Application of WNT7B in construction of myopia animal model

Abstract

The invention provides an application of WNT7B in construction of a myopia animal model. Homologous genes wnt7ba and wnt7bb of the WNT7B in the zebra fish are knocked out or knocked down by applying a CRISPR / Cas9 gene editing technology, an animal model of which the eye axis length is remarkably increased, the eyeball movement frequency is remarkably reduced and the light response is reduced is obtained, and the result shows that the WNT7B is related to the high myopia. The model provides a favorable tool for pathogenesis and drug screening of high myopia, and has a good application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of animal model construction, and particularly relates to application of WNT7B in construction of myopia animal model. BACKGROUND

[0002] High myopia (HM) has become an important "culprit" leading to irreversible visual impairment. In the Chinese population, the genetic basis is complex and has not been fully elucidated. Currently, the spherical refraction reaching -6.00D or lower, or the eye axial length exceeding 26 mm is usually used as the criterion for determining high myopia. High myopia is not just a visual problem, it is closely related to a variety of serious eye fundus complications that threaten vision, such as myopic choroidal neovascularization (mCNV), retinal detachment (RD) and myopic macular degeneration (MMD), etc. These complications may eventually lead to irreversible blindness, causing a heavy blow to the quality of life of patients.

[0003] It is particularly worth noting that the prevalence of high myopia in the 16-18 year old adolescent group is showing a sharp upward trend. According to forecasts, the prevalence of high myopia in this group will soar from 7.3% in 2001 to 22.1% in 2050. However, high myopia is highly complex, and its heterogeneity makes it difficult to accurately define by simple classification diagnostic labels. The traditional research approach based on simple classification diagnostic labels has obvious limitations and cannot fully and accurately depict the true characteristics of high myopia, which has brought great challenges to the research and treatment of high myopia. In view of this situation, it is of immeasurable importance to explore the genetic susceptibility of high myopia for the prevention, diagnosis and treatment of the disease. SUMMARY

[0004] In view of the deficiencies in the prior art, the present application provides the application of WNT7B in construction of myopia animal model.

[0005] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions:

[0006] The first aspect of the present application provides a method for constructing a myopia zebrafish animal model, which comprises constructing a wnt7ba and wnt7bb function loss zebrafish mutant.

[0007] In the present application, the wnt7ba and wnt7bb function loss zebrafish mutant refers to knocking down the expression of wnt7ba and wnt7bb genes by targeting the 2nd exon of the two genes using the CRISPR-Cas9 system, so that the mRNA expression of zebrafish wnt7ba and wnt7bb is reduced by more than 90% compared with the wild type, thereby realizing the construction of a function loss mutant.

[0008] In the present application, WNT7B is full name of Wnt family member 7B, located in 22q13.31 of chromosome 22, encoding a secreted signal protein, and the gene ID is 7477. In zebrafish, WNT7B is encoded by wnt7ba and wnt7bb genes, the gene ID of wnt7ba is 563427, and the gene ID of wnt7bb is 100148840.

[0009] Further, the method comprises the following steps:

[0010] S1, transcribing sgRNA in vitro, the recognition sequence of the sgRNA is located in the 2nd exon of zebrafish wnt7ba and wnt7bb genes, and the target sequence has the nucleotide sequence shown in SEQ ID NO: 5 and SEQ ID NO: 15.

[0011] S2, co-injecting the sgRNA and the Cas9 protein into zebrafish fertilized eggs to obtain wnt7ba and wnt7bb function loss zebrafish mutants.

[0012] Further, the method further comprises the following steps:

[0013] S3, culturing the injected fertilized eggs into adult fish to obtain F0 generation wnt7ba and wnt7bb function loss zebrafish.

[0014] S4, crossing the obtained F0 generation wnt7ba and wnt7bb function loss zebrafish with wild type zebrafish to obtain F1 generation zebrafish, and identifying F1 generation wnt7ba and wnt7bb function loss zebrafish.

[0015] S5, crossing the obtained F1 generation wnt7ba and wnt7bb function loss female and male zebrafish to obtain F2 generation zebrafish, and identifying homozygous F2 generation wnt7ba and wnt7bb function loss zebrafish to obtain stably inherited wnt7ba and wnt7bb function loss zebrafish mutants.

[0016] In some embodiments, the injection final concentration of the sgRNA in step S2 is 320 ng / μL, and the injection final concentration of the Cas9 protein is 800 ng / μL.

[0017] In some embodiments, the zebrafish fertilized eggs in step S2 are single cell stage embryos, and each embryo is injected with 1 nL.

