Microorganisms for Enhancing Sialic Acid Production and Their Applications

Abstract

This invention relates to the field of microbial technology, specifically disclosing microorganisms for increasing sialic acid production and their applications. This invention provides a recombinant strain having any of the following variations: (A) nanATEK , pykA and pykF Decreased gene expression, exogenous expression neuBC (B) Expressing GlmS, RpoD, and H-NS mutants; nanATEK , pykA , pykF and nagEBAC Decreased gene expression, exogenous expression neuB , age and GNA1 The gene expresses GlmS, RpoD, and H-NS mutants. This invention utilizes a biosensor system based on the transcriptional regulator NanR to efficiently screen for RpoD and H-NS mutants that can increase the production of sialic acid (N-acetylneuraminic acid), thereby obtaining recombinant bacteria with high sialic acid production, providing a new and efficient method for sialic acid production.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and more specifically, to microorganisms for increasing sialic acid production and their applications. Background Technology

[0002] Sialic acid (also known as N-acetylneuraminic acid) is a naturally occurring nonose sugar derivative and an important component of glycoproteins and glycolipids in animal cells. It participates in various physiological processes such as signal transduction and immune regulation, and possesses antioxidant, anti-inflammatory, antiviral, and nerve development-promoting functions, making it widely applicable in the biomedical, cosmetic, and food industries. Natural sources of N-acetylneuraminic acid include breast milk, casein, and bird's nest, but its low content in natural raw materials and complex purification and extraction processes limit its large-scale industrial production. Microbial fermentation of glucose as a raw material to produce N-acetylneuraminic acid offers advantages such as low cost, high efficiency, and environmental friendliness, making it of significant research and application value. It is necessary to develop more efficient methods for synthesizing N-acetylneuraminic acid. Summary of the Invention

[0003] One of the objectives of this invention is to provide a novel mutant and recombinant strain that can increase the production of sialic acid (N-acetylneuraminic acid).

[0004] This invention provides a recombinant bacterium that, compared with the starting strain, has any of the following changes described in (A) or (B), wherein the starting strain is *Escherichia coli*:

[0005] (A) nanATEK Gene( andA Gene, theT Gene, mother Genes and theK Gene), pykA Genes and pykF Decreased gene expression, exogenous expression neuBC Gene( neuB Genes and neuC Genes), expressing GlmS mutant, RpoD mutant and H-NS mutant;

[0006] (B) nanATEK Gene, pykA Gene, pykF Genes and EBAC Gene( nage Gene, andB Gene, thatA Genes and andC The expression level of the gene is reduced, and the exogenous expression is reduced. neuB Gene, age Genes and GNA1Genes expressing GlmS mutants, RpoD mutants, and H-NS mutants;

[0007] The nanATEK The NCBI accession numbers for the proteins encoded by the genes are AAC76257.1 ( andA (Gene-encoded protein), AAC76256.2 ( theT (Gene-encoded protein), AAC76255.1 ( mother (Gene-encoded protein), AAC76254.2 ( theK (The gene-encoded protein); the pykA The NCBI accession number for the protein encoded by the gene is AAC74924.1; pykF The NCBI accession number for the protein encoded by the gene is AAC74746.1;

[0008] The neuBC The NCBI accession numbers for the proteins encoded by the genes are WP_002874241.1 ( neuB (Gene-encoded protein), WP_002874240.1 ( neuC (Gene-encoded proteins);

[0009] The GlmS mutant, compared to the wild-type GlmS protein, has the following mutations: glutamic acid (E) at position 15 is mutated to lysine (K), aspartic acid (D) at position 387 is mutated to valine (V), serine (S) at position 450 is mutated to proline (P), and glutamic acid (E) at position 525 is mutated to glycine (G); the NCBI accession number of the wild-type GlmS protein is AAC76752.1.

[0010] The RpoD mutant and the H-NS mutant are described in any one of (1)-(7) below:

[0011] (1) The RpoD mutant has a mutation at position 278, where aspartic acid (D) is mutated to glutamic acid (E) or at position 537, where threonine (T) is mutated to serine (S) compared to the wild-type RpoD protein; the H-NS mutant has a mutation at position 51, where valine (V) is mutated to isoleucine (I) compared to the wild-type H-NS protein;

[0012] (2) The RpoD mutant has a mutation at position 66, where methionine (M) is mutated to leucine (L), compared to the wild-type RpoD protein; the H-NS mutant has a mutation at position 77, where asparagine (N) is mutated to serine (S), compared to the wild-type H-NS protein.

[0013] (3) The RpoD mutant has a mutation at position 66 (methionine (M) to leucine (L) and position 537 (threonine (T) to serine (S)) compared to the wild-type RpoD protein; the H-NS mutant has a mutation at position 77 (asparagine (N) to serine (S) compared to the wild-type H-NS protein.

[0014] (4) The RpoD mutant has the following mutations compared to the wild-type RpoD protein: methionine (M) at position 66 is mutated to leucine (L), leucine (L) at position 174 is mutated to methionine (M), and threonine (T) at position 537 is mutated to serine (S); the H-NS mutant has the following mutations compared to the wild-type H-NS protein: valine (V) at position 51 is leucine (I) and asparagine (N) at position 77 is mutated to serine (S).

[0015] (5) The RpoD mutant has the following mutations compared to the wild-type RpoD protein: methionine (M) at position 66 is mutated to leucine (L), aspartic acid (D) at position 278 is mutated to glutamic acid (E), and threonine (T) at position 537 is mutated to serine (S); the H-NS mutant has the following mutations compared to the wild-type H-NS protein: valine (V) at position 51 is leucine (I) and asparagine (N) at position 77 is mutated to serine (S).

[0016] (6) The RpoD mutant has the following mutations compared to the wild-type RpoD protein: leucine (L) at position 174 is mutated to methionine (M), aspartic acid (D) at position 278 is mutated to glutamic acid (E), and threonine (T) at position 537 is mutated to serine (S); the H-NS mutant has the following mutations compared to the wild-type H-NS protein: valine (V) at position 51 is mutated to isoleucine (I) and asparagine (N) at position 77 is mutated to serine (S).

[0017] (7) The RpoD mutant has the following mutations compared to the wild-type RpoD protein: methionine (M) at position 66 is mutated to leucine (L), leucine (L) at position 174 is mutated to methionine (M), aspartic acid (D) at position 278 is mutated to glutamic acid (E), and threonine (T) at position 537 is mutated to serine (S); the H-NS mutant has the following mutations compared to the wild-type H-NS protein: valine (V) at position 51 is leucine (I) and asparagine (N) at position 77 is mutated to serine (S);

[0018] The NCBI accession number for the wild-type RpoD protein is AAC76103.1; the NCBI accession number for the wild-type H-NS protein is AAC74319.1.

