Multi-carbon source selection marker type strain construction method and related plasmid construction method

Abstract

The invention relates to a multi-carbon source selection marker type strain construction method and a related plasmid construction method. The construction method of the strain comprises the following steps: carrying out competent preparation on a target escherichia coli strain, carrying out transformation by adopting a plasmid as shown in SEQ ID No.1, and carrying out rhamnose induction after the transformation is completed, so as to finally obtain the multi-carbon-source selection marker type strain. The plasmid construction method adopts the multi-carbon source selection marker type strain. According to the invention, the strain can be quickly transformed, so that the strain can be compatible with a plurality of nutrition screening systems, and is suitable for constructing adeno-associated virus plasmids and lentivirus plasmids.

Description

TECHNICAL FIELD

[0001] The present application relates to a method for constructing a multi-carbon source screening marker type strain and a related plasmid construction method, belonging to the field of biotechnology. BACKGROUND

[0002] Plasmid vectors play an important role in the current field of gene therapy. In most cases, plasmids are the key raw materials, including virus packaging, mRNA, circular RNA, self-replicating RNA production, and direct use of plasmids as delivery tools. Plasmid vectors based on E. coli must include a replication origin and a screening marker. The former ensures that the plasmid can be amplified in E. coli, and the latter is the basis for obtaining positive transformants. A suitable screening marker can efficiently obtain positive clones, which is the basic condition for plasmid construction and transformation amplification.

[0003] The commonly used screening markers in the current scientific research field are mainly antibiotic resistance genes, which target antibiotics including penicillin, kanamycin, chloramphenicol, tetracycline, spectinomycin and gentamicin. However, these antibiotics have problems in the field of industrial large-scale production, especially antibiotic residues and antibiotic resistance gene residues, which must be strictly controlled in the production process to ensure that the residual amount of the end product is within the regulatory requirements to avoid clinical adverse events. In addition, these antibiotics have their own problems. For example, penicillin is used a lot in scientific research, but because penicillin is easily degraded, plasmid loss may occur. Most importantly, penicillin and penicillin resistance genes are not allowed to appear in GMP production environments, so they cannot be used in clinical gene therapy. The efficacy of kanamycin will decrease significantly in phosphate buffer systems, which will affect plasmid screening and subsequent maintenance. The appropriate antibiotic concentration range for the other several resistance genes is very narrow. High concentration will inhibit the growth of positive clones, while low concentration will not kill untransformed bacteria.

[0004] In order to obtain antibiotic resistance gene-free plasmids, special strains are usually used. These strains express specific genes that will kill bacteria under specific growth conditions, and the plasmid has a detoxification gene to avoid bacterial death. It is worth noting that these strains must be genetically modified to obtain, and are often patented or kept as a trade secret, which cannot be obtained by purchase. This limits the application of antibiotic resistance gene-free plasmids. SUMMARY

[0005] The main purpose of the present application is to overcome the problems existing in the prior art, and to provide a multi-carbon source screening marker strain construction method, which can systematically edit the wild type and part of the original type of Escherichia coli, so that the nuclease is deleted, the recombination system is deleted, and the T1 phage resistance is obtained at one time, and the ability to use lactose, fructose, glycerol and sorbitol as a screening condition is provided. At the same time, the related plasmid construction method is provided.

[0006] The technical solution of the present application to solve its technical problems is as follows:

[0007] A construction method of a multi-carbon source screening marker strain, characterized by comprising the following steps:

[0008] The target Escherichia coli strain is prepared for competence, and then the plasmid shown in SEQ ID No. 1 is used for transformation. After the transformation is completed, rhamnose induction is carried out, and finally a multi-carbon source screening marker strain is obtained.

[0009] Preferably, the target Escherichia coli strain is a wild type Escherichia coli strain.

[0010] Preferably, the target Escherichia coli strain has at least one of the following genes in the genome: hsdR, recF, endA, fhuA, lacY, fruK, glpK, srlD.

[0011] More preferably, the construction method further comprises: using colony PCR to verify the editing result, wherein corresponding primers are used for each gene verification, specifically:

[0012] For hsdR, SEQ ID No. 2 and SEQ ID No. 3 are used; for recF, SEQ ID No. 4 and SEQ ID No. 5 are used; for endA, SEQ ID No. 6 and SEQ ID No. 7 are used; for fhuA, SEQ ID No. 8 and SEQ ID No. 9 are used; for lacY, SEQ ID No. 10 and SEQ ID No. 11 are used; for fruK, SEQ ID No. 12 and SEQ ID No. 13 are used; for glpK, SEQ ID No. 14 and SEQ ID No. 15 are used; for srlD, SEQ ID No. 16 and SEQ ID No. 17 are used.