[0018] The second aspect of the present application provides a group of sgRNAs targeting zebrafish wnt7ba and wnt7bb genes, the recognition sequence of the sgRNAs is located in the 2nd exon of zebrafish wnt7ba and wnt7bb genes, and the target sequence has a nucleotide sequence as shown in SEQ ID NO: 5 and SEQ ID NO: 15.

[0019] The third aspect of the present application provides the use of the sgRNA of the second aspect of the present application in constructing a wnt7ba and wnt7bb functional deficiency zebrafish mutant.

[0020] The fourth aspect of the present application provides a method for screening myopia treatment drugs, and the steps of the method are as follows: administering a drug to the wnt7ba and wnt7bb functional deficiency zebrafish mutant constructed by the method of the first aspect of the present application, and if the drug can improve the symptoms of the mutant related to myopia, the drug is a candidate drug for myopia.

[0021] In some embodiments, the improvement refers to that the symptoms (such as body length, interocular distance, eye area, axial length, etc.) of the mutant are improved by at least about 10%, at least about 30%, at least about 50%, at least about 80% or more compared with before administering the drug.

[0022] Further, the candidate drug includes protein analogs, antibodies, DNA, RNA, small molecule compounds.

[0023] Further, the source of the small molecule compound is selected from the group consisting of: newly synthesized or existing databases; wherein the existing databases include, but are not limited to, general natural product databases (COCONUT, Super Natural II, NPASS), plant natural product databases (KNApSaCK, CMAUP, TriForC, Alkamid, NPACT DB, BioPhytMol), Chinese medicine natural product databases (TCM@Taiwan, CEMTDD, CHDD, ETCM, TM-MC, TCMID, YaTCM), microbial natural product databases (StreptomeDB, NP Altas, ProCarDB, PAMDB, Lichen Database), marine natural product databases (MNPD, SWMD), natural product databases of different countries and regions (IMPPAT, NeMedPlant, MedPServer, TlPdb, AfroDB, ANPDB, BIOFACQUIM, NUBBEDB), food natural product databases (FooDB, BitterDB, Phenol-Explorer, PhytoHub, SuperSweet database), toxic natural product databases (Exposome-Explorer, T3DB, Snake Neurotoxin Database, TPPT), natural product industry catalogs (Greenpharma, AnalytiCon Discovery, InterBioScreen, Indofine Chemical Company, Pi Chemicals Systems\Specs, TargetMol), databases for MS data dereplication (MoNA, MassBank, METLIN, HMDB, YMDB, ReSpect, GNPS), databases for NMR data dereplication (NMRShiftDB, NAPROC-13), and the like.

[0024] Further, the DNA includes single-stranded DNA, double-stranded DNA, circular DNA, and ligated DNA.

[0025] Further, the RNA includes mRNA, tRNA, rRNA, snRNA, hRNA, antisense RNA, tCRNA, dsRNA, SCRNA, catalytically active RNA, and various viral RNAs.

[0026] Further, the candidate drug includes various pharmaceutically acceptable salt forms.

[0027] Further, the candidate drug includes a drug used alone or a pharmaceutical composition.

[0028] Further, the pharmaceutical composition refers to the combination of the candidate drug and the pharmaceutically acceptable carrier.

[0029] The term "pharmaceutically acceptable" is used herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit / risk ratio. Suitable carriers can be large, slowly metabolized macromolecules, such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, and amino acid copolymers. Such carriers are well known in the art. Pharmaceutically acceptable carriers in the pharmaceutical composition can include fluids such as water, saline, glycerol, and ethanol. Auxiliary substances such as wetting or emulsifying agents, pH buffering substances, and the like can also be present in such vehicles.

[0030] The fifth aspect of the present application provides the use of the wnt7ba and wnt7bb functional deletion zebrafish mutant obtained according to the method of the first aspect of the present application in the research of the gene function of wnt7ba and wnt7bb and / or in the screening of highly myopic therapeutic drugs.

[0031] The sixth aspect of the present application provides the use of WNT7B in any one of the following: 1) in the preparation of a myopia animal model; 2) in the preparation of a highly myopic gene therapy product.

[0032] In some embodiments, the highly myopic gene therapy product comprises a nucleic acid construct of a WNT7B-specific regulatory sequence.

[0033] Advantages and beneficial effects of the present application: by using CRISPR / Cas9 gene editing technology to knock out or knock down the homologous genes wnt7ba and wnt7bb of WNT7B in zebrafish, an animal model with significantly increased eye axial length, significantly reduced eye movement frequency, and reduced light response is obtained, which provides a favorable tool for the pathogenesis and drug screening of highly myopia. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 Statistical result graph of five eye parameters of participants.

