Application of SPP1 in detection and treatment of soft meningeal metastasis tumor

Abstract

The invention provides application of SPP1 in detection and treatment of soft meningeal metastasis tumor. Specifically, the invention belongs to the technical field of biology, and particularly relates to discovery and application of a diagnostic marker and a new target spot of the soft meningeal metastasis tumor. The invention discloses an application of SPP1 (seeded phophotein 1) as a target spot and a diagnostic marker of a soft meningeal metastasis tumor. The invention further discloses an application of the SPP1 (seeded phophotein 1) as the target spot and the diagnostic marker of the soft meningeal metastasis tumor. The invention also discloses an application of inhibiting SPP1 expression or function in development of drugs for treating soft meningeal metastasis.

Description

Technical Field

[0001] This invention relates to the field of biomedicine. Specifically, this invention relates to the application of SPP1 in the detection and treatment of leptomeningeal metastases. Background Technology

[0002] Leptomeningeal metastases (LM) are a common and serious central nervous system complication of various cancers, also known as carcinomatous meningitis. When leptomeningeal metastases occur, tumor cells spread to the subarachnoid space and cerebrospinal fluid, forming pathological lesions. Epidemiological studies have shown that the incidence of leptomeningeal metastases in lung cancer, breast cancer, and melanoma is 10-26%, 12-34%, and 17-25%, respectively, with the detection rate showing an increasing trend year by year. Patients with leptomeningeal metastases have a survival period of only 2-5 months, accompanied by various neurological dysfunction symptoms such as cerebral edema, headache, nausea, vomiting, and diplopia, resulting in a significant decline in quality of life. Therefore, identifying diagnostic biomarkers and effective targets for leptomeningeal metastases to provide patients with effective diagnostic and treatment options has significant translational value and social benefits.

[0003] Cerebrospinal fluid (CSF) is a bodily fluid that surrounds the brain and spinal cord parenchyma, serving as a support and facilitating substance exchange. It is the microenvironment most relevant to tumor cell survival in leptomeningeal metastases. In clinical practice, medical professionals consider the detection of tumor cells in CSF cytological examination as the gold standard for diagnosing leptomeningeal metastases. However, CSF cytological examination often faces challenges due to low sensitivity, easily leading to missed diagnoses. In normal individuals, CSF is a low-protein, low-glucose, and sparsely cellular fluid. In leptomeningeal metastases, however, CSF infiltrates with tumor cells and a large number of immune cells, while also exhibiting drastic changes in its physicochemical composition, such as an increase in lactic acid and total protein levels. Identifying protein targets associated with leptomeningeal metastases and validating their therapeutic value will help promote the discovery of novel and highly effective biomarkers and molecular targets for leptomeningeal metastases, as well as the development of related drugs.

[0004] Therefore, it is necessary in this field to identify effective targets for leptomeningeal metastases in order to provide patients with novel treatment options. Summary of the Invention

[0005] The purpose of this invention is to provide the application of SPP1 in the detection and treatment of leptomeningeal metastases.

[0006] In a first aspect of the invention, there is provided the use of an SPP1 inhibitor, said SPP1 inhibitor being used in the preparation of a medicament for the prevention and / or treatment of leptomeningeal metastases.

[0007] In another preferred embodiment, the SPP1 inhibitor is selected from the group consisting of small molecule drugs, peptides, specific antibodies, nucleic acid drugs, gene-editing drugs, or combinations thereof.

[0008] In another preferred embodiment, the nucleic acid drug includes antisense oligonucleotides, shRNA, siRNA, miRNA, or combinations thereof.

[0009] In another preferred embodiment, the nucleic acid drug is shRNA, which has the following functional sequence:

[0010] (1)GCTGAATTCTGAGGGACTAAC (SEQ ID NO: 1); or

[0011] (2)GGATGAACCAAGTCTGGAAAC (SEQ ID NO: 2).

[0012] In another preferred embodiment, the SPP1 inhibitor:

[0013] i) Inhibit SPP1 at the gene, transcriptional, or protein levels;

[0014] ii) Blocking the binding or interaction between SPP1 and its receptor, thereby interfering with SPP1 function.

[0015] In another preferred embodiment, the SPP1 receptor includes integrins, CD44, or a combination thereof.

[0016] In another preferred embodiment, the SPP1 inhibitor inhibits the binding of SPP1 to Integrin, thereby inhibiting SPP1 function.

[0017] In another preferred embodiment, the SPP1 inhibitor is:

[0018] RGD (Arginine-Glycine-Aspartic acid) peptide; or

[0019] A polypeptide containing an RGD sequence.

[0020] In another preferred embodiment, the leptomeningeal metastasis originates from a tumor selected from the group consisting of: lung cancer, breast cancer, melanoma, or a combination thereof.

[0021] In another preferred embodiment, the SPP1 inhibitor is the only active ingredient in the drug.

[0022] In a second aspect of the invention, a pharmaceutical composition for treating leptomeningeal metastases is provided, said pharmaceutical composition comprising:

[0023] (a) SPP1 inhibitors; and

[0024] (b) Pharmaceutically acceptable carriers.

[0025] In another preferred embodiment, the SPP1 inhibitor is selected from the group consisting of small molecule drugs, peptides, specific antibodies, nucleic acid drugs, gene editing drugs, or combinations thereof.

[0026] In another preferred embodiment, the nucleic acid drug includes antisense oligonucleotides, shRNA, siRNA, miRNA, or combinations thereof.

[0027] In another preferred embodiment, the nucleic acid drug is shRNA, which has the following functional sequence:

[0028] (1)GCTGAATTCTGAGGGACTAAC (SEQ ID NO: 1); or

[0029] (2)GGATGAACCAAGTCTGGAAAC (SEQ ID NO: 2).

[0030] In another preferred embodiment, the SPP1 inhibitor inhibits the binding of SPP1 to Integrin, thereby inhibiting SPP1 function.

[0031] In another preferred embodiment, the SPP1 inhibitor is:

[0032] RGD (Arginine-Glycine-Aspartic acid) peptide; or

[0033] A polypeptide containing an RGD sequence.

[0034] In another preferred embodiment, the SPP1 inhibitor is the only active ingredient in the pharmaceutical composition.

[0035] In a third aspect of the invention, there is provided the use of the SPP1 gene, mRNA, cDNA, or protein, or a detection reagent thereof, in the preparation of a diagnostic reagent or kit for diagnosing leptomeningeal metastases or predicting the risk of leptomeningeal metastases.

[0036] In another preferred embodiment, the SPP1 protein includes an SPP1 protein alternative splice.

[0037] In another preferred embodiment, the SPP1 protein alternative splice variants include OPN-a, OPN-b, OPN-c, OPN-4, and OPN-5.

[0038] In another preferred embodiment, the protein comprises a full-length protein or a protein fragment.

[0039] In another preferred embodiment, the SPP1 gene, mRNA, cDNA, or protein is used as a control in the kit.

[0040] In another preferred embodiment, the object of the diagnosis is a human or a non-human mammal (such as a mouse).

[0041] In another preferred embodiment, the non-human mammal includes a mouse.

[0042] In another preferred embodiment, the leptomeningeal metastasis originates from a tumor selected from the group consisting of: lung cancer, breast cancer, melanoma, or a combination thereof.

[0043] In another preferred embodiment, the leptomeningeal metastasis is a lung cancer leptomeningeal metastasis.

[0044] In another preferred embodiment, the detection reagent is used for a detection method selected from the group consisting of: immunohistochemistry, quantitative PCR, Western blotting, biochemical analysis, cytological analysis, genomic or transcriptomic sequencing analysis, or a combination thereof.

[0045] In another preferred embodiment, the detection is performed on a cerebrospinal fluid sample or a carcinoma in situ sample.

[0046] In another preferred embodiment, the cerebrospinal fluid sample includes cellular components, non-cellular components, or combinations thereof.

[0047] In another preferred embodiment, the cells include tumor cells, macrophages, or combinations thereof.