[0013] The multi-carbon source screening marker strain prepared by the construction method described in the foregoing.

[0014] The multi-carbon source screening marker strain described in the foregoing is used for constructing a lentivirus plasmid or an adeno-associated virus plasmid based on a lactose, fructose, glycerol or sorbitol screening system.

[0015] A method for constructing a target plasmid, characterized in that the target plasmid is a lentivirus plasmid or an adeno-associated virus plasmid based on a lactose, fructose, glycerol or sorbitol screening system; the method for constructing the target plasmid uses the multi-carbon source screening marker strain described above.

[0016] Preferably, the specific process of the method for constructing the target plasmid is as follows:

[0017] The pLK-LV2-EF1A-mStayGold plasmid shown in SEQ ID No. 22 is double-digested with SmaI / MluI, and the first fragment is recovered by gel recovery; the preset plasmid is amplified using primers SEQ ID No. 24 and SEQ ID No. 25, and the PCR product is recovered by gel recovery as the second fragment; the first fragment and the second fragment are spliced, and the obtained product is transformed into the multi-carbon source screening marker strain, and then the corresponding solid medium plate is coated and cultured to obtain the corresponding lentivirus plasmid;

[0018] When the preset plasmid is the pLevo-lac-Kan plasmid shown in SEQ ID No. 18, the corresponding solid medium plate uses a screening medium containing lactose, and the corresponding lentivirus plasmid is a lentivirus plasmid based on a lactose screening system;

[0019] When the preset plasmid is the pLevo-fru-Kan plasmid shown in SEQ ID No. 19, the corresponding solid medium plate uses a screening medium containing fructose, and the corresponding lentivirus plasmid is a lentivirus plasmid based on a fructose screening system;

[0020] When the preset plasmid is the pLevo-glp-Kan plasmid shown in SEQ ID No. 20, the corresponding solid medium plate uses a screening medium containing glycerol, and the corresponding lentivirus plasmid is a lentivirus plasmid based on a glycerol screening system;

[0021] When the preset plasmid is the pLevo-srl-Kan plasmid shown in SEQ ID No. 21, the corresponding solid medium plate uses a screening medium containing sorbitol, and the corresponding lentivirus plasmid is a lentivirus plasmid based on a sorbitol screening system.

[0022] Preferably, the specific process of the method for constructing the target plasmid is as follows:

[0023] The pLK-AAV-EGFP plasmid shown in SEQ ID No. 23 is digested by EcoRV enzyme, and a first fragment is recovered by cutting and gel recovery; a preset plasmid is amplified by using primers SEQ ID No. 27 and SEQ ID No. 28, and a PCR product is recovered by cutting and gel recovery as a second fragment; the first fragment and the second fragment are spliced, and the obtained product is transformed into a multi-carbon source screening marker strain, and then a corresponding solid culture medium plate is coated and cultured to obtain a corresponding adeno-associated virus plasmid;

[0024] When the preset plasmid is the pLevo-lac-Kan plasmid shown in SEQ ID No. 18, a corresponding solid culture medium plate adopts a screening culture medium containing lactose, and a corresponding adeno-associated virus plasmid is an adeno-associated virus plasmid based on a lactose screening system;

[0025] When the preset plasmid is the pLevo-fru-Kan plasmid shown in SEQ ID No. 19, a corresponding solid culture medium plate adopts a screening culture medium containing fructose, and a corresponding adeno-associated virus plasmid is an adeno-associated virus plasmid based on a fructose screening system;

[0026] When the preset plasmid is the pLevo-glp-Kan plasmid shown in SEQ ID No. 20, a corresponding solid culture medium plate adopts a screening culture medium containing glycerol, and a corresponding adeno-associated virus plasmid is an adeno-associated virus plasmid based on a glycerol screening system;

[0027] When the preset plasmid is the pLevo-srl-Kan plasmid shown in SEQ ID No. 21, a corresponding solid culture medium plate adopts a screening culture medium containing sorbitol, and a corresponding adeno-associated virus plasmid is an adeno-associated virus plasmid based on a sorbitol screening system.

