Novel miRNA target for treating AIDS infection and cervical cancer and application of novel miRNA target

Abstract

The invention provides a novel miRNA target for treating AIDS (acquired immune deficiency syndrome) infection and cervical cancer and application of the novel miRNA target. The miRNA comprises miR-H1 (micro Ribonucleic Acid), miR-TAR (micro Ribonucleic Acid) and miR-N367, and is called HIV1-miRNAs for short. The HIV1-miRNAs exist in a cervical cancer patient suffering from HIV (Human Immunodeficiency Virus) infection. The HIV1-miRNAs can participate in the occurrence and development process of HIV combined cervical cancer by regulating and controlling tumor key pathways such as cell proliferation and inflammation in cervical cancer cells. The invention also provides regulatory molecules (including antisense nucleotides) for targeted regulation. The invention provides a new diagnosis and treatment way for clinical treatment and detection of HIV combined cervical cancer.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological medicine, and more particularly, the present application relates to a new miRNA target for the treatment of AIDS infection combined with cervical cancer and its application. BACKGROUND

[0002] AIDS is a global public health problem, and its combination with malignant tumors makes the treatment of patients even more difficult. Among human immunodeficiency virus (HIV) female infected persons, cervical cancer is the most common cancer. Cervical cancer is one of the four major malignant tumors of women in the world, with more than 500,000 new cases and 300,000 deaths each year (PMID: 33538338), mainly due to human papillomavirus (HPV) infection. HIV-infected women have a 6-fold higher risk of developing cervical cancer than the general population (PMID: 33212031). For HIV-infected women who do not receive treatment, their cervical cancer develops at least twice as fast as other women (PMID: 24216030). Therefore, HIV infection exacerbates the risk of cervical cancer caused by HPV infection.

[0003] In fact, when HIV-negative women develop early cervical intraepithelial neoplasia (CIN), the vast majority of such lesions will spontaneously regress without treatment (PMID: 17471427). For HIV-infected women, due to the reduced function of the immune system, their ability to clear HPV is weakened, leading to an increased likelihood of persistent HPV infection, progression to higher-grade precancerous lesions of the cervix, and even cervical cancer (PMID: 11810079). For HIV-infected women, eliminating HPV is usually not an achievable goal, and treatment management strategies should focus on controlling cancer (PMID: 15784870), but the clinical treatment of cervical cancer in HIV-infected women faces great challenges. On the one hand, high-efficiency antiretroviral therapy can interact with traditional cancer drugs, especially the liver CYP3A4 enzyme system, affecting drug efficacy and safety. For example, many targeted therapy drugs, such as tyrosine kinase inhibitors and mTOR inhibitors, need to be metabolized by CYP3A4 enzymes (PMID: 19606034). If these drugs are used at the same time as HAART drugs, their blood concentrations can be increased due to the inhibition of CYP3A4 enzymes by HAART drugs, increasing the risk of toxicity. On the other hand, HIV-infected persons may have a more difficult time coping with side effects when receiving intensive chemotherapy and radiotherapy due to their compromised immune systems. Therefore, it is urgent to explore the pathogenesis of HIV-infected patients with cervical cancer and find new drug targets for the treatment of such patients.

[0004] It has been reported that virus-derived miRNAs can promote the development of tumors. For example, Epstein-Barr virus-derived miRNAs can change the expression levels of tumor cell genes, leading to tumor immune escape and exacerbating tumor progression (PMID: 33956915). However, there are few studies on HIV-derived miRNAs, and their role and mechanism in cervical cancer are not clear. SUMMARY

[0005] The present application aims to provide a new miRNA target for the treatment of HIV infection combined with cervical cancer and its application.

[0006] In the first aspect of the present application, the use of miRNA or its precursor for preparing an inhibitor of cervical cancer is provided; the miRNA includes a nucleotide sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4; the cervical cancer is HIV combined cervical cancer.

[0007] In one or more embodiments, the miRNA is a human immunodeficiency virus (HIV)-derived miRNA, and the miRNAs exist in HIV-infected cervical cancer patients.

[0008] In one or more embodiments, the miRNA as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 is used to prepare an inhibitor of cervical cancer, respectively.

[0009] In one or more embodiments, two or more of the miRNAs as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 are combined to prepare an inhibitor of cervical cancer.

[0010] In one or more embodiments, the up-regulated genes of the miRNA are significantly enriched in tumor key pathways such as cell proliferation and inflammation.

[0011] In one or more embodiments, the miRNA activates the expression of oncogenes; more preferably, the oncogenes include (but are not limited to): ITGB5, STX5 and GLI2, etc.

[0012] In one or more embodiments, the nucleotide sequence of the miRNA precursor is as shown in SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7.

[0013] In one or more embodiments, the inhibitor targets the miRNA or its precursor, interfering with or inhibiting the function of the miRNA (e.g., at the DNA level), its transcript (e.g., at the RNA level), or its translation product (e.g., at the protein level).

[0014] In one or more embodiments, the inhibitor includes (but is not limited to): antisense nucleotides (ASO), interfering molecules (such as siRNA, shRNA, dsRNA, etc.), gene editing reagents (such as sgRNA, etc.), or constructs that can express or form said antisense nucleotides, interfering molecules, or gene editing reagents.

[0015] In another aspect of the present invention, a method for preparing an inhibitor of HIV combined with cervical cancer is provided, comprising:

[0016] (1) Provide the miRNA or its precursor;

[0017] (2) Design specific inhibitors for the miRNA or its precursor in (1), said inhibitors interfering with or inhibiting the function of the miRNA or its precursor, its transcript or its translation product.

[0018] In one or more embodiments, the inhibitor includes (but is not limited to): antisense nucleotides (ASO), interfering molecules (such as siRNA, shRNA, dsRNA, etc.), gene editing reagents (such as sgRNA, etc.), or constructs that can express or form said antisense nucleotides, interfering molecules, or gene editing reagents.

[0019] In one or more embodiments, a set (for one miRNA or its precursor) or multiple sets (for multiple miRNAs or their precursors) of inhibitors are prepared for the miRNA or its precursor.