[0048] In another preferred embodiment, the detection reagent is:

[0049] i) Specific antibodies or specific binding molecules to the SPP1 protein; and / or

[0050] ii) Specific amplification primers, probes, or chips for SPP1 cDNA or mRNA.

[0051] In another preferred embodiment, the SPP1-specific antibody or specific binding molecule is conjugated with or carries a detectable label.

[0052] In another preferred embodiment, the detectable marker is selected from the group consisting of chromophores, chemiluminescent groups, fluorophores, isotopes, or enzymes.

[0053] In another preferred embodiment, the specific antibody for SPP1 is a monoclonal antibody or a polyclonal antibody.

[0054] In another preferred embodiment, the diagnostic reagent includes antibodies, primers, probes, sequencing libraries, nucleic acid chips (such as DNA chips), or protein chips.

[0055] In another preferred embodiment, SPP1 is the sole diagnostic target in the diagnostic reagent or kit.

[0056] In a fourth aspect of the invention, a diagnostic kit is provided for diagnosing leptomeningeal metastases or predicting the risk of leptomeningeal metastases, the kit comprising a container containing a detection reagent for detecting the SPP1 gene, mRNA, cDNA, or protein.

[0057] Furthermore, the kit includes instructions that state that the kit is used to diagnose leptomeningeal metastases or predict the risk of leptomeningeal metastases.

[0058] In another preferred embodiment, the detection reagent is:

[0059] i) Specific antibodies or specific binding molecules to the SPP1 protein; and / or

[0060] ii) Specific amplification primers, probes, or chips for SPP1 cDNA or mRNA.

[0061] In another preferred embodiment, the detection is performed on a cerebrospinal fluid sample or a carcinoma in situ sample.

[0062] In another preferred embodiment, the cerebrospinal fluid sample includes cellular components, non-cellular components, or combinations thereof.

[0063] In another preferred embodiment, the cells include tumor cells, macrophages, or combinations thereof.

[0064] In another preferred embodiment, the SPP1 protein includes an SPP1 protein alternative splice.

[0065] In another preferred embodiment, the SPP1 protein alternative splice variants include OPN-a, OPN-b, OPN-c, OPN-4, and OPN-5.

[0066] In another preferred embodiment, the leptomeningeal metastasis originates from a tumor selected from the group consisting of: lung cancer, breast cancer, melanoma, or a combination thereof.

[0067] In another preferred embodiment, the leptomeningeal metastasis is a lung cancer leptomeningeal metastasis.

[0068] In another preferred embodiment, SPP1 is the sole diagnostic target in the diagnostic kit.

[0069] In a fifth aspect of the invention, a method for diagnosing leptomeningeal metastases or predicting the risk of leptomeningeal metastases is provided, the method comprising:

[0070] a) Provide test samples from the subjects;

[0071] b) Detect the expression level of SPP1 in the test samples; and

[0072] c) Compare the SPP1 expression levels measured in step b) with the control.

[0073] In this study, compared with the control group, the expression levels of SPP1 protein and / or SPP1 gene in the sample were higher than the reference value, indicating that the subjects may have leptomeningeal metastases or have a higher chance of developing leptomeningeal metastases than the normal population.

[0074] In another preferred embodiment, the subject is a cancer patient.

[0075] In another preferred embodiment, the subject is a patient with lung cancer, breast cancer, or melanoma.

[0076] In another preferred embodiment, the control group is a healthy person or a tumor patient without leptomeningeal metastasis.

[0077] In another preferred embodiment, the test samples include cerebrospinal fluid samples and carcinoma in situ samples.

[0078] In another preferred embodiment, the SPP1 expression level refers to an indicator selected from the group consisting of: SPP1 protein expression level, SPP1 gene or mRNA expression level, and the proportion of SPP1 positive cells.

[0079] In another preferred embodiment, the expression level being higher than the reference value means that the ratio (E1 / E0) of the SPP1 expression level (E1) from the subject sample to the SPP1 expression level (E0) from the control group is ≥1.5, preferably ≥2, and more preferably ≥2.5.

[0080] In another preferred embodiment, the leptomeningeal metastasis originates from a tumor selected from the group consisting of: lung cancer, breast cancer, melanoma, or a combination thereof.

[0081] In a sixth aspect of the invention, a kit is provided, the kit comprising:

[0082] (Z1) Diagnostic reagents, wherein the diagnostic reagents are selected from the group consisting of: reagents for detecting SPP1 gene, mRNA, cDNA, or protein; and

[0083] (Z2) is an SPP1 inhibitor used for the prevention and / or treatment of leptomeningeal metastases.

[0084] In another preferred embodiment, the kit further includes instructions for use, which state:

[0085] The diagnostic reagent is used to detect the expression level of SPP1 in samples from subjects, thereby predicting whether subjects have a risk of developing or have already developed leptomeningeal metastases. If the results indicate that a subject has a risk of developing or has already developed leptomeningeal metastases, the SPP1 inhibitor is administered to the subject.

[0086] In a seventh aspect of the invention, a method for preventing and / or treating leptomeningeal metastases is provided, comprising the steps of: administering an effective amount of an SPP1 inhibitor and / or an SPP1 inhibitor to a subject in need.

[0087] In another preferred embodiment, the subject is a patient with leptomeningeal metastases or a tumor patient at risk of developing leptomeningeal metastases.

[0088] In another preferred embodiment, the expression level of SPP1 is elevated in the cerebrospinal fluid sample or carcinoma in situ sample of the subject.

[0089] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0090] The following figures are used to illustrate specific embodiments of the present invention and are not intended to limit the scope of the invention as defined by the claims.

[0091] Figure 1 The study showed that SPP1 was significantly upregulated in the cerebrospinal fluid (CSF) of mice with leptomeningeal metastases compared to healthy control mice. (A) This schematic diagram shows the collection of CSF from control mice and mice with leptomeningeal metastases (12 days after injection of LLC-Luc2-tdTomato-LM cells), followed by removal of cellular components and label-free proteomics analysis using timsTOF mass spectrometry. Three biological replicates were performed for each of the control and tumor groups. (B) A volcano plot was used to visualize the changes in protein levels in the tumor group compared to the control group in Figure (A), as identified by mass spectrometry. Proteins upregulated or downregulated by 1.5-fold with a p-value less than 0.05 were defined as significantly changed proteins. The horizontal dashed line in the figure is parallel to the X-axis and aligned with the Y-axis (log). 10The position with a P value of 1.30 (corresponding to a P value of 0.05) is shown. The vertical dashed line in the figure is parallel to the Y-axis. The right dashed line shows a Log2 (fold change) value of 0.585 (corresponding to an upward adjustment factor of 1.5 times), while the left dashed line shows a Log2 (fold change) value of -0.585 (corresponding to a downward adjustment factor of 1.5 times). Points representing the coordinates of the SPP1 protein are indicated by straight lines.

[0092] Figure 2 The results show that SPP1 was significantly upregulated in cerebrospinal fluid (CSF) samples from mice with leptomeningeal metastases and clinical patients. (A) Bar graphs show the ELISA (Enzyme Linked Immunosorbent Assay) quantitative results of SPP1 in the CSF of 11 healthy mice (control group) and 11 mice with leptomeningeal metastases. Results are expressed as mean ± standard error. Unpaired t-tests were used to analyze differences between the two groups. **** indicates P < 0.0001. (B) Bar graphs show the ELISA quantitative results of SPP1 in the CSF of 8 patients without leptomeningeal metastases and 18 patients with leptomeningeal metastases. Results are expressed as mean ± standard error. Unpaired t-tests were used to analyze differences between the two groups. * indicates P < 0.05.

[0093] Figure 3 This study showed high expression of SPP1 in tumor cells and macrophages of cerebrospinal fluid from patients with leptomeningeal metastases. (AD) Single-cell transcriptome sequencing was performed on cerebrospinal fluid cells from four patients with leptomeningeal metastases from lung cancer. After quality control, 15,872 cells were obtained. These cells were then visualized using tSNE dimensionality reduction, and the expression levels of EPCAM (A), PTPRC (B), SPP1 (C), and CD68 (D) genes in different cells were visualized using color intensity. The darker the color, the higher the expression level, such as... Figure 3 The scale bar in the lower right corner of each figure in (AD) is shown. EPCAM, PTPRC, and CD68 genes are characteristic genes of tumor cells, immune cells, and macrophages, respectively. The horizontal axis represents tSNE1, and the vertical axis represents tSNE2.