[0028] More preferably, the lentivirus plasmid based on the sorbitol screening system is the pLevo-srl-LV2-EF1A-mStayGold plasmid shown in SEQ ID No. 26; or the adeno-associated virus plasmid based on the sorbitol screening system is the pLevo-srl-AAV-EGFP plasmid shown in SEQ ID No. 29.

[0029] The present application knocks out hsdR, recF, endA, fhuA, lacY, fruK, glpK and srlD of wild type and partial prototrophic Escherichia coli at one time, so that the wild type and partial prototrophic Escherichia coli obtain the characteristics of recombination deletion, nuclease deletion, T1 phage resistance, and lactose, fructose, glycerol and sorbitol metabolic ability deletion; the lactose, fructose, glycerol and sorbitol metabolic ability of the wild type and partial prototrophic Escherichia coli can be compensated by a plasmid containing corresponding genes, so that the screening of plasmid positive transformants is realized.

[0030] This invention can rapidly modify strains to be compatible with multiple nutrient screening systems, and is suitable for constructing adeno-associated virus plasmids and lentivirus plasmids. These plasmids can use culture media with well-defined chemical compositions, making it easier to ensure stable experimental results. The related raw materials are inexpensive and easy to control costs. Attached Figure Description

[0031] Figure 1 The image shows the lentiviral plasmid pLevo-srl-LV2-EF1A-mStayGold used for sorbitol screening, as an example in Example 1 of this invention.

[0032] Figure 2 This is a map of the adeno-associated virus plasmid used for sorbitol screening in this invention. Detailed Implementation

[0033] The present invention will be further described in detail below with reference to the embodiments. However, the present invention is not limited to the examples given.

[0034] Example 1

[0035] The specific details of this embodiment are as follows:

[0036] 1. Gene knockout of wild-type strains using a multi-gene editing system.

[0037] This embodiment uses the main principle of the multi-gene site editing method (CN118460583B) that the applicant has applied for invention patent to knock out genes in wild-type strains.

[0038] (1) The pGM-N plasmid was synthesized by the applicant and its sequence is SEQ ID No.1.

[0039] (2) The following strains were prepared into competent cells and transformed with pGM-N plasmid using the Hanahan method (Molecular Cloning: A Laboratory Manual, 4th Edition, Chapter 3, Scheme 1):

[0040] E.coli str.K-12MG1655 DSM 18039;

[0041] E. coli str Crooks ATCC8739;

[0042] E. coli str C ATCC13706;

[0043] E. coli str B ATCC11303.

[0044] (3) After transformation, rhamnose induction was performed, and the editing results were verified using colony PCR. The primers were as follows:

[0045] For hsdR

[0046] SEQ ID No. 2: GCTCAATGAGTCGTATCGCT

[0047] SEQ ID No. 3: CGACATATTGCGGGTATCAC

[0048] For recF

[0049] SEQ ID No. 4: GTCATTCGCCATGAGCAGGAG

[0050] SEQ ID No. 5: CTGTTCGTAACGTGTCACCTG

[0051] For endA

[0052] SEQ ID No. 6: CGGTAAAAGTCCACGCTGAC

[0053] SEQ ID No. 7: CATTCACCTCACCGACTGAC

[0054] For fhua

[0055] SEQ ID No. 8: CCTGTTCCAGACTGGTTTTG

[0056] SEQ ID No. 9: GGCAACCAGCCGTAATAACC

[0057] For lacY

[0058] SEQ ID No. 10: GCTCTGGCTGTGCACTCATC

[0059] SEQ ID No. 11: GTACCCTGTTCACCGGTAGC

[0060] For fruK

[0061] SEQ ID No. 12: GCTCGGTCAGTTCGATATGG

[0062] SEQ ID No. 13: GGTGGTTTGGCGATCCATTC

[0063] For glpK

[0064] SEQ ID No. 14: CGGCAAGCCTATCTATAACG

[0065] SEQ ID No. 15: GTGTAATCGGTCACATGGAC

[0066] For srlD

[0067] SEQ ID No. 16: CAGGTTGCCGTTGTCATCGG

[0068] SEQ ID No. 17: CTCGCTAGTGGCGTCAGCAC

[0069] Note: Since E. coli str Crooks ATCC8739 and E. coli str C ATCC13706 do not have hsdR gene, these two strains do not need to identify hsdR gene.