[0020] In one or more embodiments, the inhibitor comprises a modified or unmodified nucleic acid reagent. The modification is performed, for example, by means of nucleic acid backbone modification techniques, and the modification does not substantially alter the binding properties of the oligonucleotide molecule; preferably, modifications that improve the stability of the nucleic acid molecule. For example, the modification is dU modification, thiomodification, or alkyl modification at the 2' position of the ribose.

[0021] In another aspect of the invention, an inhibitor for HIV co-occurring cervical cancer is provided, which inhibits a miRNA or its precursor, said miRNA as defined above; said inhibitor interferes with or inhibits the function of said miRNA, its transcript or its translation product.

[0022] In one or more embodiments, the inhibitor is an antisense nucleotide with a nucleotide sequence as shown in SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10.

[0023] In one or more embodiments, the miRNA or its precursor comprises a homologous miRNA or its precursor, particularly a miRNA having more than 80%, 85%, 90%, 92%, 95%, 96%, 98%, 99%, 99.5%, or 99.8% sequence identity with the miRNA having the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4; or a precursor having more than 80%, 85%, 90%, 92%, 95%, 96%, 98%, 99%, 99.5%, or 99.8% sequence identity with the miRNA precursor having the nucleotide sequence shown in SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7.

[0024] In another aspect of the invention, the use of the said inhibitor in the preparation of compositions for inhibiting HIV combined with cervical cancer is provided.

[0025] In one or more embodiments, the inhibitor inhibits the proliferation of cancer cells or inhibits the migration / metastasis of cancer cells.

[0026] In one or more embodiments, the inhibitor inhibits the expression of oncogenes; more preferably, the oncogenes include (but are not limited to): ITGB5, STX5, and GLI2.

[0027] In another aspect of the invention, a composition, kit, or reagent kit for inhibiting HIV-associated cervical cancer is provided, wherein the composition comprises the inhibitor described above; and the kit or reagent kit comprises the composition described above.

[0028] In another aspect of the invention, the use of the miRNA or its precursor is provided for the preparation of a diagnostic reagent or kit for detecting HIV combined with cervical cancer.

[0029] In another aspect of the invention, the use of a detection reagent that specifically identifies or amplifies the miRNA or its precursor is provided for the preparation of a kit for detecting HIV combined with cervical cancer.

[0030] In one or more embodiments, the detection reagent includes (but is not limited to): primers that specifically amplify the miRNA or its precursor, probes that specifically recognize the miRNA or its precursor, and chips that specifically recognize the miRNA or its precursor.

[0031] In another aspect of the present invention, a method for preparing a detection reagent for detecting HIV combined with cervical cancer is provided, comprising: using the miRNA or its precursor as the target, preparing a reagent that specifically recognizes or amplifies the miRNA or its precursor.

[0032] In one or more embodiments, the detection reagent includes (but is not limited to): primers that specifically amplify the miRNA or its precursor, probes that specifically recognize the miRNA or its precursor, and chips that specifically recognize the miRNA or its precursor.

[0033] In another aspect of the present invention, a method for diagnosing cervical cancer is provided, comprising: using a detection reagent or kit that specifically recognizes or amplifies miRNA or its precursor to detect the amount of miRNA or its precursor in an ex vivo sample (such as disease in situ tissue or body fluid tissue (blood or serum, etc.) of a subject.

[0034] In one or more embodiments, the method includes: extracting total RNA from a sample, reversing it into cDNA, performing fluorescent PCR amplification, and qualitatively or quantitatively analyzing the amplification products.

[0035] In one or more embodiments, the method includes: extracting total RNA from a sample, reversing it into cDNA, synthesizing and labeling cRNA, hybridizing, washing, scanning, and signal analysis.

[0036] Other aspects of the invention will be apparent to those skilled in the art from the disclosure herein. Attached Figure Description

[0037] Figure 1 A. Analysis of GFP-positive cells in miR-H1 / TAR / N367 and control group cells.

[0038] Figure 1 Changes in the expression levels of BD, miR-H1, miR-TAR, and miR-N367 were measured, with an empty vector lentivirus as a control.

[0039] Figure 2 A. After overexpressing HIV1-miRNAs in HeLa cells, CCK8 assays were performed to analyze the OD values ​​of the cells.

[0040] Figure 2 After overexpressing HIV1-miRNAs in BC and HeLa cells, a clonogenic assay was performed to analyze the clonogenic ability of HeLa cells.

[0041] Figure 3After overexpressing HIV1-miRNAs in AB and HeLa cells, Transwell assays were performed to analyze the number of migrating cells.

[0042] Figure 4 RNA was extracted from HeLa cells overexpressing miR-H1, followed by transcriptome sequencing to analyze the enrichment of upregulated genes.

[0043] Figure 5 RNA was extracted from HeLa cells overexpressing miR-TAR, followed by transcriptome sequencing to analyze the enrichment of upregulated genes.

[0044] Figure 6 RNA was extracted from HeLa cells overexpressing miR-N367, followed by transcriptome sequencing to analyze the enrichment of upregulated genes.

[0045] Figure 7 After overexpressing HIV1-miRNAs in AC and HeLa cells, transcriptome sequencing data were validated by RT-qPCR to analyze the types of activated genes.

[0046] Figure 8 AC, different inhibitors were transfected into HeLa cell lines that stably expressed the corresponding HIV1-miRNAs, and cell proliferation was analyzed.

[0047] Figure 8 D. Analysis of clonogenic capacity in HeLa stable transfected with miR-TARInhibitors.

[0048] Figure 9 AC used Transwell assays to evaluate the effect of inhibitors treatment on the migration ability of HeLa cells.

[0049] Figure 10 AC, HeLa cells transfected with Inhibitors were collected and RNA was extracted. Partially activated oncogenes and inflammatory genes were detected by RT-qPCR.

[0050] Figure 11 For the obtained RNA extraction samples, the expression of HIV-miR-H1 was detected by RT-qPCR.

