CRISPR / Cas13 system and application of CRISPR / Cas13 system in preparation of anti-Hantaan virus medicine

Abstract

The invention relates to a CRISPR / Cas13 (clustered regularly interspaced short palindromic repeats / CRISPR associated protein 13) system and application of the CRISPR / Cas13 system in preparation of anti-Hantaan virus drugs. The CRISPR / Cas13 system comprises Wherein the Cas13 protein is a CasRx protein, the crRNA comprises crRNA1, crRNA2, crRNA6 and crRNA7, and the sequences of the crRNA1, the crRNA2, the crRNA6 and the crRNA7 are respectively SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 and SEQ ID NO: 7. The crRNA in targeted complementary pairing with the virus RNA and messenger RNA corresponding to the Hantaan virus S gene is designed, the cleavage activity of CasRx protein can be guided and activated, then specific cleavage is conducted on the virus RNA or messenger RNA, the purpose of inhibiting hantaan virus replication is achieved, a new thought and method are provided for treatment of Hantaan virus infection, and the method has a wide application prospect. The important clinical application value is realized.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of virus infection treatment, in particular to a CRISPR / Cas13 system and application thereof in preparation of an anti-Hantaan virus drug. BACKGROUND

[0002] Hantaan virus (HTNV) belongs to the Bunyaviridae class, the Hantaviridae family, and the Orthohantavirus genus, and is a negative-strand RNA virus with segmented genomes. The virus is mainly distributed in East Asia (China, South Korea, and the Far East of Russia) and some parts of Europe, and takes rodents such as wild mice as the main natural host. The virus is transmitted through urine, feces or saliva of rodents. The virus is transmitted to humans through rodents, and can cause severe Hemorrhagic fever with renal syndrome (HFRS). The disease progresses rapidly, and delayed treatment can increase the mortality rate.

[0003] At present, there is no specific antiviral drug for treating Hantaan virus infection, and the main treatment in clinical practice is supportive therapy. The core goal is to relieve symptoms, maintain vital signs, and prevent or treat complications.

[0004] Therefore, it is necessary to propose new measures for the safe treatment of Hantaan virus infection. SUMMARY

[0005] The application aims to provide a CRISPR / Cas13 system and application thereof in preparation of an anti-Hantaan virus drug, and to provide a new treatment for Hantaan virus infection.

[0006] In order to achieve the above-mentioned purpose, the technical scheme adopted by the application is as follows:

[0007] The application provides a CRISPR / Cas13 system, which comprises a Cas13 protein and a crRNA.

[0008] The Cas13 protein is a CasRx protein.

[0009] The crRNA comprises crRNA1, crRNA2, crRNA6 and crRNA7, and the sequences are SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 and SEQ ID NO:7 respectively.

[0010] Further, the expression plasmid of the CasRx protein is PLVX-CasRx-HA-T2A-GFP-IRES-Neo.

[0011] Further, the expression plasmid of the crRNA is pXR003-CasRx-crRNA(1, 2, 6, 7)-cloning backbone.

[0012] Further, in the crRNA, crRNA1 and crRNA2 target the viral RNA corresponding to the S gene of the Hantaan virus.

[0013] Further, in the crRNA, crRNA6 and crRNA7 target the messenger RNA corresponding to the S gene of the Hantaan virus.

[0014] In another aspect, the application provides the use of the CRISPR / Cas13 system as described for preparing an anti-Hantaan virus drug for inhibiting the replication of the Hantaan virus.