[0070] Screening to obtain strains with 8 genes knocked out (E. coli str Crooks ATCC8739 and E. coli str C ATCC13706 are both 7 genes knocked out) are named respectively:

[0071] BN: E. coli str B hsdR recF endA fhuA lacY fruK glpK srlD

[0072] CN: E. coli str C recF endA fhuA lacY fruK glpK srlD

[0073] GN: E. coli str Crooks recF endA fhuA lacY fruK glpK srlD

[0074] MN: E. coli str. K-12 MG1655 hsdR recF endA fhuA lacY fruK glpK srlD

[0075] The above BN, CN, GN, MN are prepared for competent cells using Hanahan method (Molecular Cloning: A Laboratory Manual, 4th Edition, Chapter 3, Protocol 1) respectively.

[0076] 2. Preparation of screening medium

[0077] Lactose Selection Medium (LSM) is prepared as follows: using an analytical balance, weigh the following ingredients: 20 g lactose, 4.2 g citric acid monohydrate, 1.36 g potassium phosphate monobasic anhydrous, 2.92 g sodium chloride, 2.67 g ammonium chloride, 0.493 g magnesium sulfate heptahydrate, add 10 mL triethanolamine, 0.1 mL 1 M calcium chloride, 10 mL 100X M2 trace elements, 25 μL 40 g / L biotin (in DMSO), 10 μL 100 g / L thiamine hydrochloride, mix well, and sterilize at 120 °C for 20 minutes. For the corresponding solid medium, add 15 g / L agar, and obtain a selection plate.

[0078] Fructose Selection Medium (FSM) is prepared as follows: using an analytical balance, weigh the following ingredients: 20 g fructose, 4.2 g citric acid monohydrate, 1.36 g potassium phosphate monobasic anhydrous, 2.92 g sodium chloride, 2.67 g ammonium chloride, 0.493 g magnesium sulfate heptahydrate, add 10 mL triethanolamine, 0.1 mL 1 M calcium chloride, 10 mL 100X M2 trace elements, 25 μL 40 g / L biotin (in DMSO), 10 μL 100 g / L thiamine hydrochloride, mix well, and sterilize at 120 °C for 20 minutes. For the corresponding solid medium, add 15 g / L agar, and obtain a selection plate.

[0079] Glycreol Selection Medium (GSM) is prepared as follows: using an analytical balance, weigh the following ingredients: 20 mL glycerol, 4.2 g citric acid monohydrate, 1.36 g potassium phosphate monobasic anhydrous, 2.92 g sodium chloride, 2.67 g ammonium chloride, 0.493 g magnesium sulfate heptahydrate, add 10 mL triethanolamine, 0.1 mL 1 M calcium chloride, 10 mL 100X M2 trace elements, 25 μL 40 g / L biotin (in DMSO), 10 μL 100 g / L thiamine hydrochloride, mix well, and sterilize at 120 °C for 20 minutes. For the corresponding solid medium, add 15 g / L agar, and obtain a selection plate.

[0080] The preparation method of sorbitol selection medium (SSM) is as follows: the following ingredients are weighed using an analytical balance: 20 g sorbitol, 4.2 g citric acid monohydrate, 1.36 g anhydrous potassium dihydrogen phosphate, 2.92 g sodium chloride, 2.67 g ammonium chloride, 0.493 g magnesium sulfate heptahydrate, 10 mL triethanolamine, 0.1 mL 1M calcium chloride, 10 mL 100X M2 trace elements, 25 μL 40 g / L biotin (dissolved in DMSO), 10 μL 100 g / L thiamine hydrochloride, mix well, sterilize at 120°C for 20 minutes. The corresponding solid medium adds 15 g / L agarose, thereby obtaining a selection plate.

[0081] 3. Lactose, fructose, glycerol, sorbitol selection system applicability test.

[0082] The pLevo-lac-Kan plasmid (SEQ ID No. 18), pLevo-fru-Kan plasmid (SEQ ID No. 19), pLevo-glp-Kan plasmid (SEQ ID No. 20), and pLevo-srl-Kan plasmid (SEQ ID No. 21) were prepared by the applicant. These plasmids were transformed into BN, CN, GN, and MN, respectively; the pLevo-lac-Kan was plated using a lactose selection medium plate, the pLevo-fru-Kan was plated using a fructose selection medium plate, the pLevo-glp-Kan was plated using a glycerol selection medium plate, and the pLevo-srl-Kan was plated using a sorbitol selection medium plate. Four spots were picked from each, and the corresponding liquid medium was used for culture, and the number of positive clones was identified by plasmid extraction. The results are shown in the following table.