[0094] Figure 4This image shows high SPP1 expression in cerebrospinal fluid tumor cells of mice with leptomeningeal metastases. (A) Bioluminescent imaging was performed 12 days after injection of LLC-Luc2-tdTomato-LM cells into the left ventricle of mice. The image shows tumor signals along anatomical locations of the central nervous system (brain and spinal cord), indicating successful establishment of a leptomeningeal metastasis mouse model. The scale bar is on the right. (B) Cerebrospinal fluid cells were isolated 12 days after injection of LLC-Luc2-tdTomato-LM cells into the left ventricle of mice. Cerebrospinal fluid cell smears were prepared, and immunofluorescence staining and laser confocal imaging were performed on the smears. DAPI staining was used to label cell nuclei (blue pseudocolor), SPP1 primary antibody staining was used to identify SPP1-positive cells (green pseudocolor), and tdTomato-positive cells were tumor cells (red pseudocolor). The scale bar is 50 μm. (C) Bioluminescence imaging was performed on tdTomato-positive cells (tdTomato) in Figure B. + SPP1 in cells + Cell proportions were statistically analyzed and displayed using a bar chart. This chart presents statistical data from six mice, with results expressed as mean ± standard error.

[0095] Figure 5The study showed that inhibiting SPP1 expression or function in tumor cells significantly reduced tumor burden and prolonged survival in mice with leptomeningeal metastases. (A) Immunoblot image of LLC-Luc2-LM cells stably expressing Spp1-Sh1, Spp1-Sh3, and ShCtrl. The protein loading amount was 30 μg, with β-Actin protein used as an internal control. Imaging of SPP1 protein was performed first, followed by imaging of β-Actin protein. The molecular weight is shown on the right side of the figure. (B) Bioluminescence imaging was performed 12 days after injection of LLC-Luc2-LM cells stably expressing SPP1-Sh1 and SPP1-Sh3 and control cells into the left ventricle of mice. The right side shows a representative bioluminescence image (scale bar shown in the figure), which displays the signal of one control cell model mouse, one cell model mouse stably expressing Spp1-Sh1, and one cell model mouse stably expressing Spp1-Sh3. The left bar chart shows the bioluminescence signal results of three groups (n=5 per group) of mice injected with annotated cells. The signal values ​​of the control group and the other two experimental groups were compared using a one-way ANOVA with Tukey's multiple comparison test. Signal values ​​are expressed as mean ± standard error. **** represents P < 0.001, and NS is an abbreviation for not significant. (C) The overall survival of three groups of mice (n=10 per group) with leptomeningeal metastases modeled by LLC-Luc2-LM cells stably expressing Spp1-Sh1, Spp1-Sh3, and ShCtrl was observed, and Kaplan-Meier survival curves were plotted. The log rank test was used to analyze the differences among the three groups. **** represents P < 0.001, and NS is an abbreviation for not significant. (D) A leptomeningeal metastasis model was constructed according to the method in Example 1. Control group mice were injected with PBS, and experimental group mice were injected with RGD peptide. Bioluminescence imaging was performed 12 days later. The right side shows representative bioluminescence imaging images (scale bar shown), displaying the bioluminescence imaging signals of 2 control mice and 2 experimental mice. The left side bar chart shows the statistical results of the bioluminescence signals of the injected mice in the control and experimental groups (n=5 per group), and an unpaired t-test was performed on the signal values ​​of the two groups. Signal values ​​are expressed as mean ± standard error. **** indicates a p-value < 0.0001. (E) Based on Figure 5 Experiment (D) was conducted to observe the overall survival of mice with leptomeningeal metastases in the solvent injection group and the RGD peptide injection group (n=10 per group), and Kaplan-Meier survival curves were plotted. The log-rank test was used to analyze the differences between the two groups. **** represents a p-value < 0.001. Detailed Implementation

[0096] Through extensive and in-depth research, the inventors have developed, for the first time, an application of SPP1 in the detection and treatment of leptomeningeal metastases. This invention utilizes single-cell transcriptomics, proteomics, immunological staining, and bioinformatics to detect and analyze the cellular and non-cellular components of cerebrospinal fluid in leptomeningeal metastasis samples to screen for highly expressed or upregulated molecules as potential biomarkers. The inventors identified SPP1 as a molecular biomarker for leptomeningeal metastases. Further gene knockdown and animal experiments verified that inhibiting SPP1 expression significantly inhibited tumor growth in leptomeningeal metastasis model mice and significantly prolonged the median survival time of the mice, indicating that SPP1 is a potential effective target for the treatment of leptomeningeal metastases. The SPP1 involved in this invention can be further used as an indicator for the clinical diagnosis of leptomeningeal metastases and can be used to develop diagnostic kits and other products, as well as targeted drugs. Based on this, this invention was completed.

[0097] The technical solution adopted in this invention is as follows: Proteomic analysis was performed on the cerebrospinal fluid (CSF) of healthy control mice and mice with lung cancer leptomeningeal metastases to identify protein molecules highly expressed in the CSF of mice with leptomeningeal metastases compared to healthy mice, serving as candidate molecular markers. This invention utilized proteomic and bioinformatics analysis to discover that SPP1 was significantly upregulated in the CSF of mice with lung cancer leptomeningeal metastases. ELISA technology was used to verify SPP1 expression in mouse CSF, revealing a significant upregulation of SPP1 compared to healthy mice. This invention further validated the findings using ELISA technology on clinical CSF samples collected in the laboratory, revealing a significant upregulation of SPP1 in the CSF of patients with leptomeningeal metastases compared to those without. Further single-cell proteomics and bioinformatics analysis of clinical CSF revealed tumor cells (EPCAM)... + CD68 cells are the main source of SPP1 in cerebrospinal fluid, while macrophages (CD68 cells) are the main source. + SPP1 can also be produced by cells. Simultaneously, using immunofluorescence experiments, we confirmed that SPP1 is highly expressed in tumor cells of the cerebrospinal fluid of mice with leptomeningeal metastases from lung cancer. Furthermore, this invention, by constructing a stable SPP1 knockdown vector and establishing a stable LLC-LM cell line for knockdown, and through in vivo leptomeningeal metastasis model construction and subsequent analysis, found that knocking down SPP1 in tumor cells significantly reduced the tumor burden and prolonged the survival time of mice with leptomeningeal metastases. Simultaneously, injecting RGD peptide into mice with leptomeningeal metastases to block SPP1-Integrin binding and interfere with SPP1 function also resulted in a significant decrease in tumor burden and a significant increase in survival time.

[0098] the term

[0099] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0100] As used herein, when referring to a specific enumerated value, the term “about” means that the value can vary by no more than 1% from the enumerated values. For example, as used herein, the expression “about 100” includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0101] As used herein, “containing,” “having,” or “including” includes “comprising,” “mainly composed of,” “substantially composed of,” and “composed of”; “mainly composed of,” “substantially composed of,” and “composed of” are subordinate concepts of “containing,” “having,” or “including.”

[0102] SPP1

[0103] As used herein, the term "SPP1" refers to secreted phosphoprotein 1 (SPP1), a secreted phosphorylated glycosylated protein that acts as a bridge between osteocytes and hydroxyapatite. Also known as osteopontin (OPN), it is a secreted phosphorylated glycoprotein that binds to integrins and contains several conserved domains: the RGD (arginine-glycine-aspartate) domain, the SVVYGLR (serine-valine-valine-tyrosine-glutamate-leucine-arginine) domain, a heparin-binding domain, a calcium-binding domain, a matrix metalloproteinase cleavage site, and a CD44 receptor-binding domain. SPP1 binds to integrins via the RGD and SVVYGLR domains, and to CD44 via the CD44 receptor-binding domain.