[0015] Compared with the prior art, the application has the following beneficial effects:

[0016] The application provides a CRISPR / Cas13 system and the use thereof in preparing an anti-Hantaan virus drug, and a CRISPR-RNA (crRNA) is designed to target and complementarily pair with the viral RNA (HTNV-S-vRNA) and the messenger RNA (HTNV-S-mRNA) corresponding to the S gene of the Hantaan virus, the crRNA can guide and activate the cleavage activity of the Cas13 protein, and then specifically cleave the HTNV-S-vRNA or the HTNV-S-mRNA, so as to achieve the purpose of inhibiting the replication of the Hantaan virus. It has been verified through experiments that, in the Hantaan virus-infected human embryonic kidney 293T (HEK293T) cells, after the plasmid expressing the crRNA sequence and the CasRx protein (one protein in the Cas13 family) is transfected, the nucleic acid level of the Hantaan virus in the cells is significantly reduced, the expression level of the structural protein of the Hantaan virus in the cells is also significantly reduced, and the toxicity to the cells is lower after the corresponding plasmid is transfected, which provides a new idea and method for the treatment of Hantaan virus infection, and has important clinical application value. BRIEF DESCRIPTION OF DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description only some embodiments of the application, and for those skilled in the art, other drawings of other embodiments can also be obtained without creative labor on the basis of these drawings.

[0018] Figure 1 is the plasmid map of PLVX-CasRx-HA-T2A-GFP-IRES-Neo.

[0019] Figure 2 Figure 3 is a plasmid map of pXR003-CasRx-crRNA(0, 1, 2, 6, 7)-cloning backbone.

[0020] Figure 3 Figure 4 is the identification results of constructing plasmids expressing CasRx protein and crRNA sequence.

[0021] Figure 4 Figure 5 is the cell toxicity detection results after transfecting CasRx expression plasmid and crRNA expression plasmid and infecting HTNV.

[0022] Figure 5 Figure 6 is the RT-qPCR detection results of inhibiting HTNV-S gene level after transfecting CasRx expression plasmid and crRNA expression plasmid.

[0023] Figure 6 Figure 7 is the Western-blot detection results of inhibiting HTNV nucleocapsid protein expression after transfecting CasRx expression plasmid and crRNA expression plasmid. DETAILED DESCRIPTION

[0024] In order to facilitate the understanding of the present application, the present application will be described more fully below with reference to the accompanying drawings. The preferred embodiments of the present application are shown in the drawings. However, the present application can be realized in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive.

[0025] In the description of the present application, it should be understood that all the technical and scientific terms used have the same meaning as generally understood by those skilled in the art to which the present application belongs. When there is a conflict, the definition in the specification shall prevail. If not specifically indicated, the technical means used in the examples are the conventional means known to those skilled in the art, the reagents used in the examples are commercially available, and the devices used in the examples are existing devices. The limitation of means, reagents or devices cannot be understood as the limitation of the present application. Means, reagents or devices of the same type solving the same technical problem are within the protection scope of the present application.

[0026] In the description of the present application, it should be understood that when the amount, concentration, or other value or parameter is expressed as a range, a preferred range, or a range defined by a series of upper preferred values and lower preferred values, it should be understood that all ranges formed by any pair of upper or lower preferred values of any range are specifically disclosed, regardless of whether the range is disclosed separately. When a numerical range is described herein, unless otherwise stated, the range is intended to include its end values and all integers and fractions within the range.

[0027] In addition, the plurality of steps involved in the process of describing the method should not be understood as a limitation on the order of the steps of the method, and the technical solutions obtained by changing the order of the steps in solving the same technical problem are also within the protection scope of the present application.

[0028] CRISPR (Clusters of Regularly Interspaced Short Palindromic Repeats) is a naturally occurring adaptive immune system in bacteria and archaea that defends against viral (bacteriophage) or foreign DNA invasion, and has recently been modified into a powerful gene editing tool that can accurately and efficiently modify the genome of an organism, generally including CRISPR sequences, Cas proteins and guide RNA. CRISPR sequences can target almost any gene site, with editing efficiency far exceeding traditional techniques, not only knocking out genes, but also activating, inhibiting or replacing specific genes.

[0029] The present application is based on the gene editing tool, and designs a CRISPR / Cas13 system containing Cas13 protein and special sequence crRNA for Hantavirus, providing a new idea for treating Hantavirus infection.

[0030] Specifically, the CRISPR / Cas13 system provided by the present application contains Cas13 protein and crRNA (CRISPR-RNA).