[0019] The EBAC The NCBI accession numbers for the proteins encoded by the genes are AAC73773.1 ( nage (Gene-encoded protein), AAC73772.1 ( andB (Gene-encoded protein), AAC73771.1 ( thatA (Gene-encoded protein), AAC73770.1 ( andC (The gene-encoded protein); the neuB The NCBI accession number for the gene-encoded protein is WP_002874241.1; age The NCBI accession number for the protein encoded by the gene is ABG57043.1; GNA1 The NCBI accession number for the protein encoded by the gene is WNV72244.1;

[0020] Preferably, the recombinant strain, compared to the starting strain, further exhibits the changes described in (A). ackA Genes and ldhA The expression level of genes is reduced;

[0021] The ackA The NCBI accession number for the protein encoded by the gene is AAC75356.1;

[0022] The ldhA The NCBI accession number for the protein encoded by the gene is AAC74462.1.

[0023] Global transcription factors (GTFs) are a class of transcriptional regulatory proteins that can broadly regulate the expression of multiple genes by altering RNA polymerase activity or its binding affinity to DNA. Mutating the genes encoding GTFs can simultaneously regulate the transcription of multiple genes and metabolic pathways, avoiding metabolic imbalances caused by single-gene modification, and potentially leading to strains with increased yields of target products. RpoD and H-NS are two important GTFs in *E. coli*, regulating the expression of more than 2000 and more than 200 genes, respectively. This invention uses a biosensor system based on the transcriptional regulator NanR to screen for GTF mutants (RpoD mutant and H-NS mutant) that can produce high levels of N-acetylneuraminic acid. These mutants then replace wild-type RpoD and H-NS in *E. coli* strains that synthesize N-acetylneuraminic acid, thereby increasing N-acetylneuraminic acid production.

[0024] The present invention relates to a biosensor system based on the transcriptional regulator NanR, comprising components controlled by the BBa_J23104 promoter. theR Gene expression sequence PJ23104-nanR and by andA Chloramphenicol resistance gene controlled by the promoter PnanA catThe expression sequence is PnanA-cat; the expression of the PJ23104-nanR expression sequence is controlled by the replicon CDF ori.

[0025] The sequence of the BBa_J23104 promoter is shown as the first to 35 bases of SEQ ID NO:3;

[0026] The theR The sequence of the gene is shown in bases 64 to 855 of SEQ ID NO:3, and the NCBI accession number of the protein it encodes is AAC76258.1;

[0027] The andA The sequence of the gene promoter is shown in bases 1 to 63 of SEQ ID NO:4;

[0028] The chloramphenicol resistance gene cat The sequence is shown in bases 90 to 749 of SEQ ID NO:4, and the NCBI accession number of the protein it encodes is WRO64837.1.

[0029] Preferably, the nucleotide sequence of PJ23104-nanR is shown in SEQ ID NO:3; and the nucleotide sequence of PnanA-cat is shown in SEQ ID NO:4.

[0030] The biosensor system of this invention can be used to screen for gene mutants that can increase the yield of a target product. Specifically, when the yield of the target product (N-acetylneuraminic acid) is low in the presence of chloramphenicol, the NanR protein can bind to the binding site in the PnanA promoter, thereby inhibiting the chloramphenicol resistance gene. cat Transcription slows down strain growth; when the target product (N-acetylneuraminic acid) is produced in high quantities, the NanR protein dissociates, thus preventing it from binding to the binding site in the PnanA promoter, and the chloramphenicol resistance gene... cat Normal transcription causes the strain to grow faster than the target product (N-acetylneuraminic acid) when the yield is low. Therefore, when multiple mutants from the gene mutant library to be screened are simultaneously transferred into the chassis strain along with the biosensor system of this invention, mutants that may be beneficial to increasing the yield of the target product can be quickly and initially screened by observing the growth of the strains. Then, combined with actual fermentation experiments, mutants that help increase the yield of the target substance can be obtained efficiently.

[0031] In the biosensor system of the present invention, the replicon CDF ori is specifically used to control the expression of the PJ23104-nanR expression sequence, thereby achieving better screening results.

[0032] The present invention also provides the application of the above-described biosensor system in the screening of gene mutants.

[0033] As a specific implementation, the biosensor system described above can be used to screen for gene mutants that contribute to increased N-acetylneuraminic acid production.

[0034] The present invention also provides a method for screening gene mutants based on the above-mentioned biosensor system, comprising:

[0035] Construct a mutant library of genes to be screened;

[0036] PJ23104-nanR and PnanA-cat were introduced into the chassis strain, and the wild-type gene to be screened in the chassis strain was knocked out and replaced with the gene in the mutant library to obtain a variety of recombinant bacteria carrying different mutant genes to be screened; the chassis strain can produce the target product.

[0037] The various recombinant bacteria were cultured in a chloramphenicol-containing medium to enrich the recombinant bacteria with faster growth.

[0038] The fast-growing recombinant bacteria were subjected to fermentation tests to screen for recombinant bacteria with high yield of the target product.

[0039] The target gene mutants were obtained by analyzing the recombinant bacteria with high yield of the target product.

[0040] Preferably, a mutant library of the gene to be screened is obtained by performing error-prone PCR amplification on the gene to be screened; and / or, recombinant bacteria with faster growth are enriched by continuous passage.

[0041] As a specific implementation, this invention constructs an N-acetylneuraminic acid biosensor system based on the transcriptional regulatory factor NanR, which respectively uses... rpoD or hns As the genes to be screened, strains capable of producing N-acetylneuraminic acid were used as chassis strains, and RpoD and H-NS mutants that are conducive to N-acetylneuraminic acid synthesis were screened using the above method.

[0042] In this invention, when replacing wild-type RpoD and H-NS with RpoD mutants and H-NS mutants, the wild-type strains in the chassis strain can be removed first. rpoD and hns Gene knockout is performed, followed by the introduction of expression plasmids carrying the coding genes for the RpoD and H-NS mutants into the strain; alternatively, the wild-type strain in the chassis strain can be knocked out first. rpoD and hns Gene knockout was performed, followed by in situ integration of the coding genes for RpoD mutant and H-NS mutant into the strain genome.

[0043] The present invention neuBC Genes originate from Campylobacterjejuni To facilitate expression in *E. coli*, it is preferable to optimize the sequence for *E. coli* codons. For example, the optimized sequence is shown in SEQ ID NO:1.