[0104] The human SPP1 protein gene, SPP1, is located on chromosome 4 q22.1. Human SPP1 includes five different isoforms (or alternative splicing variants): OPN-a, OPN-b, OPN-c, OPN-4, and OPN-5. The SPP1 protein involved in this invention can be any isoform of SPP1.

[0105] SPP1 plays an important role in physiological processes such as development, vascular remodeling, and wound healing. SPP1 is upregulated in various cancers, including breast cancer, lung cancer, colorectal cancer, and gastric cancer, and plays a role in cancer development by promoting tumor cell survival, enhancing tumor invasion, and regulating angiogenesis or the immune microenvironment through integrin or CD44 downstream signaling.

[0106] Mouse model of leptomeningeal metastases

[0107] A mouse model of leptomeningeal metastases refers to a research system constructed in mouse models that can simulate or partially simulate the clinical occurrence and development of leptomeningeal metastases. Typically, mouse models of leptomeningeal metastases can be established by directly injecting cancer cells into the cerebellomedullary cistern or the left ventricle. The leptomeningeal metastases mouse model involved in this invention is established using a left ventricular injection technique.

[0108] Single-cell transcriptomics

[0109] Single-cell transcriptomics is an emerging high-throughput technique that can be used to study gene expression and function in individual cells. Compared to traditional tissue or cell-level transcriptomics studies, single-cell transcriptomics can better reflect the heterogeneity between different cells. In one embodiment of the present invention, single-cell transcriptomics is used to analyze the composition and gene expression distribution heterogeneity of cerebrospinal fluid cells from patients with leptomeningeal metastases, thereby identifying potential diagnostic or therapeutic targets.

[0110] Bioluminescence imaging

[0111] Bioluminescence imaging (BLI) involves labeling cells or DNA with luciferase genes. In the presence of ATP and oxygen, the luciferin undergoes an oxidation reaction, emitting light and allowing direct monitoring of cellular activity and gene behavior in vivo. Commonly used luciferase genes include firefly luciferase (Fluc), Gaussian luciferase (Gluc), or Renal luciferase (Rluc). In several embodiments of this invention, Fluc is used to label tumor cells, and BLI is used to monitor tumor cell growth in the cerebrospinal fluid and pia mater regions.

[0112] Proteomics

[0113] Proteomics is a science that studies proteins by using mass spectrometry to detect and analyze proteins in biological samples, investigating their composition and changes. Through research on protein expression levels, post-translational modifications, and protein-protein interactions, it provides a holistic and comprehensive understanding of disease development, cellular metabolism, and other processes at the protein level. In one embodiment of this invention, non-cellular components of cerebrospinal fluid from a control group and a mouse model of leptomeningeal metastases were collected and analyzed using label-free mass spectrometry to identify significantly upregulated proteins in the tumor group as potential diagnostic or therapeutic targets.

[0114] Bioinformatics

[0115] Bioinformatics effectively combines biology with mathematics and computer science. It primarily utilizes methods and tools from multiple fields, including mathematics and information science, to acquire, process, store, analyze, and interpret biological information, thereby elucidating the biological significance of large amounts of biological data. The research focus is mainly on genomics and proteomics. In several embodiments of this invention, bioinformatics methods are used to analyze cerebrospinal fluid single-cell omics or proteomics data, thereby discovering potential diagnostic or therapeutic targets for leptomeningeal metastases.

[0116] RNA interference technology

[0117] RNA interference (RNAi) is a gene knockdown technique that utilizes double-stranded RNA to efficiently and specifically degrade homologous mRNA within cells, thereby blocking the expression of target genes and causing cells to exhibit a target gene deletion phenotype. Currently, RNA interference methods mainly focus on two aspects: chemically synthesized siRNAs (short interfering RNA) and expression vector-based shRNAs (short hairpin RNA). Compared to chemically synthesized siRNAs, shRNAs have more advantages: high stability, low off-target rate, long duration of action, and easy introduction into difficult-to-access cells, making them a widely used technique among researchers. In one embodiment of this invention, the gene knockdown technique used is an shRNA-based RNA interference technique.

[0118] Total Survival

[0119] Overall survival (OS) refers to the time from randomization or the start of treatment until death from any cause. In one embodiment of the invention, the overall survival of tumor-bearing mice is statistically analyzed, and Kaplan-Meier survival curves are used to evaluate the efficacy of targeting tumor-targeting genes.

[0120] Detection and Diagnostic Methods

[0121] This invention discovered that the SPP1 content in the cerebrospinal fluid of a mouse model of lung cancer leptomeningeal metastases was significantly upregulated compared with that of the control group. It also found that SPP1 was highly expressed in tumor cells and macrophages in the cerebrospinal fluid of patients with lung cancer leptomeningeal metastases and mouse models. Based on this, this invention provides a new target for leptomeningeal metastases, SPP1.

[0122] The "leptomeningeal metastasis" referred to in this invention is a common central nervous system complication of various cancers, also known as carcinomatous meningitis. Leptomeningeal metastases can originate from lung cancer, breast cancer, or melanoma, such as lung cancer leptomeningeal metastases.

[0123] As used in this invention, the term "detection" includes any method for detecting SPP1 expression, such as biomarker expression analysis of tumor tissue (including immunohistochemistry, quantitative PCR, Western blotting, etc.), biochemical analysis of cerebrospinal fluid, and cytological analysis of cerebrospinal fluid, as well as genomic and transcriptomic sequencing of tumor tissue or cerebrospinal fluid cells. The SPP1 detected in this invention includes abnormally amplified gene fragments, messenger RNA (mRNA), and protein molecules of SPP1.

[0124] Treatment methods and pharmaceutical compositions

[0125] This invention discovered that knocking down SPP1 gene expression in lung cancer cell lines can significantly inhibit the growth of leptomeningeal metastases and prolong the median survival in mouse models. Based on this, this invention provides the use of SPP1 and its downstream signaling pathways in the treatment of leptomeningeal metastases, for the preparation of drugs that inhibit leptomeningeal metastases. The "SPP1 downstream signaling pathway" mentioned in this invention refers to cancer-related signaling pathways that depend on the binding of SPP1 to its receptors (e.g., integrin, CD44).

[0126] Drugs that can be used in the treatment methods of the present invention include drugs that directly target SPP1 and drugs that interfere with the interaction between SPP1 and its receptor. For example, the drug may be a specific antibody targeting the SPP1 protein, a small molecule drug, a nucleic acid drug that inhibits SPP1 gene expression, or a gene-editing drug, but is not limited thereto. The drug may also be a drug that blocks the binding or interaction between SPP1 and its receptor, such as a blocking antibody targeting integrin or CD44.

[0127] In one embodiment, the drug may be an shRNA plasmid for knocking down SPP1; wherein the functional sequence for knocking down is: (1) GCTGAATTCTGAGGGACTAAC (SEQ ID NO:1); or (2) GGATGAACCAAGTCTGGAAAC (SEQ ID NO:2).

[0128] In one embodiment, the drug is an inhibitor that inhibits the binding of SPP1 to Integrin, thereby inhibiting the function of SPP1. For example, the SPP1 inhibitor may be an RGD (Arginine-Glycine-Aspartic acid) peptide or a polypeptide containing an RGD sequence.

[0129] The present invention also provides pharmaceutical compositions comprising an SPP1 inhibitor for the prevention and / or treatment of leptomeningeal metastases.

[0130] The pharmaceutical compositions of the present invention comprise, within a safe and effective range, an inhibitor of the present invention (especially an inhibitor targeting SPP1 function) or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient or carrier. "Safe and effective range" refers to an amount of the compound sufficient to significantly improve the condition without causing serious side effects. Typically, the pharmaceutical composition contains 1-2000 mg of the compound of the present invention per dose, more preferably, 5-100 mg of the compound of the present invention per dose. Preferably, "one dose" is a capsule or tablet.

[0131] "Pharmaceutically acceptable carriers" refers to one or more compatible solid or liquid fillers or gelling substances that are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components in the composition can be mixed with and with the compounds of the present invention without significantly reducing the efficacy of the compounds. Examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (such as Tween), wetting agents (such as sodium dodecyl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0132] There are no particular limitations on the administration of the compounds or pharmaceutical compositions of the present invention. Representative administration methods include (but are not limited to): oral administration, parenteral administration (intravenous, intramuscular, or subcutaneous).