[0035] Figure 2 Mendelian randomization analysis result graph of quantitative traits. A is the Mendelian randomization analysis result of two samples of quantitative traits related to HM (IVW model); B is the association between exposure factors and the risk of HM, and the red p value indicates that there is a significant causal relationship between exposure and outcome; C is Beta, which represents the size of the causal relationship between exposure and outcome; D is the causal effect of eye parameters.

[0036] Figure 3 The image shows the results of single-cell enrichment analysis of WNT7B.

[0037] Figure 4 The image shows the characteristic results of wnt7ba and wnt7bb loss-of-function zebrafish. A is a schematic diagram of the location of the sgRNA-edited wnt7ba and wnt7bb genes; B shows the expression levels in negative controls and loss-of-function zebrafish quantified by qPCR; CF shows the quantification of body and eye measurements, including body length (C), interocular distance (D), eye area (E), and axial length (F); G shows H&E staining of the zebrafish larvae's retina: PCL (photoreceptor layer); INL (nuclear layer); IPL (inner retinal layer); GCL (ganglionic cell layer); H shows the statistical analysis of the thickness of each retinal layer; HI shows the thickness of GCL (H) and INL (I); J shows the frequency distribution of zebrafish larval eye movements (times / minute); K shows the difference in swimming speed between negative controls and loss-of-function zebrafish during 5 minutes of light and 5 minutes of darkness.

[0038] Figure 5 The image shows the characteristic results of wnt7ba and wnt7bb zebrafish with loss of function. A is the statistical graph of the inner reticulate layer (IPL) thickness, and B is the statistical graph of the photosensitive layer (PCL) thickness. Detailed Implementation

[0039] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments. Obviously, the described embodiments are merely some embodiments of the present invention, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0040] Example

[0041] I. Experimental Methods

[0042] 1. Study Design and Participants: Participants in this study were drawn from the Myopia-Related Genetics and Intervention Consortium (MAGIC) project. Some patients underwent ophthalmological examinations, including refractive error measurements and ocular biometrics covering five ocular parameters: spherical equivalent (SE), axial length (AL), corneal curvature (K), axial length to corneal curvature ratio (AL / CR), and tachycardia-to-white distance (WTW). High myopia was defined based on the worst-case refractive state or axial length (WSE ≤ -6.00 D or WAL > 26.0 mm). This study was approved by the Eye Hospital of Wenzhou Medical University and conducted in accordance with the principles of the Declaration of Helsinki. All participants provided written informed consent.

[0043] 2. Exclusion Criteria: Individuals lacking valid identification or both SE and AL were excluded during the initial data processing phase. Participants who had previously undergone ophthalmic surgery were excluded. Additionally, participants with an eye refractive state greater than -6.00 diopters (D) or an axial length less than 26.0 mm were excluded.

[0044] 3. Genotypic Data and Quality Control: All genotypic data were retrieved from the patient database collected by the MAGIC project and variant filtering was performed using a standardized pipeline. Then, the corresponding genotypes for the five ocular phenotypes were extracted. Second-stage variant level quality control included the following exclusion steps: recall <90%, Hardy-Weinberg equilibrium p <1×10⁻⁶. −6 The minor allele frequency (MAF) is <0.01.

[0045] 4. Gene Function Annotation: Tissue-specific expression profiles of risk genes were presented in the human eye transcriptome atlas (https: / / eye-transcriptome.com) and the human protein atlas (https: / / www.proteinatlas.org). Single-cell expression profiles of GSE236197 were used to assess cell-type specificity of finely mapped genes. Relative expression of candidate genes in a given cell cluster was calculated using the Seurat software package. RNA structure was visualized using Pymol. Finally, pathway enrichment analysis, gene ontology, and KEGG analysis were performed using STRING (https: / / string-db.org / ). The top 10% of pathways were visualized using Python 3.7. False discovery rate (FDR) was used to adjust the p-values ​​for each pathway.

[0046] 5. Generation of wnt7b gene-deleted zebrafish: Zebrafish (AB strain) were obtained from Hunter Biotech Co., Ltd. (China) and cultured at 28°C. Wild-type AB strain zebrafish were reared through natural pair mating. A CRISPR-mediated zebrafish mutant was constructed by injecting zebrafish single-cell embryos with the clustered regularly spaced short palindromic repeat (CRISPR) / CRISPR-associated protein 9 (Cas9) system using a PICOSPRITZER® III (Parker Biosciences, USA) microinjection system.