[0051] Figure 12 A. Compare the differences in miR-H1 expression between the normal group and the cervical cancer group to analyze the potential of miR-H1 in differentiating cervical cancer.

[0052] Figure 12 B. ROC curve analysis of miR-H1 was used to differentiate cervical cancer from normal cells, demonstrating its sensitivity and specificity. Detailed Implementation

[0053] This invention, based on in-depth research and screening, and focusing on the major globally prevalent HIV-1 (human immunodeficiency virus type 1) strain, reveals small nucleic acid drug targets for HIV-associated cervical cancer. These small nucleic acid drugs include miR-H1, miR-TAR, and miR-N367 (referred to as HIV1-miRNAs or miRNAs). These miRNAs are present in HIV-infected cervical cancer patients. These HIV1-miRNAs participate in the development and progression of HIV-associated cervical cancer by regulating key tumor pathways such as cell proliferation and inflammation in cervical cancer cells. These HIV1-miRNAs can be used as novel targets for the treatment of cervical cancer. This invention also provides regulatory molecules for targeted regulation. This invention provides a new diagnostic and treatment approach for the clinical treatment and detection of HIV-associated cervical cancer.

[0054] HIV1-miRNAs

[0055] In this invention, an HIV1-miRNA expression system was constructed, and cervical cancer cells were infected to establish a stable cell line expressing HIV1-miRNAs, simulating the clinical state of HIV infection combined with cervical cancer. It was subsequently found that overexpression of HIV1-miRNAs promoted the proliferation and migration of cervical cancer cells. Consistent with this, transcriptome sequencing results showed that HIV1-miRNAs could alter gene expression levels in cervical cancer cells, with differentially expressed genes significantly enriched in tumor-related signaling pathways such as cell division, cell cycle, and cell migration, suggesting a potential pro-cancer effect of HIV1-miRNAs. Antisense nucleic acids designed targeting these HIV1-miRNAs significantly inhibited the proliferation and migration induced by HIV1-miRNA overexpression. RT-qPCR showed that inhibitors could suppress the expression of tumor-related genes by reducing HIV1-miRNA expression. Therefore, HIV1-miRNAs can promote the development and progression of cervical cancer, and small nucleic acid drugs designed targeting them can block their function, thereby inhibiting the growth and metastasis of cervical cancer.

[0056] Therefore, HIV miRNAs (HIV1-miRNAs) are important pathogenic substances for cervical cancer. Targeting and inhibiting their function can be applied to the treatment of cervical cancer, and can also be used for the clinical diagnosis or evaluation of cervical cancer.

[0057] The HIV1-miRNAs described in this invention include miRNAs with nucleotide sequences such as those shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4.

[0058] The HIV1-miRNA precursors of the present invention include precursors with nucleotide sequences as shown in SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:7.

[0059] The present invention may also include miRNAs, fragments of miRNAs, or variants of miRNAs homologous to the said sequence. For example, if the said sequence contains some variants that do not cause changes to the key pathogenicity of the miRNA (such as nonsense variants), resulting in fewer differences in the target sequence, miRNAs with such variants may also be included in the present invention. For example, the miRNA or its precursor includes homologous miRNAs or their precursors, particularly miRNAs having more than 80%, 85%, 90%, 92%, 95%, 96%, 98%, 99%, 99.5%, or 99.8% sequence identity compared to miRNAs with the nucleotide sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4; or precursors having more than 80%, 85%, 90%, 92%, 95%, 96%, 98%, 99%, 99.5%, or 99.8% sequence identity compared to miRNA precursors with the nucleotide sequences shown in SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7. Fragments from the above-mentioned miRNAs or their homologs can also be used in this invention.

[0060] The present invention also provides a composition (including a pharmaceutical combination) containing an effective amount of an inhibitor of the aforementioned HIV1-miRNAs, and a pharmaceutically or physiologically acceptable carrier. The composition is used to inhibit cervical cancer.

[0061] In a preferred embodiment of the present invention, the inhibitor includes, but is not limited to: nucleic acid inhibitors (preferably antisense nucleotides, but may also include siRNA, etc.), agents for knocking out or silencing HIV1-miRNAs, small chemical molecule antagonists or inhibitors targeting HIV1-miRNAs, etc. In a more specific embodiment, the inhibitor includes, but is not limited to: CRISPR gene-editing agents targeting HIV1-miRNAs, interfering molecules that specifically interfere with the expression of genes encoding HIV1-miRNAs, homologous recombination agents or site-directed mutagenesis agents targeting HIV1-miRNAs, wherein the homologous recombination agents or site-directed mutagenesis agents induce loss-of-function mutations in HIV1-miRNAs.

[0062] As used herein, "effective amount" means an amount that is functional or active in humans and / or animals and is acceptable to humans and / or animals. "Pharmaceutically acceptable carrier" refers to a carrier used for the administration of a therapeutic agent, including various excipients and diluents. This term refers to pharmaceutical carriers that are not essential active ingredients themselves and do not cause excessive toxicity after administration. Suitable carriers are well known to those skilled in the art. Pharmaceutically acceptable carriers in a composition may contain liquids such as water, saline, or buffer solutions. Additionally, these carriers may contain auxiliary substances such as fillers, lubricants, flow aids, wetting agents or emulsifiers, pH buffers, etc. The carriers may also contain cell transfection reagents.

[0063] Once the use of the inhibitors of the HIV1-miRNAs is known, a variety of methods well known in the art can be used to administer the inhibitors or their encoding genes, or pharmaceutical compositions thereof, to mammals or humans.

[0064] Preferably, gene therapy can be used. For example, the inhibitor of HIV1-miRNAs can be directly administered to the subject by means such as injection; or, the expression unit (such as an expression vector or virus, or siRNA) carrying the inhibitor of HIV1-miRNAs can be delivered to the target site through a certain route, and the active HIV1-miRNAs inhibitor can be expressed therein. The specific circumstances depend on the type of inhibitor, all of which are well known to those skilled in the art.