[0133] The composition may also contain adjuvants such as wetting agents, emulsifiers and suspending agents, sweeteners, flavoring agents and fragrances.

[0134] In addition to the active compound, the suspension may contain suspending agents such as ethoxylated isooctadecyl alcohol, polyoxyethylene sorbitol and dehydrated sorbitol esters, microcrystalline cellulose, aluminum methoxide and agar, or mixtures of these substances.

[0135] Compositions for parenteral injection may comprise physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions, or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents, or excipients include water, ethanol, polyols, and suitable mixtures thereof.

[0136] The preferred dosage form of the pharmaceutical composition of the present invention is an injection.

[0137] The SPP1 inhibitor of the present invention can be administered alone or in combination with other pharmaceutically acceptable therapeutic agents.

[0138] When using the pharmaceutical composition, a safe and effective amount of the compound of the present invention is applied to the mammal (such as a human) requiring treatment. The dosage administered is the pharmaceutically considered effective dose. For a person weighing 60 kg, the daily dose is typically 1–2000 mg, preferably 5–100 mg. Of course, the specific dosage should also take into account factors such as the route of administration and the patient's health condition, which are all within the scope of the skills of a skilled physician.

[0139] The main advantages of this invention include:

[0140] 1) This invention is the first to discover that SPP1 is highly expressed in tumor cells and macrophages in the cerebrospinal fluid of patients with leptomeningeal metastases and mouse models, and that the content of SPP1 in the cerebrospinal fluid is significantly upregulated when leptomeningeal metastases occur. Based on this, SPP1 is provided as a new biological diagnostic marker for leptomeningeal metastases.

[0141] 2) This invention further demonstrates, using a mouse model of leptomeningeal metastases, that interfering with SPP1 expression or function can significantly inhibit the progression of leptomeningeal metastases, providing a new target for the prevention and treatment of leptomeningeal metastases.

[0142] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0143] Example 1: Proteomics Identification of Upregulated SPP1 in Cerebrospinal Fluid of Mice with Leptomeningeal Metastases

[0144] 1. Cell line culture

[0145] This invention utilizes a previously constructed lung cancer cell line with a tendency to metastasize to the leptomeningeal, named LLC-Luc2-LM cells. This cell line was constructed according to the method described in the 2017 Cell article, "Complement Component 3 Adapts the Cerebrospinal Fluid for Leptomeningeal Metastasis." Based on this cell line, our laboratory also maintains an LLC-Luc2-LM cell line stably expressing the tdTomato fluorescent protein, named LLC-Luc2-tdTomato-LM cells. In LLC-Luc2-tdTomato-LM, LLC represents Lewis lung cancer, Luc2 indicates the integration of the firefly luciferase (fLuc) gene into the cell genome, tdTomato indicates the integration of the fluorescent protein tdTomato gene into the cell genome, and LM (leptomeningeal metastasis) indicates the cell's tendency to metastasize to the leptomeningeal. Because the genome contains both the fLuc and tdTomato genes, this cell line can be observed and tracked using bioluminescence imaging and fluorescence microscopy.

[0146] LLC-Luc2-tdTomato-LM cells were cultured in DMEM (Dulbecco's modified Eagle's medium) (Catalog #Gibico C11995500BT, Thermo Fisher Scientific) complete medium supplemented with 10% (v / v) fetal bovine serum (catalog number #900-108, GeminiBio) and 0.1 mg / mL Primocin antibiotic (catalog number #ant-pm-1, InvivoGen). The culture environment was a 37°C incubator containing 5% (v / v) carbon dioxide. The specific operation steps are as follows: (1) Take out a tube of frozen LLC-Luc2-tdTomato-LM cells from liquid nitrogen, quickly put them into a 37°C water bath to thaw, and transfer them to a 10cm culture dish containing 10mL of preheated complete culture medium. When the cells reach a density of 80%-90%, pass them through cell culture; (2) When passing the cells, wash away the residual culture medium with 3mL of PBS, add 1mL of trypsin-EDTA solution, digest in a 37°C incubator for 3 minutes, add 3mL of complete culture medium to stop digestion, centrifuge at 200×g and 4°C for 5 minutes, discard the supernatant, resuspend the cells with 2mL of complete culture medium, and transfer 300μL of cell suspension to a 10cm culture dish for continued culture.

[0147] 2. Construction of a mouse model of leptomeningeal transfer.

[0148] This invention establishes a mouse model of leptomeningeal transfer via left ventricular injection. First, 8-week-old C57BL / 6J mice (from Jicui Pharmaceutical Co., Ltd.) were anesthetized by intraperitoneal injection of avertin (T48402, Sigma) at a dose of 250 mg / kg. The pubic hair on the mice's chest area was shaved. The mice were placed supine on an absorbent pad on the experimental table, and their limbs were secured to the pad with medical tape. A ruler was placed along the midline of the mouse's abdomen, and a line was drawn connecting the endpoint of the sternum near the head and the xiphoid process. The midpoint of this line, approximately 1 mm to the left of the mouse's left limb, was designated as the injection point. This injection point was marked with a marker. LLC-Luc2-tdTomato-LM cell suspension (resuspended in PBS, i.e., phosphate-buffered saline) was prepared according to the "Cell Line Culture" method. After counting the cells, the cell concentration was adjusted to 5 × 10⁶ cells / mL. 5 Cells / mL. Using a 1mL syringe equipped with a 30G needle, draw an appropriate amount of cell suspension, ensuring approximately 50μL of air remains between the cell suspension and the plunger. Insert the needle vertically downwards from the marked injection point until pulsating blood flow is observed in the syringe. Stop moving the needle tip downwards and slowly push the syringe forward, injecting 100μL of cell suspension into the mouse's bloodstream within 1 minute. Subsequently, at fixed time points such as day 7 and day 12 post-modeling, [the cells were then analyzed using...]. The Spectrum in vivo imaging system (PerkinElmer) was used to perform BLI imaging on anesthetized mice to detect tumor signals.

[0149] 3. Experimental Grouping

[0150] Mice were divided into two groups: a control group and a tumor group. Eight-week-old C57BL / 6J mice were selected, and a portion of them were used to construct a mouse model of leptomeningeal metastasis as the tumor group, while the other mice were injected with 100 μL of PBS into the left ventricle as the control group.

[0151] 4. Collection of cerebrospinal fluid from mice.

[0152] Cerebrospinal fluid (CSF) was collected from control mice and mice with leptomeningeal metastases 12 days after modeling. The CSF collection method was based on the modified version of the method described in the 2018 article "An Improved Method for Collection of Cerebrospinal Fluid from Anesthetized Mice" published in the Journal of Visualized Experiments. Mice were anesthetized with amphotericin B, and the hair on their heads and necks was shaved. They were placed prone on a stereotaxic apparatus, their heads fixed to the apparatus, and the head and body positions adjusted so that their necks were almost horizontal. The skin was incised along the midline above the cerebellomedullary cistern, and the muscles above the cistern were carefully dissected with pointed forceps to expose the atlanto-occipital membrane. The other end of a thinned glass tube was pre-attached to the needle of a 1 mL syringe using self-curing dental cement, and the syringe was then mounted on the precision microsyringe pump of the stereotaxic apparatus. Using a stereotaxic apparatus, the capillary glass tip of the syringe was brought close to and pierced the atlanto-occipital membrane in a vertical direction. The electric pump was then activated to extract cerebrospinal fluid at a rate of 15 μL per hour. 20–40 μL of cerebrospinal fluid was extracted from each mouse and transferred to low-absorption EP tubes. The tubes were centrifuged at 4°C and 400 × g for 10 minutes, and the supernatant was transferred to new low-absorption EP tubes. The tubes were then centrifuged again at 4°C and 12000 × g for 20 minutes, and the supernatant was transferred to new low-absorption EP tubes. This yielded the non-cellular component of the cerebrospinal fluid, which was stored at -80°C.