[0044] The present invention glmS Genes originate from Escherichia coli The mutated gene is shown in SEQ ID NO:2.

[0045] The present invention neuB Genes originate from Campylobacterjejuni , age Genes originate from Anabaena sp. CH1, GNA1 Genes originate from Saccharomyces cerevisiae To facilitate expression in *E. coli*, the sequence is preferably optimized to match *E. coli* codons. For example, the optimized sequences are shown as bases 1 to 1041 of SEQ ID NO:1, SEQ ID NO:32, and SEQ ID NO:33, respectively.

[0046] The present invention also provides a global transcription factor mutant, which is an RpoD mutant or an H-NS mutant; the RpoD mutant and the H-NS mutant are respectively described above.

[0047] The present invention also provides a nucleic acid encoding the above-mentioned global transcription factor mutant; preferably, a recombinant bacterium having a nucleotide sequence as shown in SEQ ID NO:5 or 6, containing this preferred nucleic acid sequence, can obtain a higher yield of N-acetylneuraminic acid.

[0048] The present invention also provides biological materials containing the above-mentioned nucleic acids, wherein the biological materials are expression cassettes, vectors or host cells.

[0049] This invention also provides any of the following applications of the above-mentioned recombinant bacteria, global transcription factor mutants, nucleic acids, or biological materials:

[0050] (1) Fermentation production of sialic acid;

[0051] (2) Microbial genetic breeding for the production of sialic acid;

[0052] (3) Increase the yield of sialic acid produced by fermentation.

[0053] The global transcription factor mutant of the present invention can be combined with other modifications that are beneficial to the production of N-acetylneuraminic acid (sialic acid) to obtain more recombinant bacteria that can produce high levels of N-acetylneuraminic acid, thereby realizing the genetic breeding of microorganisms that produce N-acetylneuraminic acid.

[0054] The present invention also provides a method for constructing recombinant bacteria, comprising the steps described in (1) or (2) below:

[0055] (1) To make the recombinant bacteria nanATEK Gene, pykA Genes and pykF Decreased gene expression, exogenous expression neuBC Genes expressing GlmS mutants, RpoD mutants, and H-NS mutants;

[0056] Preferably, it further includes causing the recombinant bacteria to... ackA Genes and ldhA The expression level of genes is reduced;

[0057] (2) To make the recombinant bacteria nanATEK Gene, pykA Gene, pykF Genes and EBAC Decreased gene expression, exogenous expression neuB Gene, age Genes and GNA1 Genes expressing GlmS mutants, RpoD mutants, and H-NS mutants;

[0058] The nanATEK Gene, pykA Gene, pykF Gene, neuBC Gene, glmS mutant, RpoD mutant, H-NS mutant, ackA Gene, ldhA Gene, EBAC Gene, neuB Gene, age Genes and GNA1 The genes are as described above.

[0059] In the method of the present invention, the starting strain of the recombinant bacteria is Escherichia coli.

[0060] The beneficial effects of this invention are at least as follows:

[0061] This invention provides a method for increasing sialic acid production by mutating global transcription factors RpoD and H-NS. This method uses recombinant bacteria containing RpoD and H-NS mutants for production, which can increase sialic acid production by up to 52.82%, thereby improving production efficiency and saving production costs. Detailed Implementation

[0062] The preferred embodiments of the present invention will now be described in detail with reference to specific examples. It should be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0063] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available or prepared according to conventional methods in the art.

[0064] The specific implementation of this invention mainly includes: (1) constructing an N-acetylneuraminic acid biosensor system based on NanR; (2) screening the RpoD mutant library and the H-NS mutant library respectively through the N-acetylneuraminic acid biosensor system, and identifying mutation sites that are beneficial to increasing N-acetylneuraminic acid production; (3) performing combined tests on the RpoD and H-NS mutation sites that are beneficial to increasing N-acetylneuraminic acid production, and obtaining strains that further increase N-acetylneuraminic acid production.

[0065] Example 1: Construction of an N-acetylneuraminic Acid Biosensor System

[0066] Construction of N-acetylneuraminic acid-producing strains. Using strains derived from... Campylobacterjejuni of neuBC Gene( neuB The gene nucleic acid sequence range is NCBI Reference Sequence: NZ_AIOE01000020.1 complement(14311..15351). neuC The gene nucleic acid sequence range is NCBI Reference Sequence: NZ_AIOE01000020.1 complement (13196..14314), and the NCBI accession numbers for the NeuB and NeuC proteins encoded by it are WP_002874241.1 and WP_002874240.1, respectively. The gene sequence was optimized for E. coli codons, and the CjneuBC sequence was artificially synthesized (as shown in SEQ ID NO:1). The sequence was derived from... Escherichia coli of glmS The gene (whose nucleic acid sequence range is GenBank: U00096.3 complement(3911839..3913668), whose NCBI accession number for the wild-type GlmS protein is AAC76752.1) was modified to include E15K, D387V, S450P, and E525G mutations in its encoded enzyme, and codon optimization was performed before artificial synthesis. Sequence (as shown in SEQ ID NO:2); CjneuBC and The sequences were linked to the backbone of the pTrc99a plasmid (purchased from Addgene plasmid, catalog number 155179) via Gibson assembly between the sequences tttcacacaggaaacagacc (SEQ ID NO:17) and ggctgttttggcggatgaga (SEQ ID NO:18) for expression (the gene sequences were linked by RBS sequences to achieve expression after the same promoter, specifically...). neuB and neuC The RBS sequence between genes is AGAAAAGGTGTGTTG (SEQ ID NO:34). neuC and The RBS sequence between genes is gcctgccgtcacaggagacttata (SEQ ID NO:35)), and the recombinant plasmid pLSM01 is obtained. The pLSM01 plasmid is transformed into Escherichia coli MG1655 (ATCC 700926) to obtain the recombinant strain STR01.

