the SNP site allele is A or G, and the risk allele is G; the SNP site of number 10 is located at position 68187651 on chromosome 7, the SNP site allele is G or T, and the risk allele is T; the SNP site of number 11 is located at position 81414747 on chromosome 14, the SNP site allele is G or A, and the risk allele is A; and the SNP site of number 12 is located at position 108676498 on chromosome 12, the SNP site allele is A or C, and the risk allele is C.
[0009] The second purpose of the present application is to provide a PCR amplification primer pair for amplifying the SNP site related to youth dilated cardiomyopathy in the present application.
[0010] Further, the primer pair has a nucleotide sequence as shown in SEQ ID NO: 1-24.
[0011] Specifically,
[0012] The primer pair for detecting the SNP site of number 1 is:
[0013] Forward primer: TAAGGCAGTGGCATGTGTGA (SEQ ID No: 1);
[0014] Forward primer: TCAATGGCTTTGGTCCCAGT (SEQ ID No: 3);
[0015] The primer pair for detecting the SNP site No. 2 is:
[0016] Forward primer: TCAATGGCTTTGGTCCCAGT (SEQ ID No: 3);
[0017] Reverse primer: TGGTTCAGCTTGCCAACTGA (SEQ ID No: 4);
[0018] The primer pair for detecting the SNP site No. 3 is:
[0019] Forward primer: ACACACACACAAGTAACCTGC (SEQ ID No: 5);
[0020] Reverse primer: AACCAGCCTCTCCTGCTTTC (SEQ ID No: 6);
[0021] The primer pair for detecting the SNP site No. 4 is:
[0022] Forward primer: TGCGGAGAATGGAACCAAGT (SEQ ID No: 7);
[0023] Reverse primer: GATTTTGCAGCGGCTGGTAC (SEQ ID No: 8);
[0024] The primer pair for detecting the SNP site No. 5 is:
[0025] Forward primer: GCATCTCCAGTGCTTGAGGT (SEQ ID No: 9);
[0026] Reverse primer: ACTCCTTCGGCTGGAACTTG (SEQ ID No: 10);
[0027] The primer pair for detecting the SNP site No. 6 is:
[0028] Forward primer: GGTGGATCACAAGGCCAAGA (SEQ ID No: 11);
[0029] Reverse primer: TTAGGGTGATGCTGGCTTCA (SEQ ID No: 12);
[0030] The primer pair for detecting the SNP site No. 7 is:
[0031] Forward primer: TCCACAAACACACATGCAAGC (SEQ ID No: 13);
[0032] Reverse primer: ACACTCCACATATCAACCACTGA (SEQ ID No: 14); The primer pair for detecting the SNP site No. 8 is:
[0033] Forward primer: TGAGAGCAGCCTGTCCATTG (SEQ ID No: 15);
[0034] Reverse primer: AGCTGCTTCTTGTTGCAAGC (SEQ ID No: 16);
[0035] The primer pair for detecting the SNP site No. 9 is:
[0036] Forward primer: TGGAAAGCATATTCTCTTCTTCAGA (SEQ ID No: 17); Reverse primer: AGTTGGCCTGGGGAAAAACA (SEQ ID No: 18);
[0037] The primer pair for detecting the SNP site No. 10 is:
[0038] Forward primer: GGGTCATGGACATGGCTCTT (SEQ ID No: 19);
[0039] Reverse primer: GGTGGGATACGGTCGGTAGA (SEQ ID No: 20);
[0040] The primer pair for detecting the SNP site No. 11 is:
[0041] Forward primer: GCCAACACAGATGGTCAAGC (SEQ ID No: 21);
[0042] Reverse primer: GAGCATTCCACTAGCCCCTT (SEQ ID No: 22);
[0043] The primer pair for detecting the SNP site No. 12 is:
[0044] Forward primer: GCTTGCCCTGACCATGATCT (SEQ ID No: 23);
[0045] Reverse primer: AGACACCAACACACAGCCAA (SEQ ID No: 24).
[0046] The third object of the present application is to provide a product for detecting the risk of youth dilated cardiomyopathy, which comprises the PCR amplification primer pair described above.
[0047] Further, the product comprises reagents, kits or SNP chips.
[0048] Further, the detection product described above further comprises PCR amplification reagents and / or MassARRAY nucleic acid sequencing reagents.
[0049] The fourth object of the present application is to provide the use of the SNP site described above or any of the PCR amplification primer pairs described above in the preparation of a product for predicting the risk of youth dilated cardiomyopathy.