[0083] Strains Plasmids Time required for colonies to grow to 0.5 mm radius Number of positive colonies BN pLevo-lac-Kan 38h 4 BN pLevo-fru-Kan 41h 4 BN pLevo-glp-Kan 38h 4 BN pLevo-srl-Kan 38h 4 CN pLevo-lac-Kan 36h 4 CN pLevo-fru-Kan 38h 4 CN pLevo-glp-Kan 36h 4 CN pLevo-srl-Kan 36h 4 GN pLevo-lac-Kan 26h 4 GN pLevo-fru-Kan 30h 4 GN pLevo-glp-Kan 26h 4 GN pLevo-srl-Kan 26h 4 MN pLevo-lac-Kan 32h 4 MN pLevo-fru-Kan 34h 4 MN pLevo-glp-Kan 32h 4 MN pLevo-srl-Kan 32h 4

[0084] As can be seen, except for the growth speed of the fructose selection system being slightly slower, the growth speeds of the lactose, glycerol, and sorbitol selection systems remain consistent in the same strain. The natural differences in the growth speeds of each strain are from fast to slow: Crooks, MG1655, C, and B; these strains exhibit the same growth speed order in M9 or LB medium.

[0085] 4. Construction of lentiviral plasmid or adeno-associated virus plasmid based on lactose, fructose, glycerol, and sorbitol selection systems.

[0086] The pLK-LV2-EF1A-mStayGold plasmid (SEQ ID No. 22) and the pLK-AAV-EGFP plasmid (SEQ ID No. 23) were prepared by the applicant.

[0087] pLK-LV2-EF1A-mStayGold was double digested with Smal / Mlul, the large fragment was recovered by gel extraction, pLevo-lac-Kan was amplified using primers SEQ ID No. 24 and SEQ ID No. 25, the PCR product was recovered by gel extraction, NEBuilder HiFi DNA Assembly Master Mix (E2621) was used for assembly, MN was transformed and plated on LSM solid medium plates, incubated at 37°C for 36h. The target product pLevo-lac-LV2-EF1A-mStayGold.

[0088] pLK-LV2-EF1A-mStayGold was double digested with Smal / Mlul, the large fragment was recovered by gel extraction, pLevo-fru-Kan was amplified using primers SEQ ID No. 24 and SEQ ID No. 25, the PCR product was recovered by gel extraction, NEBuilder HiFi DNA Assembly Master Mix (E2621) was used for assembly, MN was transformed and plated on FSM solid medium plates, incubated at 37°C for 36h. The target product pLevo-fru-LV2-EF1A-mStayGold.

[0089] pLK-LV2-EF1A-mStayGold was double digested with Smal / Mlul, the large fragment was recovered by gel extraction, pLevo-glp-Kan was amplified using primers SEQ ID No. 24 and SEQ ID No. 25, the PCR product was recovered by gel extraction, NEBuilder HiFi DNA Assembly Master Mix (E2621) was used for assembly, MN was transformed and plated on GSM solid medium plates, incubated at 37°C for 36h. The target product pLevo-glp-LV2-EF1A-mStayGold.

[0090] pLK-LV2-EF1A-mStayGold was double digested with Smal / Mlul, the large fragment was recovered by gel extraction, pLevo-srl-Kan was amplified using primers SEQ ID No. 24 and SEQ ID No. 25, the PCR product was recovered by gel extraction, NEBuilder HiFi DNA Assembly Master Mix (E2621) was used for assembly, MN was transformed and plated on SSM solid medium plates, incubated at 37°C for 36h. The target product pLevo-srl-LV2-EF1A-mStayGold (SEQ ID No. 26), an example of its map is shown in Figure 1

[0091] ​pLK-AAV-EGFP was digested with EcoRV, the large fragment was recovered by gel extraction, pLevo-lac-Kan was amplified using primers SEQ ID No. 27 and SEQ ID No. 28, the PCR product was recovered by gel extraction, NEBuilder HiFi DNA Assembly Master Mix (E2621) was used for assembly, MN was transformed and plated on LSM solid medium plates, incubated at 37°C for 36h. The target product pLevo-lac-AAV-EGFP.