[0067] Knockout on the MG1655 genome using CRISPR / Cas9-based genome editing methods nanATEK Gene clusters ( andA The gene nucleic acid sequence range is GenBank: U00096.3 complement (3372683..3373576). theT The gene nucleic acid sequence range is GenBank: U00096.3 complement (3371084..3372574). mother The gene's nucleic acid sequence range is GenBank: U00096.3 complement (3370347..3371036). theK The gene's nucleic acid sequence range is GenBank: U00096.3 complement (3369475..3370350), and the NCBI accession numbers for the encoded proteins NanA, NanT, NanE, and NanK are AAC76257.1, AAC76256.2, AAC76255.1, and AAC76254.2, respectively. Recombinant strain STR02 was obtained, and the gene was knocked out in the STR02 genome. pykAA recombinant strain STR03 was obtained by knocking out the gene (its nucleic acid sequence range is GenBank: U00096.31937649..1939091, and the NCBI accession number of the protein it encodes is AAC74924.1). pykF The recombinant strain STR04 was obtained from the gene (its nucleic acid sequence range is GenBank: U00096.31755698..1757110, and the NCBI accession number of the protein it encodes is AAC74746.1). Specific genome editing methods are described below. pykA Taking gene knockout as an example, using the STR02 genome as a template, the upstream homologous arm pykA-U was amplified using primers pykA-UF (gaattgtagcgacggagacgtgg, SEQ ID NO:7) and pykA-UR (aatacgcatgtaatactccgttgactgaaacaacca, SEQ ID NO:8), and the downstream homologous arm pykA-D was amplified using primers pykA-DF (cggagtattacatgcgtattttaacggtagagtaagtacgttgccg, SEQ ID NO:9) and pykA-DR (tcaggatcatggcccagagca, SEQ ID NO:10). The pykA-U and pykA-D fragments were then subjected to overlap PCR to obtain the targeted fragment pykA-Donor. Using plasmid pTargeF (purchased from Addgene plasmid, catalog number 62226) as a template, plasmid pTarget-pykA was amplified using primers pTarget-pykA-F (tgttgccaaggttgaacgtggttttagagctagaaatagcaagttaaaataaggctag, SEQ ID NO:11) and pTarget-pykA-R (cacgttcaaccttggcaacaactagtattatacctaggactgagctagctg, SEQ ID NO:12) to obtain plasmid pTarget-pykA. Plasmid pCas (purchased from Addgene plasmid, catalog number 62225), along with the targeting fragment pykA-Donor and plasmid pTarget-pykA, were electroporated into recombinant strain STR02 to obtain a knockout fragment in the STR02 genome. pykA The recombinant strain STR03, nanATEK Gene clusters and pykF The same principle applies to gene knockout methods.

[0068] The pLSM01 plasmid was transformed into strains STR02 and STR04, respectively, to obtain recombinant strains STR05 and STR06.

[0069] Testing of N-acetylneuraminic acid producing strains. Recombinant strains STR01, STR05, and STR06 were cultured overnight on LB agar plates. Single colonies were picked and inoculated into test tubes containing 5 mL of LB medium, and cultured at 37°C and 200 rpm for 12 hours. Then, 5% of the inoculum was inoculated into 500 mL shake flasks with baffles containing 50 mL of M9Y-glucose fermentation medium, and cultured at 37°C and 200 rpm until OD500. 600 The concentration was 0.6, 1 mM IPTG was added, and the culture was continued for 48 hours.

[0070] The formula for M9Y-glucose fermentation medium is as follows: glucose 30g / L, dipotassium hydrogen phosphate 16g / L, potassium dihydrogen phosphate 14g / L, sodium citrate dihydrate 1g / L, ammonium sulfate 7.5g / L, magnesium sulfate heptahydrate 0.25g / L, calcium chloride 15mg / L, and yeast extract 5g / L.

[0071] Antibiotics are added to the culture medium as needed. The working concentrations of each antibiotic are as follows: ampicillin 100 mg / L, kanamycin 50 mg / L, streptomycin 50 mg / L, and chloramphenicol 25 mg / L.

[0072] In this fermentation experiment, only 100 mg / L of ampicillin was added.

[0073] The product concentration of the samples after 48 h of fermentation was determined by high performance liquid chromatography, and the results are shown in Table 1.

[0074] Table 1. Test results of N-acetylneuraminic acid producing strains

[0075]

[0076] The results in Table 1 show that strains STR01, STR05 and STR06 were able to synthesize N-acetylneuraminic acid in different quantities.

[0077] Construction of an N-acetylneuraminic acid biosensor system. An N-acetylneuraminic acid biosensor system based on the transcriptional regulator NanR was employed. This system comprises two components: one controlled by the BBa_J23104 promoter (shown in bases 1 to 35 of SEQ ID NO:3). theR The gene (whose nucleic acid sequence is shown in bases 64 to 855 of SEQ ID NO:3, and whose encoded protein has the NCBI accession number AAC76258.1) expression sequence PJ23104-nanR (as shown in SEQ ID NO:3), is expressed by... andAChloramphenicol resistance gene controlled by the gene promoter PnanA (shown in bases 1 to 63 of SEQ ID NO:4) cat (Its nucleic acid sequence is shown as bases 90 to 749 of SEQ ID NO:4, and the NCBI accession number of the protein it encodes is WRO64837.1) Expression sequence PnanA-cat (as shown in SEQ ID NO:4).

[0078] The expected performance of the N-acetylneuraminic acid biosensor system is that, in the presence of chloramphenicol, when N-acetylneuraminic acid production is low, the NanR protein (NCBI accession number AAC76258.1) binds to the binding site in the PnanA promoter, inhibiting the chloramphenicol resistance gene. cat Transcription slows bacterial growth; when N-acetylneuraminic acid production is high, the NanR protein dissociates and cannot bind to the binding site in the PnanA promoter, thus affecting the chloramphenicol resistance gene. cat Normal transcription occurs when the strain grows faster than when N-acetylneuraminic acid production is low.

[0079] Introducing chloramphenicol resistance gene into N-acetylneuraminic acid synthase strains cat The expression sequence PnanA-cat is given, and at the same time, respectively... theR The gene expression sequence PJ23104-nanR was cloned into plasmids containing three different replicons to construct three N-acetylneuraminic acid biosensor systems based on the transcriptional regulator NanR. Their performance was characterized with the addition of chloramphenicol.