[0065] The effective amount of the HIV1-miRNA inhibitor described in this invention can be determined by those skilled in the art based on various factors (e.g., through clinical trials). These factors include, but are not limited to: the pharmacokinetic parameters of the HIV1-miRNA inhibitor, such as bioavailability, metabolism, and half-life; the severity of the disease to be treated, the patient's weight, the patient's immune status, and the route of administration.

[0066] In specific embodiments of the present invention, some dosing regimens for animals such as mice are provided. Converting animal dosages (e.g., mouse) to human dosages is readily achievable by those skilled in the art, for example, using the Meeh-Rubner formula. It should be understood that dosage conversions may vary depending on the drug and clinical circumstances, and may be subject to assessment by an experienced pharmacist.

[0067] The present invention also provides a kit containing the aforementioned pharmaceutical composition or an inhibitor directly containing the aforementioned HIV1-miRNAs. Furthermore, the kit may also include instructions on how to use the medication contained therein.

[0068] Downregulated molecules of HIV1-miRNAs and their applications

[0069] Based on the inventors' new discovery, the use of inhibitors of HIV1-miRNAs is provided for the preparation of compositions (including pharmaceutical compositions) that inhibit cervical cancer.

[0070] As used herein, the inhibitors of HIV1-miRNAs include blockers, antagonists, downregulators, etc., and these terms are used interchangeably.

[0071] The inhibitors of HIV1-miRNAs include: regulatory molecules / regulatory agents that can reduce the stability of HIV1-miRNAs, reduce the expression of HIV1-miRNAs, and inhibit the transcription / translation of HIV1-miRNAs. These regulatory molecules / regulatory agents can all be used in this invention as substances useful for targeting and inhibiting HIV1-miRNAs, thereby being used to inhibit cervical cancer.

[0072] As a preferred approach, the inhibitor is a nucleic acid inhibitor. For example, the inhibitor includes: interfering RNA molecules or antisense nucleotides (including locked nucleic acids and antisense nucleic acids) that specifically interfere with the expression of HIV1-miRNAs.

[0073] As a preferred approach, HIV1-miRNA expression is modulated using antisense compounds that specifically hybridize with one or more nucleic acids encoding HIV1-miRNAs. The specific hybridization of oligomers with their target nucleic acids interferes with the normal function of the nucleic acids. This modulation of target nucleic acid function by compounds that specifically hybridize with the target nucleic acid is commonly referred to as "antisense."

[0074] Preferably, the antisense compound is an antisense nucleotide. As used herein, "antisense nucleotide" is also known as "antisense nucleic acid" or "antisense oligonucleotide (AS-ONs)" or "antisense drug," referring to DNA molecules, RNA molecules, their modified forms, or their analogues that are approximately 15-30 bases in length and can complement non-coding RNAs such as mRNA or miRNA.

[0075] The miRNAs or their precursors, or their antisense nucleotides, provided according to the present invention can be appropriately modified while retaining their activity, and these modifications are all usable in the present invention. A variety of antisense nucleotides capable of inhibiting or silencing the HIV1-miRNAs are usable in the present invention, and their type is not limited to DNA or RNA. For example, the antisense nucleotides of the HIV1-miRNAs are sequences substantially (preferably completely) complementary to the sequences of the HIV1-miRNAs. For example, the sequences of the antisense nucleotides, such as those shown in SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10 (or their complementary sequences), have more than 80% identity, preferably more than 85% identity, more preferably more than 90% identity, more preferably more than 95% identity, such as more than 96%, 97%, 98%, or 99% identity; they have the same function as the antisense nucleotides listed in the embodiments of the present invention.

[0076] Existing technologies have indicated that certain variations of antisense nucleotides are desirable and can exert inhibitory effects on corresponding target sequences. For example, the literature review "Design and delivery of antisense oligonucleotides to block microRNA function in cultured Drosophila and human cells" (NATUREPROTOCOLS; VOL.3 NO.10; 2008; 1537-1549) summarizes several studies, suggesting that generally, extending some bases on both sides of the antisense nucleotide is acceptable. Furthermore, when the affinity between the antisense nucleotide and miRNA is high (e.g., locked nucleic acid modification), the antisense nucleotide can be truncated to approximately 2 / 3 of its length.

[0077] As an alternative approach, homologous recombination can be used to specifically target HIV1 miRNAs, causing defective or absent expression. For example, Cre and Loxp methods can be used to selectively knock out, reduce, or inactivate relevant genes in the genome of animals or cells.

[0078] As an alternative approach, targeted gene editing using a CRISPR / Cas (e.g., Cas9) system can be employed to downregulate (including knock out) HIV1-miRNAs. Common methods for downregulating HIV1-miRNAs include co-transferring sgRNA or nucleic acids capable of forming said sgRNA, Cas mRNA or nucleic acids capable of forming said Cas mRNA, to the target region or target cells. After identifying the target site, known methods can be used to introduce sgRNA and Cas into the cells. The nucleic acid capable of forming said sgRNA is a nucleic acid construct or expression vector, or the nucleic acid capable of forming said Cas9 mRNA is a nucleic acid construct or expression vector. These expression vectors are introduced into the cells, thereby forming active sgRNA and Cas9 enzymes within the cells.

[0079] As another preferred approach, the inhibitor can be an HIV1-miRNA-specific interfering RNA molecule (such as siRNA, shRNA, miRNA, etc.). Those skilled in the art will understand that such interfering RNA molecules can be prepared using the HIV1-miRNA sequence information provided in this invention.

[0080] As another preferred approach, RNAi is used to suppress HIV1-miRNAs. RNAi is an evolutionarily conserved cellular defense mechanism used to control the expression of exogenous genes in most eukaryotes, including humans. RNAi is typically triggered by double-stranded RNA and causes sequence-specific mRNA degradation of single-stranded target RNA.

[0081] As another preferred approach, shRNA technology is used for interference. shRNA is an RNA sequence that can rotate a tight hairpin, which can be used to silence gene expression through RNA interference. shRNA is introduced into cells using a vector and its expression is driven by a promoter. This vector is typically delivered to daughter cells, allowing gene silencing to be inherited. The shRNA hairpin structure is cleaved into siRNA by cellular mechanisms and then binds to the RNA-induced silencing complex (RISC).