[0153] 5. Cerebrospinal fluid proteomics analysis

[0154] This invention employs timsTOF label-free mass spectrometry for the relative quantification of cerebrospinal fluid (CSF) protein components. To improve the detection of low-abundance proteins, Agilent affinity columns were used to remove high-abundance albumin and IgG from the CSF according to the manufacturer's instructions. The flow-through was ion-replaced using a 10 kDa ultrafiltration tube with 100 mM Tris-HCl buffer at pH 7.6, and supplemented with 4% SDS and 100 mM DTT. The sample was then boiled at 100°C for 7 minutes. Subsequent steps were performed using the Filter-Aided Sample Preparation (FASP) method described in the 2009 Nature Methods paper entitled "Universal Sample Preparation Method for Proteome Analysis". The CSF sample was centrifuged using a 30 kDa ultrafiltration tube at 14000 × g for 40 minutes, and the solution was then replaced with a pH 8.0 buffer containing 100 mM Tris-HCl and 8 M urea. Next, iodoacetamide to a final concentration of 100 mM was added to alkylate the proteins in the ultrafiltration tube. This was then replaced with 100 mM ammonium bicarbonate buffer containing 4 μg trypsin and incubated at 37°C for 18 hours. The solution was centrifuged at 14000 × g for 15 minutes to obtain a flow-through containing the digested peptides. The peptide solution was then desalted and dried using a C18 column and redissolved in 0.1% formic acid solution.

[0155] Next, a tandem chromatography-mass spectrometry (GC-MS) system equipped with a nanoElute UHPLC system and a timsTOF Pro mass spectrometer was used for detection. The desalted peptide solution was added to a C18 analytical column and eluted sequentially with different ratios of phase A solution (0.1% formic acid acetonitrile solution) and phase B solution (0.1% formic acid aqueous solution) at a flow rate of 300 nL / min, namely: (1) for the first 45 minutes, the ratio of phase A to phase B gradually changed from 100%:0% (volume ratio) to 22%:78%; (2) for the next 5 minutes, it gradually changed to 35%:65% (volume ratio); (3) for the next 5 minutes, it gradually changed to 80%:20% (volume ratio); (4) finally, it was maintained at 80% for 20 minutes. Simultaneously, the mass spectrometer was operated in positive ion spray mode with a capillary voltage of 4500 V and set to PASEF scan mode with the following parameters: mass-to-charge ratio (m / z) range of 400-1250 and TIMS ion mobility (1 / k0) range of 0.75-1.40 Vs / cm. 2 The ramp time is 100ms.

[0156] 6. Bioinformatics Analysis of Mass Spectrometry Data

[0157] The PASEF results file was imported into MaxQuant software, and proteins were identified and quantified according to the method published in Nature Protocols in 2016, entitled "MaxQuant enables high peptide identification rates, individualized p.pb-range mass accuracies and proteome-wide protein quantification". Before subsequent analysis, proteins with a detection rate (i.e., the percentage of samples in each group that detected the protein) of less than 50% were first removed, and missing values ​​for a protein in each group were filled with the average of other samples. Differential expression analysis was performed using the limma package (v3.54.0) in R language with empirical Bayesian estimation. Changes in protein content were visualized using volcano plots generated by the EnhancedVolcano package in R language. Compared with the control group, genes with a p-value less than 0.05 and a protein upregulation greater than 1.5-fold were considered significantly upregulated.

[0158] 7. Results

[0159] according to Figure 1 Experimental strategy A involved performing label-free Tims-TOF mass spectrometry analysis on the non-cellular components (supernatant) of cerebrospinal fluid from both the control and tumor groups to obtain protein expression matrices, and then displaying differentially expressed genes using a volcano plot. Figure 1 B). Proteins showing a fold change greater than 1.5-fold between the tumor group and the control group, with a P-value less than 0.05, were defined as differentially expressed proteins. SPP1 in cerebrospinal fluid supernatant was found to be significantly upregulated in the tumor group. Figure 1 B).

[0160] Example 2: Detection of SPP1 content in cerebrospinal fluid of mice with leptomeningeal metastases and clinical patients using ELISA.

[0161] 1. ELISA assay of mouse cerebrospinal fluid

[0162] The ELISA experiment of mouse cerebrospinal fluid (CSF) included two groups: a control group and a tumor group. Eight-week-old C57BL / 6J mice were selected. A portion of these mice were used to construct a leptomeningeal metastasis mouse model as described in Example 1, serving as the tumor group. The remaining mice were injected with 100 μL of PBS into the left ventricle as the control group. CSF was collected from the control group and the leptomeningeal metastasis mice 12 days after modeling, following the method described in Example 1, and cell-free CSF was prepared. In this example, we used an ELISA kit to detect the SPP1 content in the CSF of 11 control mice and 11 leptomeningeal metastasis mice. The ELISA kit used for the mouse CSF experiment was the #MU30053 kit manufactured by Wuhan Beiyinlai Biotechnology Co., Ltd. During the ELISA experiment, 10 μL of CSF was diluted before detection. The subsequent standard curve setting and operation methods were performed according to the #MU30053 kit instructions.

[0163] 2. ELISA test of cerebrospinal fluid in clinical patients

[0164] The ELISA assay for cerebrospinal fluid (CSF) in clinical patients included two groups: a non-leptomeningeal metastasis group and a leptomeningeal metastasis group. With informed consent from the patients, 5 mL of CSF was collected via lumbar puncture. The sample was first centrifuged at 4°C and 400×g for 10 minutes, and the supernatant was transferred to a new low-absorption EP tube. This was then centrifuged again at 4°C and 12000×g for 20 minutes, and the supernatant was transferred to another low-absorption EP tube, yielding the non-cellular CSF component, which was stored at -80°C. In this example, we used an ELISA kit to detect the SPP1 content in the CSF of 8 patients with non-leptomeningeal metastasis and 18 patients with leptomeningeal metastasis. The kit used for the ELISA assay of CSF in clinical patients was the RayBiotech kit (catalog number #ELH-OPN-1). For the ELISA assay, 100 μL of CSF was used for detection, and the subsequent standard curve setting and operation methods were performed according to the #ELH-OPN-1 kit instructions.

[0165] 3. Results

[0166] ELISA results showed that, compared with the control group, the SPP1 content in the cerebrospinal fluid of mice with leptomeningeal metastases was significantly upregulated. Figure 2 A); Compared with patients without leptomeningeal metastases, patients with leptomeningeal metastases had significantly upregulated SPP1 levels in their cerebrospinal fluid (A); Figure 2 B).

[0167] Example 3: Analysis of SPP1 expression in cerebrospinal fluid cells of patients with leptomeningeal metastases

[0168] 1. Single-cell transcriptomics analysis

[0169] Single-cell transcriptome expression matrix data from the cerebrospinal fluid of four lung cancer patients with leptomeningeal metastases collected in the laboratory were used for subsequent bioinformatics analysis. The NovelBrain cloud computing platform from Liebing Biotechnology Co., Ltd. was used for data analysis. After removing cells with fewer than 200 expressed genes or whose mitochondrial gene content was greater than 20%, the data were subsequently normalized, standardized, subjected to PCA dimensionality reduction, and visualized using tSNE to obtain cell population distribution maps. The immune cell populations and tumor cell populations were then identified based on the biomedically recognized characteristic genes of immune cells (PTPRC) and the characteristic genes of lung cancer tumor cells (EPCAM).

[0170] 2. Results

[0171] On the NovelBrain cloud platform, projecting the standardized expression values ​​of the PTPRC and EPCAM genes onto the tSNE cell population map revealed that the cells in the patient's cerebrospinal fluid mainly consisted of two groups: one group highly expressed the EPCAM gene but did not express the PTPRC gene, which were tumor cells. Figure 3 A), another group highly expresses the PTPRC gene but not the EPCAM gene, which is for immune cells ( Figure 3 B). Furthermore, projecting the SPP1 gene expression value onto a tSNE (t-distributed stochastic neighbor embedding) map revealed that the vast majority of tumor cells expressed SPP1, and some immune cells also expressed SPP1. Figure 3 C). These immune cells expressing SPP1 also express the macrophage-specific gene CD68 (C). Figure 3 D). In summary, SPP1 is highly expressed mainly in cerebrospinal fluid tumor cells and macrophages of patients with leptomeningeal metastases.