[0031] Among them:

[0032] The Cas13 protein is selected from CasRx protein, and the expression plasmid is PLVX-CasRx-HA-T2A-GFP-IRES-Neo, such as Figure 1 .

[0033] The crRNA includes crRNA1, crRNA2, crRNA6, crRNA7, and the sequences are SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, respectively, and the expression plasmid is pXR003-CasRx-crRNA (1, 2, 6, 7)-cloningbackbone, such as Figure 2 . Among them, crRNA1 and crRNA2 target the viral RNA (HTNV-S-vRNA) corresponding to the S gene of Hantavirus, and crRNA6 and crRNA7 target the messenger RNA (HTNV-S-mRNA) corresponding to the S gene of Hantavirus, and the specific sequences are shown in Table 1.

[0034] Table 1

[0035] Name Specific targeting sequence Sequence (5'~3') crRNA1 HTNV-S-vRNA SEQ ID NO: 1 : AGCTACTAGAACAACGATGGCAA crRNA2 HTNV-S-vRNA SEQ ID NO: 2: ATAGAACAGCAGTCTGTGGGCTC crRNA6 HTNV-S-mRNA SEQ ID NO: 6: CAAATGGTTTAAATCCAGCACAT crRNA7 HTNV-S-mRNA SEQ ID NO: 7: ATTGTTCGATACGATCACTCCAG

[0036] The crRNA1 and crRNA2 sequences are designed for HTNV-S-vRNA, and the crRNA6 and crRNA7 sequences are designed for HTNV-S-mRNA. When these crRNAs are respectively combined with the HTNV-S-vRNA or HTNV-S-mRNA target complement, they guide and activate the cleavage activity of the CasRx protein, enabling the CasRx protein to specifically cleave the HTNV-S-vRNA or mRNA, thereby blocking the expression of the HTNV-S gene and the replication process of the virus, and ultimately achieving the purpose of inhibiting the replication of HTNV, and thus can be used for the treatment of HTNV infection.

[0037] The present application verifies that the CRISPR / Cas13 system can effectively inhibit the replication of HTNV by performing experiments in human embryonic kidney 293T (HEK293T) cells, and the toxicity to cells after transfection of the corresponding plasmid is low. During the experiment, a random sequence crRNA0 without target complementary pairing is also designed for control, and the specific sequence is shown in Table 2.

[0038] Table 2

[0039] Name Specific targeting sequence Sequence (5'~3') crRNA0 None SEQ ID NO: 0: GGAGGGACGGGTCCAATCGGAAT

[0040] The specific experiment is as follows:

[0041] (I) Construction and identification of plasmid:

[0042] The present application uses DNA recombination technology to construct the CasRx-HA-T2A-GFP target gene sequence into the PLVX-IRES-Neo vector cut by the restriction endonuclease EcoR I and BamH I. The crRNA(0, 1, 2, 6, 7) annealing product is constructed into the pXR003-CasRx-crRNA-cloning backbone vector cut by the restriction endonuclease Bbs I using T4 ligase. The above-mentioned all ligation products are respectively transformed into competent cells DH5a, and plated. After shaking the single colony formed, the plasmid is extracted, and the sequence is identified.

[0043] Figure 3 The results of sequence identification are shown. As shown in Table 1, the sequence alignment of the sequencing results is correct. Figure 3

[0044] (II) Transfection of plasmid cell toxicity determination:

[0045] ​HEK293T cell suspension was inoculated in 96-well plates, and the plates were placed in a 37°C, CO2 incubator for cell adhesion; the plasmid expressing crRNA (0, 1, 2, 6, 7) sequence and the plasmid expressing CasRx protein were co-transfected into HEK293T cells at 62.5 ng per well. Six replicates were set for each transfection group, and a group of untreated cells was set as a control group. After transfection for 12 h, HTNV suspension was added, MOI = 0.1, and cultured for 48 h after infection. CCK-8 reagent was added to each well, and the absorbance at 450 nm was measured by enzyme-labeled instrument after incubation in the incubator for 1-4 h. The cell activity was calculated according to the absorbance, and the cell viability detection results of each group were obtained.