[0082] In this invention, various nucleic acid inhibitors (such as antisense nucleotides) also include modified forms, wherein the modifications substantially do not alter the activity of the nucleic acid inhibitor, and more preferably, the modifications can improve the activity, stability, or therapeutic effect of the nucleic acid inhibitor. Modifications to nucleic acid inhibitors include, but are not limited to: methoxylation modifications, thiolation modifications, cholesterol modifications, alkyl modifications, locked nucleic acid modifications, peptide nucleic acid modifications, and / or nucleic acid inhibitors in which the phosphate backbone is replaced by phospholipid linkages.

[0083] As another preferred approach, the inhibitor is a small molecule compound targeting HIV1-miRNAs. Those skilled in the art can use methods suitable for screening small molecule compounds to perform this screening. The screening can rely on various existing or future compound libraries in the art, or new compound libraries can be established independently.

[0084] The above are some representative methods for downregulating HIV1-miRNAs. After those skilled in the art understand the overall scheme of the present invention, other methods known in the art or methods under development can also be used to regulate HIV1-miRNAs, and these methods are also included in the present invention.

[0085] Particularly preferred, according to the analysis results of the embodiments of the present invention, the antisense nucleotides designed for the HIV1-miRNAs described in the present invention exert a significant inhibitory effect on cervical cancer not only at the cellular level but also at the animal level.

[0086] Cervical cancer detection

[0087] Based on the inventors' new discovery, HIV1-miRNAs or their precursors can be used as biomarkers for cervical cancer detection. By analyzing the presence of HIV1-miRNAs or their precursors in the test sample, the subject's disease status can be determined, providing a basis for disease diagnosis or prognosis. In a preferred embodiment, the test sample is a patient's tissue sample or body fluid.

[0088] This invention can determine gene expression using any method known in the art. Those skilled in the art will understand that the means of determining gene expression are not a key aspect of this invention. The expression level of biomarkers can be detected at the transcriptional level.

[0089] In some embodiments, the levels of HIV1-miRNAs or their precursors are detected at the transcriptional level. Various methods for specific DNA and RNA measurements using nucleic acid hybridization techniques are known to those skilled in the art. Some methods involve electrophoretic separation (e.g., Southern blotting for DNA detection and Northern blotting for RNA detection), but DNA and RNA measurements can also be performed without electrophoretic separation (e.g., by dot blotting). Southern blotting of genomic DNA (e.g., from humans) can be used to screen for restriction fragment length polymorphisms (RFLPs) to detect the presence of genetic conditions affecting the polypeptides of the present invention. All forms of RNA can be detected.

[0090] Various techniques in the art can be used to detect the expression of HIV1-miRNAs, and these techniques are all included in this invention. Existing techniques that can be used to detect nucleic acids include (but are not limited to): gene chip technology, probe hybridization technology, polymerase chain reaction (PCR), Northern blotting, etc.

[0091] This invention provides reagents for specifically recognizing or amplifying HIV1-miRNAs. Any reagent capable of recognizing HIV1-miRNAs is included in this invention. These reagents for specifically recognizing HIV1-miRNAs include, but are not limited to, primers for specifically amplifying HIV1-miRNAs or probes for specific recognition.

[0092] The reagents that specifically recognize HIV1-miRNAs can also be immobilized on test strips, glass slides, or other solid-phase carriers to prepare immunogold test strips or similar detection materials.

[0093] As one option of this invention, the expression status and level of HIV1-miRNAs in a sample are analyzed by quantitative or semi-quantitative polymerase chain reaction (PCR) to make a judgment. Preferably, detection is achieved by real-time quantitative PCR. The reagents used are primers that specifically amplify HIV1-miRNAs. After knowing the nucleotide sequence of HIV1-miRNAs, primers can be designed based on this sequence.

[0094] As an alternative approach to this invention, gene chip technology can be used for the detection of HIV1-miRNAs. Once the nucleotide sequences of HIV1-miRNAs are known, probes can be easily designed based on them. For example, if the solid-phase support is a modified glass slide or silicon wafer, and the 5' end of the probe contains an amino-modified polydT string, the oligonucleotide probe can be prepared into a solution, then spotted onto the modified glass slide or silicon wafer using a spotting instrument, arranged into a predetermined sequence or array, and then fixed by incubation overnight to obtain the gene chip of this invention. If the oligonucleotide probe does not contain amino modification, its preparation method can also refer to existing known techniques.

[0095] Specifically, suitable probes can be designed using the HIV1-miRNAs described in this invention and immobilized on a solid-phase support to form an "oligonucleotide array." The "oligonucleotide array" refers to an array with addressable sites (i.e., sites characterized by distinctive, accessible addresses), each addressable site containing a characteristic oligonucleotide linked to it. The oligonucleotide array can be divided into multiple subarrays as needed. The solid-phase support may include plastic products, microparticles, membrane carriers, etc.

[0096] The present invention also provides a kit for detecting cervical cancer, the kit comprising: a reagent that specifically recognizes HIV1-miRNAs, or a carrier loaded with said reagent. The reagent that specifically recognizes HIV1-miRNAs is, for example, primers that specifically amplify HIV1-miRNAs, probes that specifically recognize HIV1-miRNAs, or a chip that specifically recognizes HIV1-miRNAs.

[0097] The kit may also contain markers for labeling samples, and corresponding substrates. Furthermore, the kit may contain auxiliary reagents: nucleic acid extraction reagents (such as nucleic acid extraction buffer, phenol, chloroform, isoamyl alcohol, NaCl, etc.); and / or polymerase chain reaction reagents (such as dNTPs, Taq enzyme, PCR buffer, DNA polymerase, etc.); and / or enzyme chain immunoassay reagents (such as chromogenic solutions or hybridization solutions, etc.).

[0098] In addition, the kit also includes an instruction manual and / or chip image analysis software.