[0050] The present application also provides a system for predicting the risk of youth dilated cardiomyopathy, comprising:
[0051] a data acquisition module for acquiring information of the SNP site described above in a DNA sample of a subject;
[0052] a data processing module for calculating S value according to the information of the SNP site acquired by the data acquisition module, wherein S = n1X1 + n2X2 + n3X3 + n4X4 + n5X5 + n6X6 + n7X7 + n8X8 + n9X9 + n10X10 + n11X11 + n12X12; wherein n1 to n12 are the number of risk bases of SNP sites numbered 1 to 12, respectively, and X1 to X12 are the weighted coefficients of SNP sites numbered 1 to 12, respectively; X1 to X12 are 0.53, 0.32, 0.42, 0.31, 0.65, 0.73, 0.62, 0.21, 0.31, 0.55, 0.65, 0.77, respectively. 10 10 11 11 12 12 ; wherein n1 to n 12 are the number of risk bases of SNP sites numbered 1 to 12, respectively, and X1 to X 12 are the weighted coefficients of SNP sites numbered 1 to 12, respectively; X1 to X 12 are 0.53, 0.32, 0.42, 0.31, 0.65, 0.73, 0.62, 0.21, 0.31, 0.55, 0.65, 0.77, respectively.
[0053] a data output module for predicting the risk of youth dilated cardiomyopathy according to the S value acquired by the data processing module, wherein when S value ≤ 4.4, it is output as low risk, when S > 8.2, it is output as high risk, and when 4.4 < S ≤ 8.2, it is output as moderate risk.
[0054] Further, the DNA sample of the subject described above is peripheral venous blood, body fluid or tissue organs.
[0055] The present invention also aims to provide a predictive device for predicting the risk of developing dilated cardiomyopathy in young people. The predictive device includes a memory and a processor. The memory stores an application program that can run on the processor. When the application program is executed by the processor, it implements a prediction method. The prediction method includes:
[0056] (1) Obtain information on the SNP sites numbered 1 to 12, which are associated with dilated cardiomyopathy in young people, as described above in the DNA samples of the subjects;
[0057] (2) Calculate the S value based on the obtained SNP site information, where,
[0058] S=n1×X1+n2×X2+n3×X3+n4×X4+n5×X5+n6×X6+n7×X7+n8×X8+n9×X9+n 10 ×X 10 +n 11 ×X 11 +n 12 ×X 12 Obtain the value of S; where n1 to n 12 These represent the number of risky bases at SNP sites numbered 1 to 12, X1 to X... 12 These are the weighting coefficients for SNP sites numbered 1 to 12; X1 to X 12 The values are 0.53, 0.32, 0.42, 0.31, 0.65, 0.73, 0.62, 0.21, 0.31, 0.55, 0.65, and 0.77, respectively.
[0059] (3) The risk of developing dilated cardiomyopathy in young people is predicted based on the obtained S value. When the S value is ≤4.4, the output is low risk; when S>8.2, the output is high risk; and when 4.4<S≤8.2, the output is medium risk.
[0060] Another objective of this invention is to provide a computer-readable storage medium storing a computer application program that can be executed by one or more processors to implement a prediction method.
[0061] The prediction methods include:
[0062] (1) Obtain information on the SNP sites numbered 1 to 12, which are associated with dilated cardiomyopathy in young people, as described above in the DNA samples of the subjects;
[0063] (2) Calculate the S value based on the obtained SNP site information, where,
[0064] S=n1×X1+n2×X2+n3×X3+n4×X4+n5×X5+n6×X6+n7×X7+n8×X8+n9×X9+n 10 ×X 10 +n 11 ×X 11 +n 12 ×X 12 ; where n1 to n 12 These represent the number of risky bases at SNP sites numbered 1 to 12, X1 to X... 12 These are the weighting coefficients for SNP sites numbered 1 to 12; X1 to X 12 The values are 0.53, 0.32, 0.42, 0.31, 0.65, 0.73, 0.62, 0.21, 0.31, 0.55, 0.65, and 0.77, respectively.
[0065] (3) The risk of developing dilated cardiomyopathy in young people is predicted based on the obtained S value. When the S value is ≤4.4, the output is low risk; when S>8.2, the output is high risk; and when 4.4<S≤8.2, the output is medium risk.
[0066] The beneficial effects of this invention include at least the following:
[0067] The predictive model constructed based on SNP sites associated with dilated cardiomyopathy in young adults, as described in this invention, accurately predicts the future risk of developing dilated cardiomyopathy in young adults, with an AUC value as high as 0.912, demonstrating very strong predictive performance. The model also exhibits excellent predictive performance with a specificity of 90.3% and a sensitivity of 90.8%. Attached Figure Description
[0068] Figure 1 This is the ROC curve of the prediction model in this invention. Detailed Implementation
[0069] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0070] Furthermore, the technical solutions of the various embodiments of the present invention can be combined with each other, but only if they are feasible for those skilled in the art. If the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention.