[0047] Design of zebrafish with wnt7ba gene deletion: (1) The target sites are designed as follows: CATCAGTGTGTCTGGTCTCCTC-CAAAGGGCTTTGTCTTCAGTCGTGGCTTTGGGCGCAAACATCATCTGCAACAAGATCCCCGGCCTGGCCCCCCGACAGCGTGCCATCTGCCAGAGCCGCCCAGATGCCATCATCATC ATTGGGGAAGGC GCTCAGCTGGG CATCAACGAGTGCCAGT ATCAGTTTCGCTACGGCCGGTGG AACTGCTCTGCCCTTGGCGAGAGGACCGTCTTTGGGCAAGAGCTGAGAGTAGGTCAGTAGGTGCAGCCCCGTGAGCTGTGCTTTCATGTCACATTCATAGTATGTGAGTGTGGGTGTGTGTGTGTGTATGTATGTTGTTTTGGCTGGATCTGTTTCCATTAGAGCCCTGCAAAACAAATGAGACAAAAAAGAGGTTAA-AGCAGATACAATCAGTCCGCAAT (SEQ ID NO: 1).

[0048] Among them, CATCAGTGTGTCTGGTCTCCTC (SEQ ID NO:2) and AGCAGTACAATCAGTCCGCAAT (SEQ ID NO:3) are sequence amplification primers, CATCAGTGTGTCTGGTCTCCTCCAAAGGGCTTTGTCTTCAGTCGTGGCTTTGGGCGCAAACATCATCTGCAACAAGATCCCCGGCCTGGCCCCCCGACAGCGTGCCATCTGCCAGAGCCGCCCAGATGCCATCATCATCATCATTGGGGAAGGCGCTCAGCTGGGCATCAACGAGTGCCAGTATCAGTTTCGCTACGGCCGGTGGAACTGCTCTGCCCTTGGCGAGAGGACCGTCTTTGGGCAAGAGCTGAGAGTAG (SEQ ID NO:4) is the gene exon sequence, and ATTGGGGAAGGCGCTCAGCTGGG (SEQ ID NO:5) and ATCAGTTTCGCTACGGCCGGTGG (SEQ ID NO:6) are target sequences.

[0049] (2) The primers for target detection were designed and synthesized as follows:

[0050] wnt7ba-F1:CATCAGTGTGTCTGGTCTCCTC (SEQ ID NO: 2).

[0051] wnt7ba-R1:ATTGCGGACTGATTGTATCTGCT (SEQ ID NO:7).

[0052] (3) Target sequence validation:

[0053] Using the wild-type zebrafish genome as a template, PCR amplification was performed using synthetic detection primers and ExTaq enzyme, yielding a product length of 425 bp. Alignment analysis of the sequences downloaded from the ENSEMBL database and the sequencing results revealed that the actual sequences of Target1 and Target2 were consistent with the target sequences designed based on the database.

[0054] (4) The designed target sequence is as follows:

[0055] wnt7ba-Target1:ATTGGGGAAGGCGCTCAGCT GGG (SEQ ID NO: 5) Forward.

[0056] wnt7ba-Target2: ATCAGTTTCGCTACGGCCGG TGG (SEQ ID NO: 6) Forward.

[0057] (5) The forward primers for target sgRNA amplification are (where the underlined sequence is the target sequence):

[0058] wnt7ba-Target1F:TTAATACGACTCACTATA GATTGGGGAAGGCGCTCAGCT GTTTTAGAGCTAGAAATAG (SEQ ID NO: 8).

[0059] wnt7ba-Target2F:TTAATACGACTCACTATA GATCAGTTTCGCTACGGCCGG GTTTTAGAGCTAGAAATAG (SEQ ID NO: 9).

[0060] (6) The reverse primer for target sgRNA transcription is:

[0061] T7gRNA-R: AAAAAAAGCACCGACTCGGTGCCAC (SEQ ID NO: 10).

[0062] (7) Target sgRNA amplification and transcription

[0063] The transcribed template was amplified and recovered using the target forward primer and T7gRNA-R primer, respectively. In vitro transcription was performed using the E2040s transcription kit. The transcribed target sgRNA was recovered using the AM1561 kit. The product was dissolved in NF water and the concentration was detected using a UV spectrophotometer before being used for embryo injection.