[0080] The specific implementation method is as follows: chloramphenicol resistance gene cat The expressed sequence PnanA-cat was cloned into the atgaccaaaatcccttaacg (SEQ ID NO:19) and tgagttttcgttccactgag (SEQ ID NO:20) sequences of the pLSM01 plasmid using Gibson assembly to obtain the recombinant plasmid pLSM02; theR The gene expression sequence PJ23104-nanR was cloned into the pBbA1k plasmid (purchased from Addgene, plasmid catalog number 35336, p15A ori, Kan) via Gibson assembly. R Between the sequences aaatattctgaaatgagctg (SEQ ID NO:21) and tttatacctagggatatatt (SEQ ID NO:22), the pCDFDuet-1 plasmid (purchased from Addgene, plasmid catalog number 172718, CDF ori (CloDF13 ori), Sm RThe sequences cgactcctgcattaggaaat (SEQ ID NO:23) and ctgaaacctcaggcatttga (SEQ ID NO:24) are intersected with those of the pLSM02 plasmid (pBR322 ori, Amp). R cgtagaaaagatcaaaggat (SEQ ID NO:25) and cttcttgagatccttttttt (SEQ ID NO:25) Recombinant plasmids pLSM03, pLSM04, and pLSM05 were obtained from the sequence NO:26. The above N-acetylneuraminic acid synthesis-related gene expression plasmids and N-acetylneuraminic acid sensor system-related gene expression plasmids were transformed into different host strains to construct nine N-acetylneuraminic acid synthesizing strains with sensor systems (STR07, STR08, STR09, STR10, STR11, STR12, STR13, STR14, STR15). These strains were cultured and induced in M9Y-glucose fermentation medium (the specific fermentation method is as described above). Chloramphenicol was added to the medium, and corresponding antibiotics were added according to the resistance genes in the plasmids of each strain (the concentrations are as described above). The N-acetylneuraminic acid yield and specific growth rate of each strain were tested. The specific growth rate was the ratio of ln(X2)-ln(X1) to t2-t1 (t1 and t2 are two time points in the logarithmic growth phase, and X1 and X2 are the OD values ​​at time points t1 and t2, respectively). 600 The strain information and test results are shown in Table 2.

[0081] Table 2. Test results of the N-acetylneuraminic acid biosensor system

[0082]

[0083] The results in Table 2 show that among the N-acetylneuraminic acid biosensor systems constructed from NanR expression plasmids with three different replicons, the system expressing NanR using the CDF ori replicon performs best. Specifically, for strains STR10, STR11, and STR12, higher N-acetylneuraminic acid production correlates with significantly higher specific growth rates. Further modification of strain STR12 and screening using its associated N-acetylneuraminic acid sensor system are expected to identify strains with even higher N-acetylneuraminic acid production based on specific growth rates.

[0084] Example 2: Screening of RpoD mutant library and H-NS mutant library

[0085] 1. Construction of the RpoD mutant library and the H-NS mutant library:

[0086] (1) Using the genome of Escherichia coli MG1655 as a template, primers RpoD-Mutant-F (ggttctggcaagaacgattaatgccaaaagcggcag, SEQ ID NO:13) and RpoD-Mutant-R (agatccttactaggcgctggtagtgcgtgg, SEQ ID NO:14) were used to target the target genome. rpoD The gene expression sequence (its nucleic acid sequence range is GenBank: U00096.3 3213047..3214888, and the NCBI number of the protein it encodes is AAC76103.1) was amplified by error-prone PCR. The error-prone PCR product was purified and recovered, and cloned into the pBbA1k plasmid backbone by Gibson assembly. The ligation product was transformed into E. coli DH5α competent cells. After recovery, the cells were plated on solid medium supplemented with kanamycin. All transformants were collected and resuspended in 4 mL of LB medium supplemented with kanamycin. After incubation at 37°C and 200 rpm for 4 h, the plasmid was extracted to obtain the RpoD mutant library.

[0087] (2) Using the Escherichia coli MG1655 genome as a template, primers H-NS-Mutant-F (ggttctggcaagcgaaatcatcggtgtaaatagggct, SEQ ID NO:15) and H-NS-Mutant-R (agatccttactgtcttaaaccggacaataaaaaatcccgc, SEQ ID NO:16) were used to target... hns The gene (whose nucleic acid sequence range is GenBank: U00096.3complement(1292509..1292922), and the NCBI number of the protein it encodes is AAC74319.1) expression sequence was amplified by error-prone PCR. The H-NS mutant library was prepared by purifying and recovering the error-prone PCR product, Gibson assembly, transformation and extraction of transformant plasmids. The specific operation method is the same as that for preparing the RpoD mutant library.

[0088] 2. Construction of control strains:

[0089] The control strains used to screen the RpoD and H-NS mutant libraries were STR12-C1 and STR12-C2, respectively.

[0090] (1) The construction method of STR12-C1 strain is as follows: primers RpoD-Mutant-F and RpoD-Mutant-R were used to construct wild-type strain. rpoDGene expression sequences were amplified by PCR, and the PCR products were purified and recovered, then cloned into the pBbA1k plasmid backbone via Gibson assembly to obtain the recombinant plasmid pLSM06. A CRISPR / Cas9-based genome editing method was used to obtain the gene expression sequence knocked out of the STR12 strain genome. rpoD The recombinant strain STR16-D1 was obtained by transforming plasmid pLSM06 into strain STR16-D1 to obtain the recombinant strain STR12-C1.

[0091] (2) The construction method of STR12-C2 strain is as follows: primers H-NS-Mutant-F and H-NS-Mutant-R were used to construct the wild-type strain. hns Gene expression sequences were amplified by PCR, and the PCR products were purified and recovered before being cloned into the pBbA1k plasmid backbone via Gibson assembly to obtain the recombinant plasmid pLSM07. A CRISPR / Cas9-based genome editing method was used to obtain the gene expression sequence knocked out of the STR12 strain genome. hns The recombinant strain STR16-D2 was obtained by transforming plasmid pLSM07 into strain STR16-D2 to obtain recombinant strain STR12-C2.

[0092] 3. Screening of RpoD mutant libraries and H-NS mutant libraries:

[0093] The screening method for the RpoD mutant library is as follows: The RpoD mutant library was transformed into the STR16-D1 strain. The transformation products were spread on solid medium supplemented with kanamycin, ampicillin, and streptomycin. To screen for strains with increased N-acetylneuraminic acid production, transformants were collected and transferred to M9Y-glucose fermentation medium supplemented with chloramphenicol, kanamycin, ampicillin, and streptomycin for culture and induction (see Example 1 for specific methods). The fastest-growing strains were enriched. The enrichment method was: when the bacterial culture OD... 600 When the OD value reaches 1.5, 1% is transferred to fresh culture medium for subculturing. After subculturing, wait for the OD value of the bacterial culture to increase. 600 When the culture medium reached 1.5, the culture was transferred to fresh medium for a second subculture. This process was repeated until the fifth subculture. The bacterial culture was then spread onto a solid medium, and 10 single colonies were randomly selected and labeled as strains STR17 to STR26. The N-acetylneuraminic acid (NNA) production of strains STR17 to STR26 was tested using the fermentation test method for NNA production strains described in Example 1, with strain STR12-C1 serving as a control. Similarly, the H-NS mutant library was transferred into strain STR16-D2, and the H-NS mutant library was screened. Strains STR27 to STR36 were selected and fermented to test NNA production, with strain STR12-C2 serving as a control. The test results are shown in Table 3.