[0071] One of the purposes of the present application is to provide a SNP site related to youth dilated cardiomyopathy, the SNP site comprises one or more combinations of numbers 1 to 12, wherein the SNP site of number 1 is located at 207684579 of chromosome 2, the SNP site allele is C or T, and the risk allele is T; the SNP site of number 2 is located at 197084089 of chromosome 2, the SNP site allele is G or A, and the risk allele is A; the SNP site of number 3 is located at 155532795 of chromosome 5, the SNP site allele is C or T, and the risk allele is T; the SNP site of number 4 is located at 70408568 of chromosome 12, the SNP site allele is C or A, and the risk allele is A; the SNP site of number 5 is located at 96217325 of chromosome 14, the SNP site allele is T or C, and the risk allele is C; the SNP site of number 6 is located at 27418298 of chromosome 9, the SNP site allele is C or T, and the risk allele is T; the SNP site of number 7 is located at 57574238 of chromosome 7, the SNP site allele is C or G, and the risk allele is G; the SNP site of number 8 is located at 94935442 of chromosome 9, the SNP site allele is C or T, and the risk allele is T; the SNP site of number 9 is located at 76453904 of chromosome 7, the SNP site allele is A or G, and the risk allele is G; the SNP site of number 10 is located at 68187651 of chromosome 7, the SNP site allele is G or T, and the risk allele is T; the SNP site of number 11 is located at 81414747 of chromosome 14, the SNP site allele is G or A, and the risk allele is A; and the SNP site of number 12 is located at 108676498 of chromosome 12, the SNP site allele is A or C, and the risk allele is C.
[0072] It should be noted that in the present application, the risk of youth dilated cardiomyopathy can be predicted by one of the above-mentioned SNP sites, and the accuracy of predicting the risk of youth dilated cardiomyopathy can be increased by different combinations of SNP sites, and more preferably, 12 SNP sites are detected at the same time to predict the risk of youth dilated cardiomyopathy.
[0073] The embodiment of the present application also provides a PCR amplification primer pair for amplifying the SNP site related to youth dilated cardiomyopathy in the present application.
[0074] It should be noted that the present application can use the PCR amplification primer pair to detect the SNP site, and the PCR amplification primer pair can be designed according to the conventional technical means in the art.
[0075] In some specific examples,
[0076] The primer pair for detecting the SNP site No. 1 is:
[0077] Forward primer: TAAGGCAGTGGCATGTGTGA (SEQ ID No: 1);
[0078] Reverse primer: CTCACTGCAACCTCCACCTC (SEQ ID No: 2);
[0079] The primer pair for detecting the SNP site No. 2 is:
[0080] Forward primer: TCAATGGCTTTGGTCCCAGT (SEQ ID No: 3);
[0081] Reverse primer: TGGTTCAGCTTGCCAACTGA (SEQ ID No: 4);
[0082] The primer pair for detecting the SNP site No. 3 is:
[0083] Forward primer: ACACACACACAAGTAACCTGC (SEQ ID No: 5);
[0084] Reverse primer: AACCAGCCTCTCCTGCTTTC (SEQ ID No: 6);
[0085] The primer pair for detecting the SNP site No. 4 is:
[0086] Forward primer: TGCGGAGAATGGAACCAAGT (SEQ ID No: 7);
[0087] Reverse primer: GATTTTGCAGCGGCTGGTAC (SEQ ID No: 8);
[0088] The primer pair for detecting the SNP site No. 5 is:
[0089] Forward primer: GCATCTCCAGTGCTTGAGGT (SEQ ID No: 9);
[0090] Reverse primer: ACTCCTTCGGCTGGAACTTG (SEQ ID No: 10);
[0091] The primer pair for detecting the SNP site No. 6 is:
[0092] Forward primer: GGTGGATCACAAGGCCAAGA (SEQ ID No: 11);
[0093] Forward primer: TTAGGGTGATGCTGGCTTCA (SEQ ID No: 12);
[0094] The primer pair for detecting the SNP site No. 7 is:
[0095] Forward primer: TCCACAAACACACATGCAAGC (SEQ ID No: 13);
[0096] Reverse primer: ACACTCCACATATCAACCACTGA (SEQ ID No: 14);
[0097] The primer pair for detecting the SNP site No. 8 is:
[0098] Forward primer: TGAGAGCAGCCTGTCCATTG (SEQ ID No: 15);
[0099] Reverse primer: AGCTGCTTCTTGTTGCAAGC (SEQ ID No: 16);
[0100] The primer pair for detecting the SNP site No. 9 is:
[0101] Forward primer: TGGAAAGCATATTCTCTTCTTCAGA (SEQ ID No: 17);
[0102] Reverse primer: AGTTGGCCTGGGGAAAAACA (SEQ ID No: 18);
[0103] The primer pair for detecting the SNP site No. 10 is:
[0104] Forward primer: GGGTCATGGACATGGCTCTT (SEQ ID No: 19);
[0105] Reverse primer: GGTGGGATACGGTCGGTAGA (SEQ ID No: 20);
[0106] The primer pair for detecting the SNP site No. 11 is:
[0107] Forward primer: GCCAACACAGATGGTCAAGC (SEQ ID No: 21);
[0108] Reverse primer: GAGCATTCCACTAGCCCCTT (SEQ ID No: 22);
[0109] The primer pair for detecting the SNP site No. 12 is:
[0110] Forward primer: GCTTGCCCTGACCATGATCT (SEQ ID No: 23);
[0111] Reverse primer: AGACACCAACACACAGCCAA (SEQ ID No: 24).