[0064] Design of zebrafish with wnt7bb gene deletion: (1) Design target sites are as follows:

[0065] TTACAGGTTACGGATGAGGGAC-CAGCTGCGATCAATCATATCATGTGCTTCTCTCGAAATTAGTTTGTAAAAGTTTACTAAGAAGACTTTTTTTGCAGTGTAGTTTTAACTTAATGTGAATTGTTCACTTT TTTAAGCTAGTTTTTCAGTGACTGTTCACTATTTCACTTAATTTACTTCGTTTTTTTTTTGACCAATCGTTTTAGTTTTCGTTAACTAATATAACCTTGGTTTGCGTGTCTTCTGTCCTGCAG-GGCTCTTT CCTCAGTGGTGGCTCTCGGTGCG AACATCATCTGCAATAAGATTCCGGGTCTCGCCCCCCGTCAGCGCGCCATCTGCCAGAGCCGGCCGGACGCCATCATCGTGATCGGAGAAGGAGCGCAGCTGGGCATTAACGAA TGCCAGTACCAGTTCAGATACGG CCGCTGGAACTGTTCAGCGTTGGGCGAACGCACCGTCTTCGGCCAGGAGCTGCGAGTAG-GTCAGTGCTTGCTTTGTTTGGGGATCTGGATTGATCGATGGACGTCATTGACATTTCTCTTAGTCTCTGTGGCAGCTTCTTCAACCTCTGGTT-GATGCAGGTGGACTTGTAATGA (SEQ ID NO: 11).

[0066] Among them, TTACAGGTTACGGATGAGGGAC (SEQ ID NO:12) and GATGCAGGTGGACTTGTAATGA (SEQ ID NO:13) are sequence amplification primers, GGCTCTTTCCTCAGTGGTGGCTCTCGGTGCGAACATCATCTGCAATAAGATTCCGGGTCTCGCCCCCCGTCAGCGCGCCATCTGCCAGAGCCGGCCGGACGCCATCATCGTGATCGGAGAAGGAGCGCAGCTGGGCATTAACGAATGCCAGTACCAGTTCAGATACGGCCGCTGGAACTGTTCAGCGTTGGGCGAACGCACCGTCTTCGGCCAGGAGCTGCGAGTAG (SEQ ID NO:14) is the gene exon sequence, and CCTCAGTGGTGGCTCTCGGTGCG (SEQ ID NO:15) and TGCCAGTACCAGTTCAGATACGG (SEQ ID NO:16) are target sequences.

[0067] (2) The primers for target detection were designed and synthesized as follows:

[0068] wnt7bb-F1:TTACAGGTTACGGATGAGGGAC (SEQ ID NO: 12).

[0069] wnt7bb-R1: TCATTACAAGTCCACCTGCATC (SEQ ID NO: 17).

[0070] (3) Target sequence validation:

[0071] Using the wild-type zebrafish genome as a template, PCR amplification was performed using synthetic detection primers and ExTaq enzyme, yielding a product length of 601 bp. Alignment analysis of the sequences downloaded from the ENSEMBL database and the sequencing results revealed that the actual sequences of Target1 and Target2 were consistent with the target sequences designed based on the database.

[0072] (4) The designed target sequence is as follows:

[0073] wnt7bb-Target1: CGCACCGAGAGCCACCACTG AGG (SEQ ID NO: 18) Reverse.

[0074] wnt7bb-Target2: TGCCAGTACCAGTTCAGATA CGG (SEQ ID NO: 19) Forward.

[0075] (5) The forward primers for target sgRNA amplification are (where the underlined sequence is the target sequence):

[0076] wnt7bb-Target1F:TTAATACGACTCACTATA GCGCACCGAGAGCCACCACTG GTTTTAGAGCTAGAAATAG (SEQ ID NO: 20).

[0077] wnt7bb-Target2F:TTAATACGACTCACTATA GTGCCAGTACCAGTTCAGATA GTTTTAGAGCTAGAAATAG (SEQ ID NO: 21).

[0078] (6) The reverse primer for target gRNA transcription is:

[0079] T7gRNA-R: AAAAAAAGCACCGACTCGGTGCCAC (SEQ ID NO: 10).

[0080] (7) Target gRNA amplification and transcription

[0081] The transcription template was amplified and recovered using the target forward primer and T7gRNA-R primer, respectively. In vitro transcription was performed using the E2040s transcription kit. The transcribed target gRNA was recovered using the AM1561 kit. The product was dissolved in NF water and the concentration was detected using a UV spectrophotometer before being used for embryo injection.