[0172] Example 4: Analysis of SPP1 expression in cerebrospinal fluid cells of mice with leptomeningeal metastases

[0173] 1. Cerebrospinal fluid cell collection and immunofluorescence staining.

[0174] After constructing a mouse model of leptomeningeal metastasis according to Example 1, bioluminescence imaging was performed using an IVIS machine 12 days after the start of modeling. The presence of head signals in the mice confirmed successful modeling. Mice 12 days after modeling were anesthetized with aflutin and placed supine on an absorbent pad on the experimental table. The abdominal and thoracic cavities were dissected upwards along the midline, and a small incision was made in the right ventricle. Approximately 50 mL of cold PBS was infused into the left ventricle using a peristaltic pump at a rate of 5 mL / min. The skin and muscles of the head were removed, and the skull was dissected along the midline to expose the brain parenchyma. The brain parenchyma and skull were transferred to a 3.5 cm dish containing 3 mL of complete culture medium. The culture medium was used to rinse the surface of the brain parenchyma and the cranial cavity with a P1000 pipette, yielding a rinsing solution rich in cerebrospinal fluid cell components. The washing solution was centrifuged at 4°C and 400×g for 5 minutes, resuspended in 1 mL of complete culture medium, and 100 μL of the cell suspension was centrifuged onto a glass slide at 700 rpm at room temperature using a cell centrifuge and fixed in 4% paraformaldehyde for 10 minutes. After rinsing twice with PBS (5 minutes each time), it was used for subsequent staining.

[0175] Cerebrospinal fluid cell smears were incubated in TBS buffer containing 0.3% Triton X-100 at room temperature for 15 minutes. A hydrophobic zone was drawn around the cells using a hydrophobic pen. Then, a blocking solution containing 5% donkey serum (#017-000-121, Jackson Immuno Research) in TBS buffer (pH 8.0, 150 mM Tris-HCl, 150 mM NaCl) was added to the hydrophobic zone and incubated at room temperature for 1 hour. After discarding the blocking solution, a primary antibody dilution solution containing goat anti-SPP1 antibody (1:250 dilution, catalog number #AF808, R&D Company) was added to the hydrophobic zone (TBS containing 5% donkey serum) and incubated overnight at 4°C. The primary antibody incubation solution was aspirated, and the cells were washed three times (5 minutes each) with TBS containing 0.05% Tween (TBST). Add a drop of secondary antibody dilution buffer (containing 5% donkey serum in TBS) containing AF488 donkey anti-goat IgG secondary antibody (1:800 dilution, Invitrogen #A-11055, Thermo Fisher Scientific) and AF647 donkey anti-rat IgG secondary antibody (1:800 dilution, Jackson Immunoresearch #712-605-153) to the hydrophobic zone and incubate at room temperature for 1 hour. Aspirate the secondary antibody incubation buffer and wash three times (5 minutes each) with TBST containing 0.05% Tween. Add a drop of TBS containing 1 μg / mL DAPI (Sigma #D8417) to the hydrophobic zone and incubate for 5 minutes. Discard the PBS, add one drop of Fluoro-Gel (Electron Microscopy Sciences #17985) mounting medium, and mount with a coverslip. Subsequent images were taken using an Olympus FV3000 confocal microscope, and the images were analyzed using Image J / FIJI software.

[0176] 2. Results

[0177] Firstly, through bioluminescence imaging, we found that using the leptomeningeal metastasis modeling method described in Example 1, tumor signals could be observed in mice with leptomeningeal metastases along the anatomical locations of the central nervous system (brain and spinal cord) at 12 days. Figure 4 A) Simultaneously, cerebrospinal fluid analysis of model mice also identified the fluorescent protein tdTomato. + tumor cells ( Figure 4 B), these phenomena represent the typical phenotype of leptomeningeal metastases, indicating that the animal model of this tumor was successfully established. Further immunofluorescence staining and statistical analysis of cerebrospinal fluid cells revealed that during the occurrence of leptomeningeal metastases, tumor cells in the cerebrospinal fluid highly expressed SPP1 (B). Figure 4 B, 4C).

[0178] Example 5 analyzes the effects of knocking down SPP1 expression or inhibiting SPP1 function on the progression of leptomeningeal metastases in mice.

[0179] 1. Establishment of cell lines with stable Spp1 knockdown

[0180] This invention utilizes shRNA-based RNA interference and lentiviral infection techniques to achieve stable knockdown of Spp1 in target cells. The first step involves preparing Spp1-shRNA lentiviruses. The lentiviral packaging system employs a three-plasmid system: pLVX, psPAX2, and pMD2.G, with pLVX plasmid used to carry the shRNA. The Spp1 knockdown plasmids used in this invention comprise two sequences: pLVX-Spp1-Sh1 and pLVX-Spp1-Sh3, carrying the following shRNA sequences: Sh1-GCTGAATTCTGAGGGACTAAC, Sh3-GGATGAACCAAGTCTGGAAAC, and the control plasmid is pLVX-ShCtrl. The HEK293T cell line was used for lentiviral packaging. HEK293T cells were seeded in T25 cell culture flasks, and 5 mL of DMEM complete medium containing 10% FBS was added. When the cell density reached approximately 50%, plasmid transfection was performed. For transfection, first prepare 500 μL of Opti-MEM medium (catalog number #Gibico 31985062, Thermo Fisher Scientific) containing 10 μL of liposomes. After standing for 5 minutes, mix with 500 μL of Opti-MEM medium containing 5 μg of lentiviral plasmid (pLVX 2.5 μg; psPAX2 1.87 μg; pMD2.G 0.63 μg). After standing for 20 minutes, add to the cell culture flask. After 6 hours, replace with fresh complete medium. After 48 hours, collect the lentiviral supernatant with a syringe and filter slowly through a 0.45 μm pore size filter.

[0181] The second step involved lentiviral infection of LLC-Luc2-LM cells and screening of the target cell line. LLC-Luc2-LM cells were seeded in 6-well cell culture plates, and 2 mL of complete culture medium was added. When the cell density reached 30%, the old medium was removed, and 1 mL of viral supernatant and 1 mL of fresh complete culture medium were added. Polybrene (catalog number #HY-112735, MedChemExpress) was added to a final concentration of 5 μg / mL. After incubating at 37°C for 24 hours, the medium was replaced with 2 mL of fresh complete culture medium. When the cells reached 90% confluence, they were passaged according to the method in Example 1 at a passage ratio of 1:10. The cells were transferred to new 6-well plates, and after overnight incubation, the old medium was removed, and 1 mL of viral supernatant and 1 mL of fresh complete culture medium were added again, along with polybrene to a final concentration of 5 μg / mL. After incubating at 37°C for 24 hours, the medium was replaced with 2 mL of fresh complete culture medium. Subsequently, whenever the cell density reached 90%, the cells were passaged at a 1:10 ratio. On day 10 post-viral infection, the cell culture medium was changed to complete medium containing 2 μg / mL puromycin for selection. Whenever the cell density reached 90%, the cells were passaged at a 1:10 ratio into 6-well plates. Seven days after drug selection, the cells were expanded by transferring them from 6-well plates to 10 cm culture dishes, and 10 mL of complete medium containing 2 μg / mL puromycin was added. Following the above method, two stably knocked-down Spp1 cell lines and one control cell line were obtained by infecting the cells with Spp1-Sh1, Spp1-Sh3, and ShCtrl viruses, respectively, and named LLC-Luc2-LM-Spp1-Sh1, LLC-Luc2-LM-Spp1-Sh3, and LLC-Luc2-LM-ShCtrl, respectively.