[0112] It should be noted that the primer pair described above can amplify both the risk gene-containing and the risk gene-non-containing.
[0113] The embodiment of the present application further provides a detection product comprising the PCR amplification primer pair in the present application.
[0114] In some specific examples, the detection product described above comprises a detection reagent, a detection kit or a SNP chip.
[0115] In some specific examples, the detection product described above further comprises PCR amplification reagents and / or MassARRAY nucleic acid sequencing technology reagents.
[0116] The embodiment of the present application further provides a prediction system for predicting the risk of developing young dilated cardiomyopathy, comprising:
[0117] A data acquisition module is configured to acquire information of SNP sites 1-12 related to young dilated cardiomyopathy in a DNA sample of a subject.
[0118] A data processing module is configured to calculate S value according to the information of SNP sites acquired by the data acquisition module, wherein S = n1X1 + n2X2 + n3X3 + n4X4 + n5X5 + n6X6 + n7X7 + n8X8 + n9X9 + n10X10 + n11X11 + n12X12; wherein n1-n12 are the number of risk bases of SNP sites 1-12, respectively, and X1-X12 are the weighted coefficients of SNP sites 1-12, respectively; X1-X12 are 0.53, 0.32, 0.42, 0.31, 0.65, 0.73, 0.62, 0.21, 0.31, 0.55, 0.65, 0.77, respectively. 10 10 11 11 12 12 ; wherein n1-n 12 are the number of risk bases of SNP sites 1-12, respectively, and X1-X 12 are the weighted coefficients of SNP sites 1-12, respectively; X1-X 12 are 0.53, 0.32, 0.42, 0.31, 0.65, 0.73, 0.62, 0.21, 0.31, 0.55, 0.65, 0.77, respectively.
[0119] The data output module is used to predict the risk of developing dilated cardiomyopathy in young people based on the S-value obtained by the data processing module. Specifically, when the S-value is ≤4.4, the output is low risk; when the S-value is >8.2, the output is high risk; and when the S-value is 4.4 < S ≤8.2, the output is moderate risk.
[0120] In some specific examples, the DNA samples of the aforementioned subjects were peripheral blood, body fluids, or tissues / organs.
[0121] This invention also provides a predictive device for predicting the risk of developing dilated cardiomyopathy in young people. The predictive device includes a memory and a processor. The memory stores an application program that can run on the processor. When the application program is executed by the processor, it implements a prediction method. The prediction method includes:
[0122] (1) Obtain information on SNP sites numbered 1 to 12 in the invention related to dilated cardiomyopathy in young people from the DNA samples of the subjects;
[0123] (2) Calculate the S value based on the obtained SNP site information, where,
[0124] S=n1×X1+n2×X2+n3×X3+n4×X4+n5×X5+n6×X6+n7×X7+n8×X8+n9×X9+n 10 ×X 10 +n 11 ×X 11 +n 12 ×X 12 Obtain the value of S; where n1 to n 12 These represent the number of risky bases at SNP sites numbered 1 to 12, X1 to X... 12 These are the weighting coefficients for SNP sites numbered 1 to 12; X1 to X 12 The values are 0.53, 0.32, 0.42, 0.31, 0.65, 0.73, 0.62, 0.21, 0.31, 0.55, 0.65, and 0.77, respectively.
[0125] (3) The risk of developing dilated cardiomyopathy in young people is predicted based on the obtained S value. When the S value is ≤4.4, the output is low risk; when S>8.2, the output is high risk; and when 4.4<S≤8.2, the output is medium risk.
[0126] This invention also provides a computer-readable storage medium storing an application program that can be executed by one or more processors to implement the prediction method.
[0127] The prediction methods include:
[0128] (1) Obtain information on the SNP sites numbered 1 to 12 associated with dilated cardiomyopathy in young people in the present invention from the DNA samples of the subjects;
[0129] (2) Calculate the S value based on the obtained SNP site information, where,
[0130] S=n1×X1+n2×X2+n3×X3+n4×X4+n5×X5+n6×X6+n7×X7+n8×X8+n9×X9+n 10 ×X 10 +n 11 ×X 11 +n 12 ×X 12 ; where n1 to n 12 These represent the number of risky bases at SNP sites numbered 1 to 12, X1 to X... 12 These are the weighting coefficients for SNP sites numbered 1 to 12; X1 to X 12 The values are 0.53, 0.32, 0.42, 0.31, 0.65, 0.73, 0.62, 0.21, 0.31, 0.55, 0.65, and 0.77, respectively.