[0082] The knockout sgRNA target site of wnt7b was used to construct the deletion genome. After comparing knockdown efficiency, the target gene sgRNAs selected for subsequent experiments were 5′-ATTGGGGAAGGCGCTCAGCT GGG-3′ (SEQ ID NO:5) and 5′-CGCACCGAGAGCCACCACTG AGG-3′ (SEQ ID NO:15). The last three bases are PAM sequences located 3 nt downstream of the target gene, used for Cas9 protein recognition. Synthesized, capped, and purified Cas9 protein (EnGen® SpyCas9 NLS (catalog number M0646T, NEB, USA)) was diluted in nuclease-free water and used for control injection.

[0083] The target sgRNA and Cas9 protein were mixed and injected into AB wild-type zebrafish embryos. The final concentration of Cas9 protein was 800 ng / μL, and the final concentration of sgRNA was 320 ng / μL. Microinjection was performed during the first embryonic stage of zebrafish, with 1 nL injected into each embryo, and approximately 200 embryos were injected at each target site.

[0084] We then assessed the cleavage efficiency of each target gene using Sanger sequencing on 15 randomly selected zebrafish. We randomly selected 20 larvae and used qPCR to detect the expression levels of the target genes. All procedures performed in this study complied with the ARVO Statement on the Use of Animals for Ophthalmic Vision and Research. Furthermore, the handling of the zebrafish used in this study was approved by the Institutional Animal Care and Use Committee of Wenzhou Medical University.

[0085] 6. Eye Measurements and Morphological Analysis: Phenotypic abnormalities in all embryos were assessed at 5 dpf (5 days post-fertilization). For each experiment, 8–20 larvae were collected as a negative control and a target gene deletion group, respectively. Vertical and transverse images of each larva were captured using stereofluorescence microscopy (SZX16 and MVX10, OLYMPUS, Japan). Body length, eye area, and interocular distance were calculated using ImageJ. Axial length was measured using the built-in program (OLYMPUS Cellens Standard 1.14).

[0086] 7. Zebrafish Behavioral Experiment: This study analyzed the Optical Dynamic Response (OKR). The specific method used was based on the OKR measurement method published by Brokerhoff et al. in *Nature Protocols* in 2006 (Vol. 1, pp. 2448-2451), which is cited in full here. We randomly selected 16 injected larvae at 5 dpf and performed routine experiments. We used OKR software (ViewPoint OKR 2.0, ViewPoint, France) to record the larvae's eye movements over one minute.

[0087] 8. Zebrafish Swimming Ability Assessment: Swimming behavior was assessed at 5 days post-flop (dpf) and recorded using a behavioral assessment system (ZebraLab 3.22.3.31, Viewpoint, France). Ten larvae were collected from both the non-targeted and targeted groups to measure speed. The average speed was measured for each 5-minute dark period and 5-minute light period within two cycles. The difference in swimming speed per minute between light and dark stimuli was calculated to assess visual function.

[0088] 9. Frozen Sectioning and H&E Staining: Zebrafish embryos were fixed by immersion in 4% paraformaldehyde for 24 hours during day 5 of larval development. Samples were embedded using an embedding mold. Larvae were dehydrated in progressively higher concentrations of ethanol (75%, 85%, and 90%). Frozen sections were then prepared using a JB-P5 (Wuhan Junjie Electronics Co., Ltd.) and an RM2016 (Shanghai Leica Instruments Co., Ltd.) to a section thickness of 2.5 μm. These images were captured using a Pannoramic MIDI (3DHISRECH, Hungary). The thicknesses of the ganglion cell layer (GCL), inner nuclear layer (INL), photoreceptor layer (PR), and inner reticular layer (IPL) of the retina were calculated using CaseViewer and Photoshop.

[0089] 10. Statistical Analysis: Data are expressed as mean ± standard error. Wilcox rank-sum test and t-test were used to determine statistical significance between datasets using R (version 4.1.1). A p-value < 0.05 was considered statistically significant.

[0090] II. Experimental Results

[0091] 1. Participant Demographics Related to Five Ocular Parameters: 4540 participants had five ocular parameters (spherical equivalent (SE), axial length (AL), corneal curvature (K), axial length to corneal curvature ratio (AL / CR), and tachycardia-to-tachycardia distance (WTW)). After applying quality control procedures, a total of 3642 participants were included in the final analysis. Figure 1 As shown, the data for each eye parameter is summarized.