[0046] Figure 4 is the cell toxicity detection result after transfection of CasRx protein expression plasmid and crRNA sequence expression plasmid and infection of HTNV. As shown in Figure 4 , compared with the control group, it was found that after transfection of plasmid and infection of HTNV, the data analysis result had no statistical difference, that is, it had no obvious effect on cell activity, and the cell activity was good.

[0047] (Three) RT-qPCR detection:

[0048] HEK293T cell suspension was inoculated in 24-well plates, and the plates were placed in a 37°C, CO2 incubator for cell adhesion; the plasmid expressing crRNA (0, 1, 2, 6, 7) sequence and the plasmid expressing CasRx protein were co-transfected into HEK293T cells at 250 ng per well, and infected with HTNV after transfection for 12 h, MOI = 0.1, and cultured for 48 h. Total RNA was extracted, and 1000 ng of total RNA was reverse transcribed into cDNA. SYBR green was used as a fluorescent dye, HTNV-S fragment was used as a target, and GAPDH was used as an internal reference for nucleic acid quantification.

[0049] Figure 5 is the RT-qPCR detection result of CRISPR / Cas13 system inhibiting HTNV-S gene RNA level. As shown in Figure 5 , taking crRNA 0 group as a control group, crRNA (1, 2, 6, 7) group can reduce the RNA level of HTNV-S gene in cells.

[0050] (Four) Western-blot detection:

[0051] HEK293T cell suspension was inoculated in a 6-well plate, and the plate was placed in a 37°C, CO2 incubator for cell adhesion; the plasmid expressing the crRNA (0, 1, 2, 6, 7) sequence was respectively co-transfected with the plasmid expressing the CasRx protein at 1000 ng per hole in the HEK293T cells, and 12 h after transfection, HTNV was infected at an MOI of 0.1, and the infection was performed for 48 h. The cells were lysed by RIPA lysis buffer, total protein was extracted, and Western-blot was used to detect the HTNV nucleocapsid protein (NP), and the total protein loading amount of each group was 20 μg.

[0052] Figure 6 is the Western-blot detection result of the CRISPR / Cas13 system inhibiting HTNV-NP. As shown in Figure 6 , the crRNA (1, 2, 6, 7) group can reduce the expression level of HTNV-NP in the cells, with the crRNA 0 group as the control group.

[0053] The above application uses specific examples to describe the present application, which is only used to help understand the present application and does not limit the present application. For those skilled in the art to which the present application belongs, according to the idea of the present application, a number of simple deductions, deformations or substitutions can be made.

Claims

1. A CRISPR / Cas13 system, characterized by: The system contains Cas13 protein and crRNA; The Cas13 protein is the CasRx protein; The crRNAs include crRNA1, crRNA2, crRNA6, and crRNA7, with sequences SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, and SEQ ID NO:7, respectively.

2. The CRISPR / Cas13 system according to claim 1, characterized in that: The expression plasmid for the CasRx protein is PLVX-CasRx-HA-T2A-GFP-IRES-Neo.

3. The CRISPR / Cas13 system according to claim 2, characterized in that: The expression plasmid for the crRNA is pXR003-CasRx-crRNA(1, 2, 6, 7)-cloning backbone.

4. The CRISPR / Cas13 system according to claim 3, characterized in that: Of the crRNAs, crRNA1 and crRNA2 target the viral RNA corresponding to the S gene of Hantan virus.

5. The CRISPR / Cas13 system according to claim 4, characterized in that: Of the crRNAs, crRNA6 and crRNA7 target the messenger RNA corresponding to the S gene of Hantan virus.

6. The application of the CRISPR / Cas13 system as described in claim 5, characterized in that: The system is used to prepare anti-Hantan virus drugs to inhibit Hantan virus replication.

Images