[0131] (3) The risk of developing dilated cardiomyopathy in young people is predicted based on the obtained S value. When the S value is ≤4.4, the output is low risk; when S>8.2, the output is high risk; and when 4.4<S≤8.2, the output is medium risk.
[0132] The following specific embodiments illustrate the solution proposed in this invention:
[0133] The reagents used in this invention are as follows: Onco Cartapanel 2.0 (Sequenom, San Diego); Onco Carta amplification primer mixture (Sequenom); Onco Carta extension primer mixture (Sequenom); Clean Resin resin (Sequenom); Spectro CHIP II chip (Sequenom).
[0134] The following specific embodiments illustrate the solution proposed in this invention:
[0135] Example 1
[0136] 1. Specimen collection and preservation
[0137] (1) Specimen collection
[0138] The samples were collected from 18-30 years old healthy people in the physical examination center of the Second Affiliated Hospital of Anhui Medical University, 5ml peripheral venous blood was collected and treated with EDTA anticoagulation. The inclusion criteria was young people (less than 30 years old) who signed the informed consent form, and the exclusion criteria was patients who had been diagnosed with cardiovascular disease or cancer.
[0139] (2) Preservation
[0140] The samples can be detected immediately, if short-term preservation is needed, they can be stored in a 4℃ refrigerator for one week. If long-term preservation is needed, they need to be stored at-80℃.
[0141] 2. Detection step (1) extraction of specimen genomic DNA
[0142] The blood DNA extraction kit of Nanjing Nuo Weizan Biological Technology Co., Ltd. was used to extract genomic DNA according to the following steps:
[0143] 1) Take 200μL of blood cell sample containing white blood cells, add it to a numbered 1.5mL EP tube, add 5μL of RNase, shake and mix for 30 seconds, and let it stand at room temperature for 10 minutes.
[0144] 2) Add 20μL of proteinase K, mix for 30 seconds, then add 200μL of GB buffer, shake and mix for 30 seconds.
[0145] 3) After short centrifugation, place it in a 56℃ water bath for 20 minutes, then remove it and centrifuge again to remove the water droplets on the wall of the tube.
[0146] 4) Let it stand at room temperature for 5 minutes, add 350μL of BD buffer, mix well to produce a small amount of flocculent precipitate.
[0147] 5) Put the CG2 adsorption column in the collection tube, and transfer the mixed solution and precipitate of the previous step to the CG2 adsorption column.
[0148] 6) Centrifuge at 13000rpm for 30 seconds, discard the liquid in the collection tube, and put the CG2 adsorption column back into the collection tube.
[0149] 7) Add 500μL of GDB buffer, mix well, then centrifuge at 13000rpm for 30 seconds, discard the liquid, and put the adsorption column back into the collection tube.
[0150] 8) Prepare the rinse solution PWB (add anhydrous ethanol) according to the kit instructions, add 500μL of PWB to the adsorption column, centrifuge at 13000rpm for 30 seconds, discard the liquid, and put the adsorption column back into the collection tube.
[0151] 9) Repeat step 8) once.
[0152] 10) 13000 rpm for 2 min, remove the column, and let it dry at room temperature for 20 min.
[0153] 11) Put the column into a new 1.5 mL EP tube, slowly add 80 μL TB elution buffer to the center of the membrane, let it stand at room temperature for 5 min, centrifuge at 12000 rpm for 3 min, and collect the DNA.
[0154] 12) Use NanoDrop 2000 to detect the concentration and purity of the extracted DNA.
[0155] (2) Genomic DNA concentration determination and dilution
[0156] 1) Prepare Qubit 2.0 working solution
[0157] According to the Qubit dsDNA HS assay kit 2.0 instructions, prepare the working solution required for detection. Each working solution is mixed from 199 μL Qubit mixture and 1 μL DNA dye. Prepare a total of the number of samples to be tested plus two calibration standards. The working solution needs to be prepared and used immediately.
[0158] 2) Calibrate Qubit 2.0 fluorometer
[0159] a) In two brand new Qubit analysis tubes, add 190 μL of freshly prepared working solution to each.
[0160] b) Take out standard S01 and S02 from the 4°C refrigerator, and add 10 μL of each to the corresponding analysis tube.
[0161] c) Shake well for 30 seconds, centrifuge briefly, and incubate at room temperature for 5 minutes in the dark.
[0162] d) According to the operation requirements of Qubit 2.0 fluorometer, put in standard S01 and S02 in turn for reading. The instrument will automatically generate a standard curve.
[0163] 3) Detect sample concentration
[0164] a) In each Qubit analysis tube, add 195 μL of detection working solution and 5 μL of sample to be tested.
[0165] b) Shake well for 30 seconds, centrifuge briefly, and incubate at room temperature for 5 minutes in the dark.
[0166] c) Set the original sample volume to 5 μL on the Qubit 2.0 fluorometer.
[0167] d) Put the samples in order into the instrument for reading, and the instrument will automatically calculate the initial concentration of genomic DNA.