[0092] In addition, Table 3 summarizes demographic and ocular characteristics. Of the participants in this study, 1961 (53.84%) were male and 1681 (46.16%) were female, aged between 3 and 22 years. Data on SE were available for 3474 participants, 1206 for AL, 1341 for K, 1341 for AL / CR ratio, and 1112 for WTW. In the poorer visual acuity group, the mean SE was -8.01 ± 2.61 D, and the mean AL was 27.40 ± 0.86 mm. The mean K was 43.36 ± 2.07 D. The mean AL / CR in the poorer visual acuity group was 3.49 ± 0.02. The mean WTW was 12.09 ± 0.16 mm.

[0093] Table 3. Statistical summary of multidimensional eye parameters in high myopia

[0094]

[0095] 2. Mendelian randomization demonstrates causal relationships among multidimensional phenotypes: Colocalization analysis observed phenotypic correlations between SE and AL / CR, K and AL, WTW and AL, and WTW and K; however, a clear causal relationship among these ocular traits remains uninvestigated. Figure 2 (AB in the text). To explore possible causal relationships in depth, we used genetic variation as a tool and performed a two-sample, two-way Mendelian randomization (MR) analysis based on inverse variance weighting (IVW). When SE was considered as exposure and AL / CR as outcomes, SE became a risk factor for AL / CR ( AB in the text). )( Figure 2 (BC in the text). When AL / CR is the exposure factor and SE is the outcome, the causal relationship still exists. Therefore, SE and AL / CR showed a bidirectional connection. When K was used as the exposure factor and AL as the outcome, the results supported K as a risk factor for AL. , Figure 2 (BC in the context). However, when AL is considered as exposure and K as outcome, no causal relationship was observed between AL and K ( Furthermore, Mendelian randomization analysis showed no causal relationship between AL and WTW. A negative correlation was observed when WTW was used as the exposure and K as the outcome. In contrast, no significant total effect was detected when K was considered as the exposure level and WTW as the outcome.

[0096] The MR-PRESSO test showed no evidence of directed pleiotropy between SE and AL / CR, K and AL, and WTW and AL, further confirming the validity of the results (Table 4). However, sensitivity analysis using the IVW method revealed significant heterogeneity and pleiotropy in the two-way Mendelian randomization between WTW and K (p(heterogeneity)). WTWvsK =0.007, p (pleiotropy) WTWvsK =0.113, p (non-heterogeneity) KvsWTW =0.001, p (pleiotropy) KvsWTW =0.008).

[0097] Table 4. Results of co-localization analysis

[0098]

[0099] The key gene WNT7B was identified by screening ocular phenotypes and corresponding genotypes associated with high myopia, and then subjected to computational analysis. Tissue-specific expression profiling showed that WNT7B was most strongly expressed in the choroid, retinal pigment epithelium (RPE), cornea, and conjunctiva (KW test, p = 3.874 × 10⁻⁶). -8Wilcoxon rank-sum test, p strongest vs others =1.02×10 -10 However, as observed in the human protein atlas, WNT7B exhibits low expression in different cell types of the retina. Figure 3 Interestingly, previous studies have shown that WNT7B is highly expressed in the mouse retina, suggesting a potential role in eye development. Furthermore, WNT7B is highly enriched in the Wnt signaling pathway and has been shown to regulate intraretinal vascular development (FDR p-value = 3.39 × 10⁻⁶). -21 ).

[0100] 3. Zebrafish model reveals the regulatory role of wnt7b: wnt7ba and wnt7bb represent zebrafish homologs of wnt7b. Therefore, two sgRNAs were designed to target exon 2 of wnt7ba and wnt7bb, respectively (see...). Figure 4 The method shown in Figure A). Furthermore, qPCR analysis showed that compared to the negative control group (NC(wnt7ba+wnt7bb)), the expression of wnt7ba and wnt7bb in the deletion group (KD(wnt7ba+wnt7bb)) was significantly reduced (p<0.001). The results indicate that the knockout of wnt7b (including wnt7ba and wnt7bb) was successfully achieved. Figure 4 (B in the middle).