[0092] pLK-AAV-EGFP was digested with EcoRV, the large fragment was recovered by gel extraction, pLevo-fru-Kan was amplified using primers SEQ ID No. 27 and SEQ ID No. 28, the PCR product was recovered by gel extraction, NEBuilder HiFi DNA Assembly Master Mix (E2621) was used for assembly, MN was transformed and plated on FSM solid medium plates, incubated at 37°C for 36h. The target product pLevo-fru-AAV-EGFP.

[0093] pLK-AAV-EGFP was digested with EcoRV, the large fragment was recovered by gel extraction, pLevo-glp-Kan was amplified using primers SEQ ID No. 27 and SEQ ID No. 28, the PCR product was recovered by gel extraction, NEBuilder HiFi DNA Assembly Master Mix (E2621) was used for assembly, MN was transformed and plated on GSM solid medium plates, incubated at 37°C for 36h. The target product pLevo-glp-AAV-EGFP.

[0094] pLK-AAV-EGFP was digested with EcoRV, the large fragment was recovered by gel extraction, pLevo-srl-Kan was amplified using primers SEQ ID No. 27 and SEQ ID No. 28, the PCR product was recovered by gel extraction, NEBuilder HiFi DNA Assembly Master Mix (E2621) was used for assembly, MN was transformed and plated on SSM solid medium plates, incubated at 37°C for 36h. The target product pLevo-srl-AAV-EGFP (SEQ ID No. 29), whose map is shown as an example in Figure 2

[0095] ​Eight clones from each plate were picked and grown overnight in 2 mL of the corresponding liquid medium and plasmids were extracted, pLevo-lac / fru / glp / srl-LV2-EF1A-mStayGold was digested with SmaI / MluI and sequenced using SEQ ID No. 30; pLevo-lac / fru / glp / srl-AAV-EGFP was digested with SmaI and sequenced using SEQ ID No. 30. The results are shown in the table below.

[0096] Plasmids Number of positive colonies pLevo-lac-LV2-EF1A-mStayGold 7 pLevo-fru-LV2-EF1A-mStayGold 6 pLevo-glp-LV2-EF1A-mStayGold 6 pLevo-srl-LV2-EF1A-mStayGold 7 pLevo-lac-AAV-EGFP 8 pLevo-fru-AAV-EGFP 6 pLevo-glp-AAV-EGFP 7 pLevo-srl-AAV-EGFP 8

[0097] According to the above results, it can be known that the lactose, fructose, glycerol, sorbitol screening system can be used for lentivirus plasmid and adeno-associated virus plasmid.

[0098] In addition to the above embodiments, the present application can have other implementation manners. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present application.

Claims

1. A method for constructing multi-carbon source screening marker strains, characterized in that, Includes the following steps: The target Escherichia coli strain was prepared into competent cells, and then transformed using the plasmid shown in SEQ ID No.

1. After transformation, rhamnose induction was performed to finally obtain a multi-carbon source screening marker strain.

2. The method for constructing a multi-carbon source screening marker strain according to claim 1, characterized in that, The target Escherichia coli strain is a wild-type Escherichia coli strain.

3. The method for constructing a multi-carbon source screening marker strain according to claim 1, characterized in that, The genome of the target Escherichia coli strain contains at least one of the following genes: hsdR, recF, endA, fhuA, lacY, fruK, glpK, srlD.

4. The method for constructing a multi-carbon source screening marker strain according to claim 3, characterized in that, The construction method also includes: validating the editing results using colony PCR, specifically by using corresponding primers for each gene, as follows: For hsdR, use SEQ ID No. 2 and SEQ ID No. 3; for recF, use SEQ ID No. 4 and SEQ ID No. 5; for endA, use SEQ ID No. 6 and SEQ ID No. 7; for fhuA, use SEQ ID No. 8 and SEQ ID No. 9; for lacY, use SEQ ID No. 10 and SEQ ID No. 11; for fruK, use SEQ ID No. 12 and SEQ ID No. 13; for glpK, use SEQ ID No. 14 and SEQ ID No. 15; for srlD, use SEQ ID No. 16 and SEQ ID No.

17.