[0094] Table 3. Test results of RpoD mutant and H-NS mutant strains

[0095]

[0096] The test results in Table 3 show that among the RpoD mutant strains STR17 to STR26, 6 strains had higher N-acetylneuraminic acid (NNA) production than the control strain STR12-C1. Among them, strain STR21 achieved an NNA production of 5.57 g / L, a 35.52% increase compared to STR12-C1. Among the H-NS mutant strains STR27 to STR36, 5 strains had higher NNA production than the control strain STR12-C2. Among them, strain STR32 achieved an NNA production of 4.92 g / L, an 18.84% increase compared to STR12-C2. Sequencing revealed that strain STR21's RpoD mutation contained four mutations: M66L, L174M, D278E, and T537S, while strain STR32's H-NS mutation contained two mutations: V51I and N77S.

[0097] Example 3: Testing of the RpoD and H-NS combined mutant strain

[0098] Construction of the control strain STR06-C. A CRISPR / Cas9-based genome editing method was used to obtain a genome in strain STR06 with knockout cells. rpoD Genes and hns The recombinant strain of the gene was named STR37. Primers RpoD-Mutant-F and RpoD-H-NS-R (taagacgatccttactaggcgctggtagtgcgtgg, SEQ ID NO:27) were used to target the wild-type strain. rpoD The gene expression sequence was amplified by PCR to obtain the fragment RpoD-WT. Primers RpoD-H-NS-F (gcgcctagtaaggatcgtcttaaaccggacaataaaaaatcccgc, SEQ ID NO:28) and H-NS-R (tgatgcctggagcgaaatcatcggtgtaaatagggct, SEQ ID NO:29) were used to target the wild-type gene. hnsThe gene expression sequence was amplified by PCR to obtain the fragment H-NS-WT. The fragments RpoD-WT and H-NS-WT were cloned into the pBbA1k plasmid backbone between the sequences catcataacggttctggcaa (SEQ ID NO:30) and tccaggcatcaaataaaacg (SEQ ID NO:31) to obtain the recombinant plasmid pLSM08; the plasmid pLSM08 was transformed into strain STR37 to obtain the recombinant strain STR06-C.

[0099] Testing of RpoD and H-NS combined mutant strains. Overlap PCR was used to prepare RpoD mutant gene expression sequences containing 1 to 4 mutations from M66L, L174M, D278E, and T537S, and H-NS mutant gene expression sequences containing 1 to 2 mutations from V51I and N77S. The RpoD and H-NS mutant gene expression sequences were amplified using primer pairs RpoD-Mutant-F and RpoD-H-NS-R, and primer pairs RpoD-H-NS-F and H-NS-R, respectively. The amplified fragments were ligated to the pBbA1k plasmid backbone using Gibson assembly: catcataacggttctggcaa (SEQ ID NO:30) and tccaggcatcaaataaaacg (SEQ ID NO:30). Between the NO:31) sequences, recombinant plasmids expressing both the RpoD mutant and the H-NS mutant were obtained. These recombinant plasmids were transformed into STR37 strain to obtain recombinant strains STR38 to STR52. The N-acetylneuraminic acid production of strains STR38 to STR52 was tested according to the fermentation test method of N-acetylneuraminic acid producing strains in Example 1. The test results are shown in Table 4.

[0100] Table 4. Test results of RpoD and H-NS combined mutations

[0101]

[0102] The test results in Table 4 show that among the STR38 to STR52 strains containing the combined RpoD and H-NS mutations, 8 strains had higher N-acetylneuraminic acid production than the control strain STR06-C. Among them, strain STR51 had the highest production, reaching 7.32 g / L, which was 52.82% higher than that of STR06-C. Strain STR51 expressed the RpoD mutant containing L174M, D278E, and T537S (coding sequence shown in SEQ ID NO:5) and the H-NS mutant containing V51I and N77S (coding sequence shown in SEQ ID NO:6).

[0103] To verify the effectiveness of integrating RpoD and H-NS mutants into the genome, a recombinant strain STR53 was obtained using a CRISPR / Cas9-based genome editing method. This strain integrated the expression genes of the RpoD mutants (L174M, D278E, T537S) and the H-NS mutants (V51I, N77S) into the genome of strain STR37. The integration sites of the RpoD and H-NS mutant genes were the same as those of the original wild-type strain. rpoD and hns The gene locations are consistent. Following the fermentation test method for N-acetylneuraminic acid producing strains in Example 1, the N-acetylneuraminic acid yields of strains STR06 (control) and STR53 were tested, and were 4.84 g / L and 7.39 g / L, respectively, indicating that the integrated expression of RpoD mutants (L174M, D278E, T537S) and H-NS mutants (V51I, N77S) can increase the yield by 52.69%.

[0104] Example 4: Knocking out competing pathway genes to promote product synthesis

[0105] To reduce the competing pathway in N-acetylneuraminic acid synthesis and further increase yield, this embodiment uses a CRISPR / Cas9-based genome editing method to knock out the pathway involved in the synthesis of the byproduct acetic acid in the STR53 strain genome. ackA The gene (whose nucleic acid sequence range is GenBank: U00096.3 2413470..2414672, and the NCBI accession number of the protein it encodes is AAC75356.1) and the gene involved in the synthesis of the byproduct lactic acid. ldhA The recombinant strain STR54 contains the gene (its nucleic acid sequence range is GenBank: U00096.3 complement(1441854..1442843), and the NCBI accession number of the protein it encodes is AAC74462.1).

[0106] Following the fermentation test method for N-acetylneuraminic acid producing strains in Example 1, the N-acetylneuraminic acid yields of strains STR53 (control) and STR54 were tested, and were 7.25 g / L and 7.84 g / L, respectively. That is, by knocking out… ackA and ldhA Genes can further increase yield.

[0107] Example 5: Effects of the RpoD and H-NS combined mutant on other N-acetylneuraminic acid producing strains

[0108] To verify the effects of RpoD mutants (L174M, D278E, T537S) and H-NS mutants (V51I, N77S) on other N-acetylneuraminic acid producing strains, a CRISPR / Cas9-based genome editing method was used to knock out mutants in the genome of strain STR04. EBAC Gene( nage The gene nucleic acid sequence range is GenBank: U00096.3 703944..705890. andB The gene's nucleic acid sequence range is GenBank: U00096.3 complement (702811..703611). thatA The gene's nucleic acid sequence range is GenBank: U00096.3 complement (701603..702751). andC The gene's nucleic acid sequence range is GenBank: U00096.3 complement (700374..701594), and the NCBI accession numbers for the encoded proteins NagE, NagB, NagA, and NagC are AAC73773.1, AAC73772.1, AAC73771.1, and AAC73770.1, respectively, thus obtaining strain STR55.