[0099] Currently, there are no effective targeted therapies for HIV-positive cervical cancer. This invention identifies HIV-derived miRNAs that can promote the development and progression of cervical cancer, which will contribute to the development of targeted small nucleic acid drugs to improve the quality of life for cervical cancer patients and reduce their psychological and economic burden during treatment.

[0100] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Science Press, or according to the manufacturer's recommendations.

[0101] Materials and methods

[0102] Main experimental reagents

[0103] DMEM medium, fetal bovine serum, PBS buffer, penicillin-streptomycin solution, 0.25% trypsin, plasmid extraction kit, plasmid transfection reagent, one-step RNA extraction kit, reverse transcription kit, quantitative real-time assay kit, CCK8 kit.

[0104] Main instrument consumables

[0105] Cell culture incubators, cell counters, fluorescence microscopes, clean benches, quantitative PCR instruments, cell culture dishes / plates, cell culture chambers, pipettes and pipette tips, EP tubes, quantitative PCR plates and sealing films, etc.

[0106] Experimental cells

[0107] Human embryonic kidney cells (HEK293T cells);

[0108] Human cervical cancer cells (HeLa cells).

[0109] Cell culture and passage

[0110] When the cell density reaches 85% or higher, wash the cells with PBS solution, add 0.25% trypsin for digestion, add complete culture medium to stop digestion, centrifuge at room temperature for 5 min, discard the supernatant, add 1 mL of complete culture medium to resuspend the cells, and passage or seed them in appropriate well plates according to different cell growth characteristics. After shaking well, place them in a 37℃, 5% CO2 incubator for culture.

[0111] Lentiviral Packaging and Infection

[0112] HEK293T cells in logarithmic growth phase were seeded at 1.5 million cells / well in 6-well plates. The following day, when the cell density reached approximately 80%, lentiviral packaging plasmids were transfected. After 6 hours, the medium was replaced with fresh complete medium, and the cells were cultured until the appropriate time was reached. The supernatant containing the lentiviral medium was collected, filtered through a 0.22 μm filter, and stored at 4°C for later use. HeLa cells were seeded into 6-well plates, and 500 μL of lentiviral solution was added for infection. Subsequent experiments were performed when the cell positivity rate exceeded 90%, and stable transgenic lines were selected. RNA was extracted from the cells for RT-qPCR and transcriptome sequencing.

[0113] Real-time PCR

[0114] Lentivirally infected cells were collected, RNA was extracted using the Novizan reagent kit, and then reverse transcribed into cDNA using the Tiangen one-step reverse transcription method. Finally, quantitative PCR was performed using SYBR Green reagent. GAPDH was used as an internal control gene, and 2... -ΔΔCt The method calculates the relative gene expression level.

[0115] CCK8 Experiment

[0116] Seed 2000 cells per well of cells stably expressing HIV1-miRNAs into 96-well plates. On the day of plating (D0), the second day (D1), the third day (D2), and the fourth day (D3), CCK8 reagent was added to make a working concentration of 10%. After adding CCK8, the plates were incubated in an incubator for 3 hours and the absorbance at OD450 was measured using a microplate reader.

[0117] Transwell experiment

[0118] The chambers were placed in a 24-well plate, 500 μL of 20% DMEM medium was added to the bottom, and 80,000 cervical cancer cells resuspended in serum-free medium were added to the top. The plates were incubated for 48 hours, fixed and stained with formaldehyde and crystal violet, and observed and photographed under a microscope. Five fields of view were randomly selected to record the migration of cervical cancer cells.

[0119] Cell colony formation experiment

[0120] 500 cervical cancer cells per well were seeded into a six-well plate and cultured continuously until a visible cell colony appeared. The cells were then fixed with 4% formaldehyde for 20 min, stained with 0.5% crystal violet for 20 min, thoroughly washed with PBS or miniQ to remove excess stain, and air-dried before photographing and recording.

[0121] Inhibitor treatment experiment

[0122] A biotechnology company was commissioned to synthesize inhibitors targeting HIV1-miRNAs, while a small, meaningless nucleic acid (NC) was synthesized as a negative control. A 20 μmol solution was prepared using RNase-free H2O. Cervical cancer cells stably expressing HIV1-miRNAs were seeded in six-well plates, and the NC and HIV1-miRNA inhibitors were transfected into the cells using transfection reagents. Forty-eight hours post-transfection, RNA was extracted to detect gene expression, and cell function experiments were performed to evaluate the effectiveness of the inhibitors.

[0123] Example 1: Obtaining HIV1-miRNAs

[0124] The inventors focused on analyzing the influencing factors in the clinical incidence and progression of cervical cancer, and paid attention to three miRNAs (HIV1-miRNAs) associated with the major globally circulating HIV-1 strain, namely miR-H1, miR-TAR, and miR-N367, whose mature sequence structures are as follows:

[0125] miR-H1: CCAGGGAGGCGUGCCUGGGC (SEQ ID NO: 1);

[0126] miR-TAR-5p: UCUCUCUGGUUAGACCAGAUCUGA (SEQ ID NO: 2);

[0127] miR-TAR-3p:UCUCUGGCUAACUAGGGAACCCA (SEQ ID NO:3);

[0128] miR-N367: ACUGACCUUUGGAUGGUGCUUCAA (SEQ ID NO: 4).