[0168] 4) Sample dilution
[0169] a) Take 200 μL PCR tube, according to the measured DNA concentration, use TE elution buffer to dilute the sample to 5 ng / μL.
[0170] b) The diluted sample is used as the starting template for the subsequent PCR reaction.
[0171] (3) DNA PCR amplification reaction
[0172] The DNA PCR amplification reaction system is shown in Table 1 below.
[0173] Table 1 DNA PCR amplification reaction system
[0174]
[0175]
[0176] The DNA PCR amplification reaction program is shown in Table 2 below.
[0177] Table 2 DNA PCR amplification reaction program
[0178]
[0179] (4) Removal of residual nucleic acid bases after amplification reaction using shrimp alkaline phosphatase
[0180] a) Configure SAP suspension: 1.53 μl double distilled water, 0.17 μl SAP Buffer, 0.3 μl SAP enzyme are required for each sample;
[0181] b) Add 2 μl of the above prepared SAP suspension to each sample;
[0182] c) Place the sample in the PCR instrument and execute the following procedures in sequence: ① 37℃, 40min; ② 85℃, 5min; ③ 4℃, storage;
[0183] (5) Single base extension reaction (EXTEND)
[0184] a) Configure iPLEX single base extension suspension: 0.619 μl double distilled water, 0.2 μl iPLEX Buffer, 0.041 μl iPLEX enzyme, 0.94 μl extension primer mixture are required for each sample;
[0185] b) Add 2 μl of the above prepared iPLEX suspension to each sample;
[0186] c) Put the sample into PCR instrument to execute the following procedures in turn: ① 94℃, 30min; ② 94℃, 5min; ③ 52℃, 5s; ④ 80℃, 5min; ⑤ 72℃, 3min; ⑥ repeat ② ③ ④ ⑤ 40 times; ⑦ 4℃, storage;
[0187] (6) Sample resin purification
[0188] a) Spread the resin on the 384-well plate and air dry for 10min;
[0189] b) Add 16μl double distilled water to the sample treated in step (5);
[0190] c) Pour the resin into the sample and place it on the shaker for 15min;
[0191] d) Centrifuge at 3200g for 5min;
[0192] (7) Chip spotting and MassARRAY instrument detection mass spectrum detection
[0193] MassARRAY sequencing technology can simultaneously analyze 7 target regions of the sample and accurately identify the genotype of single nucleotide polymorphism (SNP) sites.
[0194] a) Put the sample treated above into the spotting instrument base;
[0195] b) Put the flying mass spectrum chip into the corresponding position of the spotting instrument;
[0196] c) Click the "loading" button to automatically load;
[0197] d) Put the flying mass spectrum chip after loading into the MassARRAY instrument;
[0198] e) According to the pre-set configuration file, arrange the corresponding sample number;
[0199] f) Click the "START" button, and the instrument will automatically detect and analyze the genotype of SNP sites;
[0200] (8) Data analysis
[0201] Use Typer 5.0 software TyperAnalyzer to export Onco CartaReport to obtain the detection results.
[0202] (IX) Prediction results
[0203] Using the detection results, using a weighted algorithm, each site (a total of 12 SNP sites) is calculated according to the weighted total score S = n1xX1 + n2xX2 + n3xX3 + n4xX4 + n5xX5 + n6xX6 + n7xX7 + n8xX8 + n9xX9 + n 10 xX 10 + n 11 xX 11 + n 12 xX 12 Obtain the S value; wherein n1 to n 12 are the number of risk bases of SNP sites numbered 1 to 12, X1 to X 12 are the weighted coefficients of SNP sites numbered 1 to 12, and the risk result of the subject for young dilated cardiomyopathy is obtained by querying the score table (when S value ≤4.4 points is low risk, when S>8.2 points is high risk, when 4.4<S≤8.2 is moderate risk); the weighted coefficient of each site is shown in Table 3.
[0204] Table 3 SNP site allele, risk gene and weighted coefficient
[0205]
[0206]
[0207] 3. ROC curve drawing
[0208] (1) Data preparation
[0209] The individual data of 4713 samples are arranged in a CSV file, and the data fields include:
[0210] 1) Number of risk alleles: the number of risk alleles of each SNP site.
[0211] 2) Weighting coefficient: risk weight calculated according to the model.
[0212] 3) Risk level: risk score calculated based on the weighting coefficient and the number of risk alleles.
[0213] 4) Whether young dilated cardiomyopathy occurs: a binary variable (0 indicates no occurrence, 1 indicates occurrence).