[0109] Will come from Campylobacterjejuni of neuB The gene (the nucleic acid sequence range is NCBI ReferenceSequence: NZ_AIOE01000020.1 complement(14311..15351), encoding the NeuB protein with NCBI accession number WP_002874241.1) is derived from... Anabaena sp. CH1 age The gene (nucleic acid sequence range: GenBank: DQ661858.1 1602..2768, encoding the AGE protein with NCBI accession number ABG57043.1) is derived from... Saccharomyces cerevisiae of GNA1 The gene (the nucleic acid sequence range is GenBank: CP135953.1 complement (88209..88688), and the NCBI accession number for the GNA1 protein is WNV72244.1) was optimized for E. coli codons and artificially synthesized to obtain fragments CjneuB (as shown in bases 1 to 1041 of SEQ ID NO:1), Asage (as shown in SEQ ID NO:32), and ScGNA1 (as shown in SEQ ID NO:33); CjneuB, Asage, ScGNA1 and The sequences (as shown in SEQ ID NO:2) are linked via Gibson assembly to the pTrc99a plasmid backbone between the tttcacacaggaaacagacc (SEQ ID NO:17) and ggctgttttggcggatgaga (SEQ ID NO:18) sequences (each gene sequence is linked with an RBS sequence to achieve expression after the same promoter, specifically...) neuB and age The RBS sequence between genes is ACTAGTAAGGAGGTTTTCG (SEQ ID NO:36). age and GNA1 The RBS sequence between genes is GGATCCAAGGAGATATACC (SEQ ID NO:37). GNA1 and The RBS sequence between genes is gcctgccgtcacaggagacttata (SEQ ID NO:35) to obtain the recombinant plasmid pLSM09; the pLSM09 plasmid was transformed into strain STR55 to obtain the recombinant strain STR56; the CRISPR / Cas9-based genome editing method was used to obtain the knockout of genes in the genome of strain STR56. rpoD Genes and hns The recombinant strain STR57 integrates the gene expression sequences of the RpoD mutant (L174M, D278E, T537S) (as shown in SEQ ID NO:5) and the gene expression sequences of the H-NS mutant (V51I, N77S) (as shown in SEQ ID NO:6) in their original positions.

[0110] Following the fermentation test method for N-acetylneuraminic acid producing strains in Example 1, the N-acetylneuraminic acid yields of strains STR56 (control) and STR57 were tested, and were 1.76 g / L and 2.45 g / L, respectively. That is, the yield of strain STR57 expressing RpoD mutants (L174M, D278E, T537S) and H-NS mutants (V51I, N77S) was 39.20% higher than that of strain STR56. This indicates that RpoD mutants (L174M, D278E, T537S) and H-NS mutants (V51I, N77S) can also show the effect of increasing yield in different N-acetylneuraminic acid producing strains.

[0111] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A recombinant bacterium, characterized in that, The recombinant bacteria, compared with the original strain, exhibits any of the changes described in (A) or (B) below, wherein the original strain is Escherichia coli: (A) nanATEK Gene, pykA Genes and pykF Decreased gene expression, exogenous expression neuBC Genes expressing GlmS mutants, RpoD mutants, and H-NS mutants; (B) nanATEK Gene, pykA Gene, pykF Genes and nagEBAC Decreased gene expression, exogenous expression neuB Gene, age Genes and GNA1 Genes expressing GlmS mutants, RpoD mutants, and H-NS mutants; The nanATEK The NCBI accession numbers for the proteins encoded by the genes are AAC76257.1, AAC76256.2, AAC76255.1, and AAC76254.2, respectively; pykA The NCBI accession number for the protein encoded by the gene is AAC74924.1; pykF The NCBI accession number for the protein encoded by the gene is AAC74746.1; The neuBC The NCBI accession numbers for the proteins encoded by the gene are WP_002874241.1 and WP_002874240.1, respectively. Compared to the wild-type GlmS protein, the GlmS mutant has mutations at position 15 (glutamic acid to lysine), position 387 (aspartic acid to valine), position 450 (serine to proline), and position 525 (glutamic acid to glycine). The NCBI accession number for the wild-type GlmS protein is AAC76752.

1. The RpoD mutant and the H-NS mutant are described in any one of (1)-(7) below: (1) The RpoD mutant has a mutation at position 278 where aspartic acid is changed to glutamic acid or at position 537 where threonine is changed to serine, compared to the wild-type RpoD protein; the H-NS mutant has a mutation at position 51 where valine is changed to isoleucine, compared to the wild-type H-NS protein. (2) The RpoD mutant has a mutation at position 66, where methionine is replaced by leucine, compared to the wild-type RpoD protein; the H-NS mutant has a mutation at position 77, where asparagine is replaced by serine, compared to the wild-type H-NS protein. (3) The RpoD mutant has a mutation at position 66 (methionine) to leucine and position 537 (threonine) to serine compared to the wild-type RpoD protein; the H-NS mutant has a mutation at position 77 (asparagine) to serine compared to the wild-type H-NS protein. (4) The RpoD mutant has mutations at position 66 (methionine) to leucine, position 174 (leucine) to methionine, and position 537 (threonine) to serine compared to the wild-type RpoD protein; the H-NS mutant has mutations at position 51 (valine) to isoleucine and position 77 (asparagine) to serine compared to the wild-type H-NS protein; (5) The RpoD mutant has mutations at position 66 (methionine) to leucine, position 278 (aspartic acid) to glutamic acid, and position 537 (threonine) to serine compared to the wild-type RpoD protein; the H-NS mutant has mutations at position 51 (valine) to isoleucine and position 77 (asparagine) to serine compared to the wild-type H-NS protein; (6) The RpoD mutant has mutations compared to the wild-type RpoD protein, namely, leucine at position 174 is substituted for methionine, aspartic acid at position 278 is substituted for glutamic acid, and threonine at position 537 is substituted for serine; the H-NS mutant has mutations compared to the wild-type H-NS protein, namely, valine at position 51 is substituted for isoleucine and asparagine at position 77 is substituted for serine. (7) The RpoD mutant has mutations compared to the wild-type RpoD protein, namely, methionine at position 66 is mutated to leucine, leucine at position 174 is mutated to methionine, aspartic acid at position 278 is mutated to glutamic acid, and threonine at position 537 is mutated to serine; the H-NS mutant has mutations compared to the wild-type H-NS protein, namely, valine at position 51 is mutated to isoleucine and asparagine at position 77 is mutated to serine. The NCBI accession number for the wild-type RpoD protein is AAC76103.1; the NCBI accession number for the wild-type H-NS protein is AAC74319.