[0129] The inventors used molecular cloning to clone the HIV precursor sequences they contained into the pCDH vector. The specific sequences are as follows:

[0130] Pri-miR-H1 (SEQ ID NO:5):

[0131] CTGACACCTTCTGTGAAGACTGCTGACACCGAGCTTTCTACAAGGGACTTTCC

[0132] GCTGGGGACTTT CCAGGGAGGCGTGCCTGGGC GGGACTGGGGAGTGGCTA

[0133] ACCCTCAGATGCTGCATATAAGCAGCTGCTCTTTGCCTGTACTGGGT

[0134] Pri-miR-TAR (SEQ ID NO:6):

[0135] GGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTA GGGAACCCA CTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTC

[0136] Pri-miR-N367 (SEQ ID NO:7):

[0137] CTTGATTTGTGGGTCCACCACACACAAGGCTACTTCCCTGATTGGCAGAATTA

[0138] CACACCAGGGCCAGGGATCAGATATCCACTGACCTTTGGATGGTGCTTCAA

[0139] GCTAGTACCAGTAGAGCCAGAGCAGGTAGAAGAGGCCACTGAAGGAG

[0140] Example 2: Establishment of a cervical cancer cell line expressing HIV1-miRNAs

[0141] Lentiviral vectors containing HIV1-miRNAs were prepared and used to infect cervical cancer HeLa cells, with an empty vector lentivirus serving as a control group. Figure 1The number of GFP-positive cells in A, miR-H1 / TAR / N367 and the control group cells was close to 100%, and the cells were in good growth condition.

[0142] Simultaneously, some cells were collected and RNA was extracted. The expression of miRNAs was detected by RT-qPCR. Figure 1 Compared with the control group (empty vector lentivirus), the expression levels of miR-H1, miR-TAR and miR-N367 increased by 9.57-fold, 106.18-fold and 374.02-fold, respectively.

[0143] Therefore, HeLa cell lines expressing different HIV1-miRNAs were constructed and used in subsequent experiments.

[0144] Overexpressing HIV-miRNAs in cervical cancer cells is equivalent to simulating the clinical state of HIV infection combined with cervical cancer.

[0145] Example 3: HIV1-miRNAs promote the proliferation and migration of cervical cancer cells.

[0146] To further determine the effects of HIV1-miRNAs on cervical cancer cells, CCK8, colony formation, and Transwell assays were performed.

[0147] 1. CCK8 Experiment

[0148] like Figure 2 A. Compared with the control group, HeLa cells overexpressing miR-H1, miR-TAR and miR-N367 showed a significant increase in OD values, suggesting that overexpression of these HIV1-miRNAs can promote cervical cancer proliferation.

[0149] 2. Cloning experiment

[0150] Consistent with this, overexpression of miR-H1, miR-TAR, and miR-N367 enhanced the clonogenic ability of HeLa. Figure 2 (BC) suggests that the HIV1-miRNAs can promote cervical cancer growth.

[0151] 3. Transwell experiment

[0152] like Figure 3 A. Compared with the control group, overexpression of miR-H1, miR-TAR, and miR-N367 significantly increased the number of migrating cells, and the difference was statistically significant. Figure 3 B) suggests that the HIV1-miRNAs can promote cervical cancer migration.

[0153] Therefore, HIV1-miRNAs can promote the proliferation and migration of cervical cancer cells, suggesting that they have the potential to promote the growth and metastasis of cervical cancer.

[0154] Example 4: HIV1-miRNAs upregulated genes were significantly enriched in key tumor pathways such as cell proliferation and inflammation.

[0155] To investigate the mechanism by which HIV1-miRNAs regulate cervical cancer proliferation and migration, cells overexpressing different HIV1-miRNAs were collected, RNA was extracted, and transcriptome sequencing was performed. Figure 4 miR-H1 upregulated genes were significantly enriched in tumor-related pathways such as hypoxia response, cell cycle, cell motility, and inflammatory response. Similarly, miR-TAR and miR-N367 upregulated genes were also enriched in similar pathways. Figures 5-6 ).

[0156] Subsequently, the transcriptome sequencing data were validated using RT-qPCR. Figure 7 AC and HIV1-miRNAs activate the expression of oncogenes such as ITGB5, STX5, and GLI2, respectively, while miR-H1 can activate the expression of inflammatory genes such as IL7 and IFIH1.

[0157] These results suggest that the HIV1-miRNAs promote the development and progression of cervical cancer by activating the expression of genes such as oncogenes and inflammatory genes.

[0158] Example 5: HIV1-miRNA inhibitors inhibit the proliferation and migration of cervical cancer cells.

[0159] 1. Preparation of antisense nucleic acids (Inhibitors)

[0160] To further confirm whether targeting HIV1-miRNAs has a therapeutic effect, a biotechnology company was commissioned to synthesize antisense nucleic acid inhibitors that target different HIV1-miRNAs.

[0161] miR-H1 Inhibitor(SEQ ID NO:8):

[0162] GCCCAGGCACGCCUCCCUGG;

[0163] miR-TAR-3p Inhibitor (SEQ ID NO:9):

[0164] UGGGUUCCCUAGUUAGCCAGAGA;

[0165] miR-N367 Inhibitor(SEQ ID NO:10):

[0166] UUGAAGCACCAUCCAAAGGUUCAGU.

[0167] 2. Inhibitory effect of antisense nucleic acids

[0168] Different inhibitors were transfected into HeLa cell lines that stably expressed the corresponding HIV1-miRNAs. For example... Figure 8 Compared with the NC group, inhibitors targeting HIV1-miRNAs significantly reduced OD values ​​in both AC and NC groups, suggesting that inhibitors can suppress HIV1-miRNA-induced cell proliferation. Specifically, the colony-forming ability of HeLa stable transfected cells transfected with miR-TAR inhibitors was significantly reduced. Figure 8 D) suggests that inhibitors can reduce HIV1-miRNA-induced cervical cancer growth.

[0169] Subsequently, the effect of inhibitor treatment on the migration ability of HeLa cells was evaluated using Transwell assays. Figure 9 Compared with the NC group, the inhibitors were able to suppress the increase in cell migration ability induced by HIV1-miRNAs.

[0170] Therefore, the proliferation and migration abilities of cervical cancer cells were significantly reduced after treatment with inhibitors, indicating that small nucleic acids targeting HIV1-miRNAs can inhibit the growth and metastasis of cervical cancer.

[0171] The above analysis in this embodiment shows that overexpressing HIV-miRNAs in cervical cancer cells is equivalent to simulating the clinical state of HIV infection combined with cervical cancer, and the function of cervical cancer cells can be significantly inhibited through the action of inhibitors.