5. A multi-carbon source screening marker strain prepared by the construction method according to any one of claims 1 to 4.

6. The application of the multi-carbon source screening marker strain of claim 5 for constructing lentiviral plasmids or adeno-associated virus plasmids based on lactose, fructose, glycerol or sorbitol screening systems.

7. A method for constructing a target plasmid, characterized in that, The target plasmid is a lentiviral plasmid or an adeno-associated virus plasmid based on a screening system of lactose, fructose, glycerol or sorbitol; the construction method uses the multi-carbon source screening marker strain described in claim 5.

8. The method for constructing a target plasmid according to claim 7, characterized in that, The specific process of this construction method is as follows: The pLK-LV2-EF1A-mStayGold plasmid shown in SEQ ID No. 22 was digested with SmaI / MluI double enzymes, and the first fragment was recovered by gel digestion. The pre-set plasmid was amplified using primers SEQ ID No. 24 and SEQ ID No. 25, and the PCR product was recovered by gel digestion as the second fragment. The first and second fragments were spliced ​​together, and the resulting product was transformed into multi-carbon source screening marker strains. Then, it was plated on the corresponding solid medium plates and cultured to obtain the corresponding lentiviral plasmid. When the preset plasmid is the pLevo-lac-Kan plasmid shown in SEQ ID No.18, the corresponding solid culture medium plate uses a screening medium containing lactose, and the corresponding lentiviral plasmid is a lentiviral plasmid based on a lactose screening system. When the preset plasmid is the pLevo-fru-Kan plasmid shown in SEQ ID No.19, the corresponding solid culture medium plate uses a screening medium containing fructose, and the corresponding lentiviral plasmid is a lentiviral plasmid based on a fructose screening system. When the preset plasmid is the pLevo-glp-Kan plasmid shown in SEQ ID No. 20, the corresponding solid culture medium plate uses a screening medium containing glycerol, and the corresponding lentiviral plasmid is a lentiviral plasmid based on a glycerol screening system. When the preset plasmid is the pLevo-srl-Kan plasmid shown in SEQ ID No. 21, the corresponding solid culture medium plate uses a screening medium containing sorbitol, and the corresponding lentiviral plasmid is a lentiviral plasmid based on the sorbitol screening system.

9. The method for constructing a target plasmid according to claim 7, characterized in that, The specific process of this construction method is as follows: The pLK-AAV-EGFP plasmid shown in SEQ ID No. 23 was digested with EcoRV enzyme, and the first fragment was recovered by gel digestion. The pre-set plasmid was amplified using primers SEQ ID No. 27 and SEQ ID No. 28, and the PCR product was recovered by gel digestion as the second fragment. The first fragment and the second fragment were spliced ​​together, and the resulting product was transformed into a multi-carbon source screened marker strain. Then, it was plated on the corresponding solid culture medium plate and cultured to obtain the corresponding adeno-associated virus plasmid. Wherein, when the preset plasmid is the pLevo-lac-Kan plasmid shown in SEQ ID No.18, the corresponding solid culture medium plate uses a screening medium containing lactose, and the corresponding adeno-associated virus plasmid is an adeno-associated virus plasmid based on a lactose screening system; When the preset plasmid is the pLevo-fru-Kan plasmid shown in SEQ ID No.19, the corresponding solid culture medium plate uses a screening medium containing fructose, and the corresponding adeno-associated virus plasmid is an adeno-associated virus plasmid based on a fructose screening system. When the preset plasmid is the pLevo-glp-Kan plasmid shown in SEQ ID No. 20, the corresponding solid culture medium plate uses a screening medium containing glycerol, and the corresponding adeno-associated virus plasmid is an adeno-associated virus plasmid based on a glycerol screening system. When the preset plasmid is the pLevo-srl-Kan plasmid shown in SEQ ID No. 21, the corresponding solid culture medium plate uses a screening medium containing sorbitol, and the corresponding adeno-associated virus plasmid is an adeno-associated virus plasmid based on the sorbitol screening system.

10. A method for constructing a target plasmid according to claim 8 or 9, characterized in that, The lentiviral plasmid based on the sorbitol screening system is the pLevo-srl-LV2-EF1A-mStayGold plasmid shown in SEQ ID No. 26; or the adeno-associated virus plasmid based on the sorbitol screening system is the pLevo-srl-AAV-EGFP plasmid shown in SEQ ID No. 29.

Images