[0214] (2) R language environment setting
[0215] Install and load the "PredictABEL" package of R language, the code is as follows:
[0216] install.packages("PredictABEL")
[0217] library(PredictABEL)
[0218] (3) Using R language to read CSV file and data preprocessing, code as follows:
[0219] # Import data
[0220] data<-read.csv("sample_data.csv",header=TRUE)
[0221] # View data structure str(data)
[0222] # Ensure data type is correct data$risk_allele_count<-as.numeric(data$risk_allele_count)
[0223] data$weighted_score<-as.numeric(data$weighted_score)
[0224] data$risk_level<-as.numeric(data$risk_level)
[0225] data$aortic_dissection<-as.factor(data$aortic_dissection)
[0226] (4) Risk score calculation
[0227] According to the number of risk alleles and weighted coefficients, calculate the risk score of each sample, code as follows: data$risk_score<-data$risk_allele_count*data$weighted_score
[0228] (5) ROC curve drawing and AUC value calculation
[0229] Use the roc function in the "PredictABEL" package to draw the ROC curve and calculate the AUC value, code as follows:
[0230] # Load necessary packages
[0231] library(pROC)
[0232] # Draw ROC curve
[0233] roc_curve<-roc(data$aortic_dissection,data$risk_score)
[0234] # Calculate AUC value
[0235] auc_value <- auc(roc_curve)
[0236] print(paste("AUC value is:", auc_value))
[0237] # Plot ROC curve
[0238] plot(roc_curve, main = "ROC Curve", col = "blue", lwd = 2)
[0239] legend("bottomright", legend = paste("AUC =", round(auc_value, 3)), col = "blue", lwd = 2)
[0240] (6) Specificity and Sensitivity Analysis
[0241] Extract the optimal cutoff point from the ROC curve and calculate the corresponding specificity and sensitivity, code as follows:
[0242] # Get the optimal cutoff point
[0243] optimal_cutoff <- coords(roc_curve, "best", ret = "threshold")
[0244] # Calculate specificity and sensitivity
[0245] specificity <- coords(roc_curve, optimal_cutoff, ret = "specificity")
[0246] sensitivity <- coords(roc_curve, optimal_cutoff, ret = "sensitivity")
[0247] print(paste("Optimal cutoff point is:", optimal_cutoff))
[0248] print(paste("Specificity is:", specificity))
[0249] print(paste("Sensitivity is:", sensitivity))
[0250] (7) Result Output
[0251] The results of AUC value, specificity, sensitivity, etc. are saved as a text file or directly displayed in R, and the code is as follows:
[0252] results<-data.frame(
[0253] AUC = auc_value,
[0254] Optimal_Cutoff = optimal_cutoff,
[0255] Specificity = specificity,
[0256] Sensitivity = sensitivity )
[0258] write.csv(results,"analysis_results.csv",row.names = FALSE)
[0259] The ROC curve of the prediction method in the present application is shown in Figure 1 The results show that the AUC value of the present application can be as high as 0.912, which reflects very strong prediction performance. The specificity of the prediction model is 90.3%, and the sensitivity is 90.8%, which also shows excellent prediction performance.
[0260] 4. Clinical application example
[0261] Since 2013, the method of the present application has been applied to the risk prediction of young dilated cardiomyopathy in healthy population in the physical examination center of the Second Affiliated Hospital of Anhui Medical University. So far, a total of 3729 healthy individuals have been detected, and they are divided into:
[0262] High risk: 8 cases, of which 3 cases occurred young dilated cardiomyopathy within 10 years, and the incidence rate was 37.5%.
[0263] Medium risk: 36 cases, of which 3 cases occurred young dilated cardiomyopathy within 10 years, and the incidence rate was 8.33%.
[0264] Low risk: 3685 cases, of which 4 cases occurred young dilated cardiomyopathy within 10 years, and the incidence rate was 0.11%.
[0265] The results show that the incidence rate of young dilated cardiomyopathy in high-risk population is significantly higher than that in medium-risk and low-risk population. The method of the present application can effectively predict the risk of young dilated cardiomyopathy, especially the early identification of high-risk individuals, which is of great value and helps to implement targeted prevention measures to reduce the risk of disease.
[0266] It should be noted that the terms "comprising," "including," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but can also include other elements not expressly listed or inherent to such process, method, article, or apparatus. Without additional restrictions, an element preceded by "comprising" does not exclude the existence of additional identical elements in the process, method, article, or apparatus that comprises the element.
[0267] The above-mentioned embodiment numbers of the present application are only for description, not representing the advantages and disadvantages of the embodiments.
[0268] The above embodiments are only used to illustrate the technical solutions of the present application and not limit the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced equivalently without departing from the spirit and scope of the present application, and all of them should be covered in the scope of the claims of the present application.