[0172] Example 6: Targeting HIV1-miRNAs with small nucleic acids to inhibit the expression of tumor-related genes.

[0173] To identify the genes that inhibitors can regulate HIV1-miRNA activation, HeLa cells transfected with inhibitors were collected and RNA was extracted. Some activated oncogenes and inflammatory genes were detected by RT-qPCR.

[0174] like Figure 10 AC, different inhibitors can significantly reduce the expression level of corresponding HIV1-miRNAs; inhibitors can significantly inhibit the expression of oncogenes such as ITGB5, PTGER and GLI2.

[0175] Therefore, inhibitors exert their anti-cancer effects by targeting and blocking the expression of HIV1-miRNAs, thereby reducing the expression of tumor-related genes such as oncogenes and inflammatory genes.

[0176] Example 7: Clinical diagnosis of cervical cancer using miR-H1

[0177] Twenty samples were collected, including tissue samples from HIV-positive patients with cervical cancer at different stages of cervical cancer (n=9; 3 per stage), and 11 normal cervical epithelial cells. RNA extraction was performed.

[0178] The expression of HIV-miR-H1 in the obtained RNA extraction samples was detected by RT-qPCR. The results are as follows: Figure 11 The expression level of miR-H1 gradually increases with the progression of cervical cancer, suggesting that miR-H1 may serve as a target gene in the progression of cervical cancer.

[0179] The inventors compared the expression differences of miR-H1 between the normal group and the cervical cancer group, and further analyzed the potential of miR-H1 as a target gene to distinguish cervical cancer. Figure 12 A. Compared with the control group, miR-H1 expression was significantly increased in the cervical cancer group.

[0180] like Figure 12 B. The ROC curve showed that miR-H1 had a sensitivity of 77.78% and a specificity of 81.82% in distinguishing cervical cancer from normal individuals, indicating that miR-H1 has excellent potential as a target for cervical cancer diagnosis.

[0181] In summary, HIV1-miRNAs promote the proliferation and migration of cervical cancer cells by upregulating tumor-related genes such as oncogenes. Furthermore, designing antisense nucleic acids targeting HIV1-miRNAs can inhibit the proliferation and migration of cervical cancer cells by suppressing their activation of tumor-progressing genes and other tumor-related genes. Accordingly, HIV1-miRNAs can serve as therapeutic targets and disease progression prediction targets for HIV-positive cervical cancer patients.

[0182] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. Use of miRNA or its precursor for the preparation of inhibitors for cervical cancer; said miRNA comprising miRNAs with nucleotide sequences as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4; said cervical cancer being HIV-associated cervical cancer.

2. The use as described in claim 1, characterized in that, The nucleotide sequence of the miRNA precursor is shown in SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:

7.

3. The use as described in claim 1, characterized in that, The inhibitor targets the miRNA or its precursor, interfering with or inhibiting the function of the miRNA, its transcript, or its translation product; Preferably, the inhibitor comprises: an antisense nucleotide, an interfering molecule, a gene editing reagent, or a construct capable of expressing or forming the antisense nucleotide, the interfering molecule, or the gene editing reagent.

4. Methods for preparing inhibitors of HIV combined with cervical cancer, including: (1) Provide a miRNA or a precursor thereof, wherein the miRNA is as defined in claim 1; (2) Design specific inhibitors for the miRNA or its precursor in (1), said inhibitors interfering with or inhibiting the function of the miRNA or its precursor, its transcript or its translation product; Preferably, the miRNA precursor is as defined in claim 2; Preferably, the inhibitor comprises: an antisense nucleotide, an interfering molecule, a gene editing reagent, or a construct capable of expressing or forming the antisense nucleotide, the interfering molecule, or the gene editing reagent.

5. An inhibitor of HIV combined with cervical cancer, which inhibits a miRNA or its precursor, said miRNA as defined in claim 1; said inhibitor interferes with or inhibits the function of the miRNA, its transcript or its translation product; Preferably, the miRNA precursor is as defined in claim 2; Preferably, the inhibitor comprises: The miRNA can be identified and targeted to inhibit antisense nucleotides, interfering molecules, or gene editing reagents, or can be expressed or formed by constructs containing the antisense nucleotides, interfering molecules, or gene editing reagents. More preferably, the inhibitor is an antisense nucleotide, the nucleotide sequence of which is shown in SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:

10.

6. Use of the inhibitor of claim 5 in the preparation of a composition for inhibiting HIV combined with cervical cancer; Preferably, the inhibitor inhibits the proliferation of cancer cells or inhibits the migration / metastasis of cancer cells; Preferably, the inhibitor inhibits the expression of oncogenes; more preferably, the oncogenes include (but are not limited to): ITGB5, STX5, and GLI2.

7. A composition, kit, or reagent kit for inhibiting HIV-associated cervical cancer, said composition comprising the inhibitor of claim 5; said kit or reagent kit comprising said composition.

8. Use of miRNA or its precursor for the preparation of a diagnostic reagent or kit for detecting HIV in combination with cervical cancer, wherein the miRNA is as defined in claim 1; preferably, the miRNA precursor is as defined in claim 2.

9. Use of a detection reagent that specifically recognizes or amplifies miRNA or its precursor for the preparation of a kit for detecting HIV combined with cervical cancer, wherein the miRNA is as defined in claim 1; preferably, the miRNA precursor is as defined in claim 2; Preferably, the detection reagent includes: Primers that specifically amplify the miRNA or its precursor, probes that specifically recognize the miRNA or its precursor, and chips that specifically recognize the miRNA or its precursor.

10. A method for preparing a diagnostic reagent for detecting HIV combined with cervical cancer, comprising: Using miRNA or its precursor as a target, prepare reagents that specifically recognize or amplify the miRNA or its precursor, wherein the miRNA is as defined in claim 1; Preferably, the miRNA precursor is as defined in claim 2; Preferably, the detection reagent includes: primers that specifically amplify the miRNA or its precursor, probes that specifically recognize the miRNA or its precursor, and a chip that specifically recognizes the miRNA or its precursor.

Images