1. The nagEBAC The NCBI accession numbers for the proteins encoded by the genes are AAC73773.1, AAC73772.1, AAC73771.1, and AAC73770.1, respectively; neuB The NCBI accession number for the gene-encoded protein is WP_002874241.1; age The NCBI accession number for the protein encoded by the gene is ABG57043.1; GNA1 The NCBI accession number for the gene-encoded protein is WNV72244.

1.

2. The recombinant bacteria according to claim 1, characterized in that, Compared with the original strain, the recombinant strain further exhibits the changes described in (A). ackA Genes and ldhA The expression level of the gene is reduced; ackA The NCBI accession number for the protein encoded by the gene is AAC75356.1; ldhA The NCBI accession number for the protein encoded by the gene is AAC74462.

1.

3. A combination of global transcription factor mutants, characterized in that, The combination of RpoD mutant and H-NS mutant; the combination of RpoD mutant and H-NS mutant is as described in any one of (1)-(7) below: (1) The RpoD mutant has a mutation at position 278 where aspartic acid is changed to glutamic acid or at position 537 where threonine is changed to serine, compared to the wild-type RpoD protein; the H-NS mutant has a mutation at position 51 where valine is changed to isoleucine, compared to the wild-type H-NS protein. (2) The RpoD mutant has a mutation at position 66, where methionine is replaced by leucine, compared to the wild-type RpoD protein; the H-NS mutant has a mutation at position 77, where asparagine is replaced by serine, compared to the wild-type H-NS protein. (3) The RpoD mutant has a mutation at position 66 (methionine) to leucine and position 537 (threonine) to serine compared to the wild-type RpoD protein; the H-NS mutant has a mutation at position 77 (asparagine) to serine compared to the wild-type H-NS protein. (4) The RpoD mutant has mutations at position 66 (methionine) to leucine, position 174 (leucine) to methionine, and position 537 (threonine) to serine compared to the wild-type RpoD protein; the H-NS mutant has mutations at position 51 (valine) to isoleucine and position 77 (asparagine) to serine compared to the wild-type H-NS protein; (5) The RpoD mutant has mutations at position 66 (methionine) to leucine, position 278 (aspartic acid) to glutamic acid, and position 537 (threonine) to serine compared to the wild-type RpoD protein; the H-NS mutant has mutations at position 51 (valine) to isoleucine and position 77 (asparagine) to serine compared to the wild-type H-NS protein; (6) The RpoD mutant has mutations compared to the wild-type RpoD protein, namely, leucine at position 174 is substituted for methionine, aspartic acid at position 278 is substituted for glutamic acid, and threonine at position 537 is substituted for serine; the H-NS mutant has mutations compared to the wild-type H-NS protein, namely, valine at position 51 is substituted for isoleucine and asparagine at position 77 is substituted for serine. (7) The RpoD mutant has mutations compared to the wild-type RpoD protein, namely, methionine at position 66 is mutated to leucine, leucine at position 174 is mutated to methionine, aspartic acid at position 278 is mutated to glutamic acid, and threonine at position 537 is mutated to serine; the H-NS mutant has mutations compared to the wild-type H-NS protein, namely, valine at position 51 is mutated to isoleucine and asparagine at position 77 is mutated to serine. The NCBI accession number for the wild-type RpoD protein is AAC76103.1; the NCBI accession number for the wild-type H-NS protein is AAC74319.

1.

4. An RpoD mutant, characterized in that, The RpoD mutant, compared to the wild-type RpoD protein, has mutations at position 66 (methionine to leucine), position 174 (leucine to methionine), position 278 (aspartic acid to glutamic acid), and position 537 (threonine to serine). The NCBI accession number for the wild-type RpoD protein is AAC76103.

1.

5. An H-NS mutant, characterized in that, The H-NS mutant has mutations at position 51 (valine to isoleucine) and position 77 (asparagine to serine) compared to the wild-type H-NS protein; the NCBI accession number of the wild-type H-NS protein is AAC74319.

1.

6. A nucleic acid encoding the global transcription factor mutant combination of claim 3.

7. The nucleic acid according to claim 6, characterized in that, The nucleotide sequence of the nucleic acid encoding the RpoD mutant is shown in SEQ ID NO:5; the nucleotide sequence of the nucleic acid encoding the H-NS mutant is shown in SEQ ID NO:

6.

8. The nucleic acid encoding the RpoD mutant of claim 4.

9. The nucleic acid encoding the H-NS mutant of claim 5.

10. A biological material containing the nucleic acid according to any one of claims 6-9, wherein the biological material is an expression cassette, a vector, or a host cell.

11. Any of the following applications of the recombinant bacteria of claim 1 or 2, the global transcription factor mutant combination of claim 3, the RpoD mutant of claim 4, the H-NS mutant of claim 5, the nucleic acid of any one of claims 6-9, or the biomaterial of claim 10: (1) Fermentation production of sialic acid; (2) Microbial genetic breeding for the production of sialic acid; (3) Increase the yield of sialic acid produced by fermentation.

12. A method for constructing recombinant bacteria, characterized in that, Includes the steps described in (1) or (2) below: (1) To make the recombinant bacteria nanATEK Gene, pykA Genes and pykF Decreased gene expression, exogenous expression neuBC Genes expressing GlmS mutants, RpoD mutants, and H-NS mutants; (2) To make the recombinant bacteria nanATEK Gene, pykA Gene, pykF Genes and nagEBAC Decreased gene expression, exogenous expression neuB Gene, age Genes and GNA1 Genes expressing GlmS mutants, RpoD mutants, and H-NS mutants; The nanATEK Gene, pykA Gene, pykF Gene, neuBC Gene, GlmS mutant, RpoD mutant, H-NS mutant, nagEBAC Gene, neuB Gene, age Genes and GNA1 The genes are as described in claim 1; The recombinant bacteria originated from Escherichia coli.

13. The method according to claim 12, characterized in that, Based on step (1), the method further includes making the recombinant bacteria... ackA Genes and ldhA The steps that reduce gene expression; The ackA Genes and ldhA The genes are as described in claim 2.

Images