Claims
1. A SNP site associated with youth-onset dilated cardiomyopathy, characterized in that, The SNP site comprises one or more of numbers 1 to 12, wherein, The SNP site of number 1 is located at 207684579 of chromosome 2, the SNP site allele is C or T, and the risk allele is T; The SNP site of number 2 is located at 197084089 of chromosome 2, the SNP site allele is G or A, and the risk allele is A; The SNP site of number 3 is located at 155532795 of chromosome 5, the SNP site allele is C or T, and the risk allele is T; The SNP site of number 4 is located at 70408568 of chromosome 12, the SNP site allele is C or A, and the risk allele is A; The SNP site of number 5 is located at 96217325 of chromosome 14, the SNP site allele is T or C, and the risk allele is C; The SNP site of number 6 is located at 27418298 of chromosome 9, the SNP site allele is C or T, and the risk allele is T; The SNP site of number 7 is located at 57574238 of chromosome 7, the SNP site allele is C or G, and the risk allele is G; The SNP site of number 8 is located at 94935442 of chromosome 9, the SNP site allele is C or T, and the risk allele is T; The SNP site of number 9 is located at 76453904 of chromosome 7, the SNP site allele is A or G, and the risk allele is G; The SNP site of number 10 is located at 68187651 of chromosome 7, the SNP site allele is G or T, and the risk allele is T; The SNP site of number 11 is located at 81414747 of chromosome 14, the SNP site allele is G or A, and the risk allele is A; The SNP site of number 12 is located at 108676498 of chromosome 12, the SNP site allele is A or C, and the risk allele is C.
2. A PCR amplification primer pair for amplifying the SNP site associated with young dilated cardiomyopathy in claim 1.
3. The PCR amplification primer pair according to claim 2, characterized in that, The primer pair has a nucleotide sequence as shown in SEQ ID NO: 1-24.
4. A product for detecting the risk of developing an idiopathic dilated cardiomyopathy in a young subject, characterized in that: The product comprises the PCR amplification primer pair of claim 2 or 3.
5. The product of claim 4, wherein, The product comprises reagents, kits or SNP chips.
6. Use of the SNP site of claim 1 or the PCR amplification primer pair of any one of claims 2-3 in the preparation of a product for predicting the risk of young dilated cardiomyopathy.
7. A system for predicting the risk of developing a dilated cardiomyopathy in a young adult, characterized in that it comprises: Comprise: Data acquisition module: for acquiring information of the SNP site of claim 1 in the DNA sample of the subject; The data processing module is used for calculating S value according to the information of SNP sites acquired by the data acquisition module, wherein S=n1×X1+n2×X2+n3×X3+n4×X4+n5×X5+n6×X6+n7×X7+n8×X8+n9×X9+n10×X10+n11×X11+n12×X12; wherein n1 to n12 are respectively the number of risk bases of SNP sites numbered 1 to 12, X1 to X12 are respectively the weighted coefficients of SNP sites numbered 1 to 12; X1 to X12 are respectively 0.53, 0.32, 0.42, 0.31, 0.65, 0.73, 0.62, 0.21, 0.31, 0.55, 0.65, 0.
77. 10 10 11 11 12 12 ; wherein n1 to n 12 are respectively the number of risk bases of SNP sites numbered 1 to 12, X1 to X 12 are respectively the weighted coefficients of SNP sites numbered 1 to 12; X1 to X 12 are respectively 0.53, 0.32, 0.42, 0.31, 0.65, 0.73, 0.62, 0.21, 0.31, 0.55, 0.65, 0.77. Data output module: for predicting the risk of young dilated cardiomyopathy according to the S value obtained by the data processing module, wherein when S≤4.4, output as low risk, when S>8.2, output as high risk, when 4.4<S≤8.2, output as moderate risk.
8. The prediction system of claim 7, wherein, The DNA sample of the subject is derived from peripheral venous blood, body fluid or tissue organ.
9. A prediction device for predicting the risk of developing a dilated cardiomyopathy in a young adult, characterized in that it comprises: The prediction device comprises a memory and a processor, the memory has an application program capable of running on the processor stored thereon, and the application program is executed by the processor to implement the prediction method; The prediction method comprises: (1) obtaining information of the SNP sites numbered 1 to 12 related to the youth dilated cardiomyopathy in the DNA sample of the subject according to claim 1; (2) Calculate the S value based on the obtained SNP locus information, where S = n1×X1 + n2×X2 + n3×X3 + n4×X4 + n5×X5 + n6×X6 + n7×X7 + n8×X8 + n9×X9 + n 10 ×X 10 +n 11 ×X 11 +n 12 ×X 12 ; where n1 to n 12 These represent the number of risky bases at SNP sites numbered 1 to 12, X1 to X... 12 These are the weighting coefficients for SNP sites numbered 1 to 12; X1 to X 12 The values are 0.53, 0.32, 0.42, 0.31, 0.65, 0.73, 0.62, 0.21, 0.31, 0.55, 0.65, and 0.77, respectively. (3) predicting the youth dilated cardiomyopathy risk according to the obtained S value, wherein when the S value is ≤4.4, the output is low risk, when the S value is >8.2, the output is high risk, and when 4.4<S≤8.2, the output is moderate risk.
10. A computer-readable storage medium, characterized in that, The computer readable storage medium has a computer program stored thereon, and the computer program is executed by the processor to implement the steps of the method according to claim 9.