[0182] The third step was to verify the knockdown effect of Spp1 using Western blotting. The same number of LLC-Luc2-LM-Spp1-Sh1, LLC-Luc2-LM-Spp1-Sh3, and LLC-Luc2-LM-ShCtrl cells were seeded into 6-well cell culture plates, and 2 mL of complete culture medium was added for incubation. When the cell density reached 80%, the old culture medium was discarded, and the cells were washed once with 1 mL of PBS. Then, 200 μL of RIPA lysis buffer (pH 7.4, 50 mM Tris-HCl, 150 mM NaCl, 1% NP40, 0.1% SDS) containing a protease inhibitor (#Roche 05892791001, Sigma-Aldrich) was added, and the cells were lysed on ice for 15 minutes. The lysate was transferred to 1.5 mL EP tubes and centrifuged at 4°C and 12000 × g for 20 minutes. The supernatant was transferred to new EP tubes, and quantification was performed according to the BCA protein quantification method. Add 5× loading buffer (pH 6.8, 250 mM Tris-HCl, 10% SDS, 50% glycerol, 0.05% bromophenol blue) to the supernatant, and add mercaptoethanol to a final concentration of 0.145 mM. Boil the sample at 100°C for 10 minutes, and adjust the protein concentration to 1.5 μg / mL with 1× loading buffer. Then, perform polyacrylamide gel electrophoresis according to standard procedures. Prepare a 10% stacking gel and a 5% separating gel with a thickness of 1 mm using the BioRad gel preparation system. After assembling the BioRad electrophoresis tank, load 20 μL (30 μg) of protein into each well using a microsyringe, and load 5 μL of a protein molecular weight marker protein (catalog number #26616, Thermo Fisher Scientific) into one empty well. Start the electrophoresis apparatus and set the voltage sequentially to 80V for the upper gel electrophoresis and 120V for the lower gel electrophoresis.

[0183] After electrophoresis, carefully remove the gel and arrange it in the following order from bottom to top: filter paper-PVDF membrane-gel-filter paper. Then, transfer the membrane using the Biorad transfer system at 80V for 2 hours. After transfer, carefully transfer the PVDF membrane to an incubation chamber, rinse with 1×TBST for 10 minutes, then add TBST containing 5% skim milk powder for blocking. Incubate on a side-shaking incubator at low speed at room temperature for 1 hour. Next, add primary antibody dilution (TBST solution containing 3% BSA) and incubate overnight on a low-speed shaker at 4°C. Rinse three times with TBST (5 minutes each time), then add secondary antibody dilution (TBST solution containing 3% BSA) and incubate on a low-speed shaker at room temperature for 1 hour. Rinse three times with TBST (5 minutes each time). Place the PVDF membrane on the imaging plate of an e-blot imaging system (Shanghai E-Bote Optoelectronic Technology Co., Ltd.) and add an appropriate amount of ECL developing solution for imaging. In this invention, SPP1 is detected first. The primary antibody used is goat anti-SPP1 antibody (1:500 dilution, #AF808, R&D Company), and the secondary antibody is rabbit anti-goat IgG antibody conjugated with horseradish peroxidase (1:5000 dilution, #1721034, BioRad Company). After development, the PVDF membrane is washed three times with TBST (5 minutes each time). Then, the internal control protein β-Actin is detected. The primary antibody used is mouse anti-β-Actin antibody (1:10000 dilution, catalog number #66009-1, Proteintech Company), and the secondary antibody is goat anti-mouse IgG antibody conjugated with horseradish peroxidase (1:5000 dilution, catalog number #L3032, SAB Company).

[0184] 2. Compare tumor growth and survival time between the control group and the LLC cell line with Spp1 knockdown.

[0185] Following the method described in Example 1, LLC-Luc2-LM-Spp1-Sh1, LLC-Luc2-LM-Spp1-Sh3, and LLC-Luc2-LM-ShCtrl cells were injected into different mice to establish a leptomeningeal metastasis model. Then, on day 12 post-modeling, [the tumor was analyzed using...]. The Spectrum in vivo imaging system (PerkinElmer) was used to perform BLI imaging on anesthetized mice to detect and record tumor signals, comparing tumor growth in the Spp1 knockdown tumor cell model group and the control group. Simultaneously, the overall survival of the tumor-bearing mice in the Spp1 knockdown tumor cell model group and the control group was recorded and analyzed.

[0186] 3. Evaluate the therapeutic effect of the SPP1 function inhibitor RGD on leptomeningeal metastases in mice.

[0187] Five mice with leptomeningeal metastases were used in both the control and experimental groups. Following the method described in Example 1, LLC-Luc2-tdTomato-LM cells were used to establish the leptomeningeal model. Control mice were intraperitoneally injected with 100 μL of PBS every two days, while experimental mice were injected every two days with 100 μL of PBS solution containing 100 μg of RGD peptide (catalog number #HY-P0278, MedChemExpress). Then, on day 12 post-modeling, [the mice were...]. The Spectrum in vivo imaging system (PerkinElmer) was used to perform BLI imaging on anesthetized mice to detect and record tumor signals, comparing tumor growth between the control and experimental groups. Simultaneously, the overall survival of the tumor-bearing mice in the experimental and control groups was recorded and statistically analyzed.

[0188] 4. Results

[0189] Lysates of the constructed LLC-Luc2-LM-Spp1-Sh1, LLC-Luc2-LM-Spp1-Sh3, and LLC-Luc2-LM-ShCtrl (control cells) cells were collected and analyzed by Western blotting. The results showed that Spp1-Sh1 and Spp1-Sh3 significantly knocked down Spp1 expression. Figure 5 A). Subsequent in vivo leptomeningeal metastasis modeling experiments revealed that tumor growth in Spp1 knockdown cell line animal models was significantly lower than that in the control group. Figure 5 B), and: the overall survival of cell line animal models with Spp1 knockdown was significantly prolonged ( Figure 5 C). Simultaneously, we found that inhibiting SPP1 function in vivo using RGD significantly reduced the tumor burden in mice with leptomeningeal metastases (C). Figure 5 D) and the survival period is significantly prolonged ( Figure 5 E).

[0190] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. The use of an SPP1 inhibitor, characterized in that, The SPP1 inhibitor is used to prepare drugs for the prevention and / or treatment of leptomeningeal metastases.

2. The use as described in claim 1, characterized in that, The SPP1 inhibitors mentioned are selected from the group consisting of small molecule drugs, peptides, specific antibodies, nucleic acid drugs, gene editing drugs, or combinations thereof.

3. The use as described in claim 1, characterized in that, The SPP1 inhibitor inhibits the binding of SPP1 to Integrin, thereby inhibiting SPP1 function.

4. The use as described in claim 1, characterized in that, The SPP1 inhibitor mentioned is: RGD (Arginine-Glycine-Aspartic acid) peptide; or A polypeptide containing an RGD sequence.

5. The use as described in claim 1, characterized in that, The leptomeningeal metastases are metastases from tumors selected from the group consisting of: lung cancer, breast cancer, melanoma, or a combination thereof.

6. A pharmaceutical composition for treating leptomeningeal metastases, said pharmaceutical composition comprising: (a) SPP1 inhibitors; and (b) Pharmaceutically acceptable carriers.

7. The use of an SPP1 gene, mRNA, cDNA, or protein, or a detection reagent thereof, in the preparation of diagnostic reagents or kits, characterized in that, The diagnostic reagents or kits are used to diagnose leptomeningeal metastases or predict the risk of leptomeningeal metastases.

8. The use as described in claim 7, characterized in that, The SPP1 protein includes SPP1 protein alternative splicing variants, which are selected from the group consisting of OPN-a, OPN-b, OPN-c, OPN-4, and OPN-5.

9. The use as described in claim 7, characterized in that, The leptomeningeal metastases are metastases from tumors selected from the group consisting of: lung cancer, breast cancer, melanoma, or a combination thereof.

10. A diagnostic kit for diagnosing leptomeningeal metastases or predicting the risk of leptomeningeal metastases, characterized in that, The kit contains a container containing a detection reagent for detecting the SPP1 gene, mRNA, cDNA, or protein. Furthermore, the kit includes instructions that state that the kit is used to diagnose leptomeningeal metastases or predict the risk of leptomeningeal metastases.

Images