[0101] Furthermore, phenotypic analysis of KD(wnt7ba+wnt7bb) zebrafish showed that, compared with the negative control group, body length, eye area, and interocular distance were reduced (body length = 0.034, interocular distance < 0.014, eye area < 0.001). Figure 4 (CE in the text). Notably, compared to the negative control, the axial length of wnt7b KD larvae was significantly increased, supporting the potential role of wnt7b in HM development (an increase of 2.34%, p=0.05). Figure 4 In addition, HE staining showed that the Wnt7b-deficient GCL and INL appeared to be thicker compared with the negative control; however, the difference did not reach statistical significance. Figure 4 (Medium GI). For example Figure 5 As shown in Figure AB, compared with the negative control group, both IPL and PCL in the KD(wnt7ba+wnt7bb) group showed a trend of increased thickness (p>0.05). Furthermore, the OKR study results showed that with the absence of wnt7ba and wnt7bb, the eye movement frequency decreased sharply within one minute (a decrease of 50%, p=0.002). Figure 4 J in the middle). Compared with the KD (wnt7ba+wnt7bb) group, the control group had a greater difference in average swimming speed per minute under light and dark conditions (Figure 4 K decreased by 71.68% (p<0.001). Overall, the results indicate that the absence of wnt7ba and wnt7bb leads to decreased sensitivity to light stimulation.

[0102] This study involved 4,540 patients aged 3 to 22 years with high myopia from the MAGIC cohort, with data on five ocular parameters: SE, AL, K, AL / CR, and WTW. We identified the key gene WNT7B, which is significantly associated with high myopia (HM) in Chinese individuals. In this study, WNT7B was enriched in the choroid, RPE, and cornea. Ultimately, validated using a zebrafish model, wnt7b deficiency resulted in delayed ocular responses and reduced swimming speed relative to controls. Notably, axial elongation was also observed, suggesting that Wnt signaling is involved in the regulation of eye growth and myopia development. Despite these phenotypic changes, there was no significant difference in retinal layer thickness between groups, likely due to the relatively low expression of WNT7B in the retina observed in our study. These findings suggest that wnt7b may regulate axial elongation through a mechanism independent of retinal structure.

[0103] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.

Claims

1. A method for constructing a myopic zebrafish animal model, characterized in that, The method includes constructing wnt7ba and wnt7bb loss-of-function zebrafish mutants.

2. The method according to claim 1, characterized in that, The method includes the following steps: S1. In vitro transcription of sgRNA, wherein the recognition sequence of the sgRNA is located in the second exon of the zebrafish wnt7ba and wnt7bb genes, and the target sequence has the nucleotide sequence shown in SEQ ID NO:5 and SEQ ID NO:15; S2. The sgRNA and Cas9 protein are co-injected into zebrafish fertilized eggs to obtain wnt7ba and wnt7bb loss-of-function zebrafish mutants.

3. The method according to claim 1, characterized in that, The method further includes the following steps: S3. The injected fertilized eggs were cultured into adult fish to obtain F0 generation wnt7ba and wnt7bb zebrafish with functional deficiencies. S4. Cross the F0 generation zebrafish with missing wnt7ba and wnt7bb functions with wild-type zebrafish to obtain F1 generation zebrafish, and identify the F1 generation zebrafish with missing wnt7ba and wnt7bb functions. S5. Cross the F1 generation female and male zebrafish with missing wnt7ba and wnt7bb functions to obtain F2 generation zebrafish, and identify homozygous F2 generation zebrafish with missing wnt7ba and wnt7bb functions to obtain zebrafish mutants with stable inheritance of missing wnt7ba and wnt7bb functions.

4. The method according to claim 2, characterized in that, The final injection concentration of sgRNA in step S2 is 320 ng / μL, and the final injection concentration of Cas9 protein is 800 ng / μL.

5. The method according to claim 2, characterized in that, The zebrafish fertilized eggs mentioned in step S2 are single-cell embryos, and 1 nL is injected into each embryo.

6. A group of sgRNAs targeting the zebrafish wnt7ba and wnt7bb genes, characterized in that, The recognition sequence of the sgRNA is located in the second exon of the zebrafish wnt7ba and wnt7bb genes, and the target sequence has the nucleotide sequence shown in SEQ ID NO:5 and SEQ ID NO:

15.

7. The use of the sgRNA according to claim 6 in constructing wnt7ba and wnt7bb loss-of-function zebrafish mutants.

8. A method for screening drugs for the treatment of myopia, characterized in that, The method comprises the following steps: administering a drug to the wnt7ba and wnt7bb loss-of-function zebrafish mutants obtained by the method described in any one of claims 1-5; if the drug can improve the myopia-related symptoms of the mutants, then the drug is a candidate drug for myopia.

9. The application of the zebrafish mutants with lost-function wnt7ba and wnt7bb constructed by the method according to any one of claims 1-5 in the study of wnt7ba and wnt7bb gene function and / or in screening drugs for the treatment of high myopia.

10. Any of the following applications of WNT7B: 1) Application in the preparation of animal models of myopia; 2) Application in the preparation of gene therapy products for high myopia.

Images