Application of WNT7B in constructing myopia animal model

Abstract

The application provides an application of WNT7B in constructing a myopia animal model. Homologous genes wnt7ba and wnt7bb of WNT7B in zebrafish are knocked out or knocked down by using a CRISPR / Cas9 gene editing technology, and an animal model with a significantly increased eye axial length, a significantly reduced eyeball movement frequency and a reduced light response is obtained, which indicates that WNT7B is related to high myopia. The model provides an advantageous tool for a pathogenesis and drug screening of high myopia and has a good application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of animal model construction, and particularly relates to application of WNT7B in construction of myopia animal model. BACKGROUND

[0002] High myopia (HM) has become an important "culprit" leading to irreversible visual impairment. In the Chinese population, the genetic basis is complex and has not been fully elucidated. Currently, the spherical refraction reaching -6.00D or lower, or the eye axial length exceeding 26 mm is usually used as the criterion for determining high myopia. High myopia is not just a visual problem, it is closely related to a variety of serious eye fundus complications that threaten vision, such as myopic choroidal neovascularization (mCNV), retinal detachment (RD) and myopic macular degeneration (MMD), etc. These complications may eventually lead to irreversible blindness, causing a heavy blow to the quality of life of patients.

[0003] It is particularly worth noting that the prevalence of high myopia in the 16-18 year old adolescent group is showing a sharp upward trend. According to forecasts, the prevalence of high myopia in this group will soar from 7.3% in 2001 to 22.1% in 2050. However, high myopia is highly complex, and its heterogeneity makes it difficult to accurately define by simple classification diagnostic labels. The traditional research approach based on simple classification diagnostic labels has obvious limitations and cannot fully and accurately depict the true characteristics of high myopia, which has brought great challenges to the research and treatment of high myopia. In view of this situation, it is of immeasurable importance to explore the genetic susceptibility of high myopia for the prevention, diagnosis and treatment of the disease. SUMMARY

[0004] In view of the deficiencies in the prior art, the present application provides the application of WNT7B in construction of myopia animal model.

[0005] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions:

[0006] The first aspect of the present application provides a method for constructing a myopia zebrafish animal model, which comprises constructing a wnt7ba and wnt7bb function loss zebrafish mutant.

[0007] In the present application, the wnt7ba and wnt7bb function loss zebrafish mutant refers to knocking down the expression of wnt7ba and wnt7bb genes by targeting the 2nd exon of the two genes using the CRISPR-Cas9 system, so that the mRNA expression of zebrafish wnt7ba and wnt7bb is reduced by more than 90% compared with the wild type, thereby realizing the construction of a function loss mutant.

[0008] In the present application, WNT7B is full name of Wnt family member 7B, located in 22q13.31 of chromosome 22, encoding a secreted signal protein, and the gene ID is 7477. In zebrafish, WNT7B is encoded by wnt7ba and wnt7bb genes, the gene ID of wnt7ba is 563427, and the gene ID of wnt7bb is 100148840.

[0009] Further, the method comprises the following steps:

[0010] S1, transcribing sgRNA in vitro, the recognition sequence of the sgRNA is located in the 2nd exon of zebrafish wnt7ba and wnt7bb genes, and the target sequence has the nucleotide sequence shown in SEQ ID NO: 5 and SEQ ID NO: 15.

[0011] S2, co-injecting the sgRNA and the Cas9 protein into zebrafish fertilized eggs to obtain wnt7ba and wnt7bb function loss zebrafish mutants.

[0012] Further, the method further comprises the following steps:

[0013] S3, culturing the injected fertilized eggs into adult fish to obtain F0 generation wnt7ba and wnt7bb function loss zebrafish.

[0014] S4, crossing the obtained F0 generation wnt7ba and wnt7bb function loss zebrafish with wild type zebrafish to obtain F1 generation zebrafish, and identifying F1 generation wnt7ba and wnt7bb function loss zebrafish.

[0015] S5, crossing the obtained F1 generation wnt7ba and wnt7bb function loss female and male zebrafish to obtain F2 generation zebrafish, and identifying homozygous F2 generation wnt7ba and wnt7bb function loss zebrafish to obtain stably inherited wnt7ba and wnt7bb function loss zebrafish mutants.

[0016] In some embodiments, the injection final concentration of the sgRNA in step S2 is 320 ng / μL, and the injection final concentration of the Cas9 protein is 800 ng / μL.

[0017] In some embodiments, the zebrafish fertilized eggs in step S2 are single cell stage embryos, and each embryo is injected with 1 nL.

[0018] The second aspect of the present application provides a group of sgRNAs targeting zebrafish wnt7ba and wnt7bb genes, the recognition sequence of the sgRNAs is located in the 2nd exon of zebrafish wnt7ba and wnt7bb genes, and the target sequence has a nucleotide sequence as shown in SEQ ID NO: 5 and SEQ ID NO: 15.

[0019] The third aspect of the present application provides the use of the sgRNA of the second aspect of the present application in constructing a wnt7ba and wnt7bb functional deficiency zebrafish mutant.

[0020] The fourth aspect of the present application provides a method for screening myopia treatment drugs, and the steps of the method are as follows: administering a drug to the wnt7ba and wnt7bb functional deficiency zebrafish mutant constructed by the method of the first aspect of the present application, and if the drug can improve the symptoms of the mutant related to myopia, the drug is a candidate drug for myopia.

[0021] In some embodiments, the improvement refers to that the symptoms (such as body length, interocular distance, eye area, axial length, etc.) of the mutant are improved by at least about 10%, at least about 30%, at least about 50%, at least about 80% or more compared with before administering the drug.

[0022] Further, the candidate drug includes protein analogs, antibodies, DNA, RNA, small molecule compounds.

[0023] Further, the source of the small molecule compound is selected from the group consisting of: newly synthesized or existing databases; wherein the existing databases include, but are not limited to, general natural product databases (COCONUT, Super Natural II, NPASS), plant natural product databases (KNApSaCK, CMAUP, TriForC, Alkamid, NPACT DB, BioPhytMol), Chinese medicine natural product databases (CEMTDD, CHDD, ETCM, TM-MC, TCMID, YaTCM), microbial natural product databases (StreptomeDB, NPAltas, ProCarDB, PAMDB, Lichen Database), marine natural product databases (MNPD, SWMD), natural product databases of different countries and regions (IMPPAT, NeMedPlant, MedPServer, TlPdb, AfroDB, ANPDB, BIOFACQUIM, NUBBEDB), food natural product databases (FooDB, BitterDB, Phenol-Explorer, PhytoHub, SuperSweet database), toxic natural product databases (Exposome-Explorer, T3DB, SnakeNeurotoxin Database, TPPT), natural product industry catalogs (Greenpharma, AnalytiCon Discovery, InterBioScreen, Indofine Chemical Company, Pi Chemicals Systems\Specs, TargetMol), databases for MS data dereplication (MoNA, MassBank, METLIN, HMDB, YMDB, ReSpect, GNPS), databases for NMR data dereplication (NMRShiftDB, NAPROC-13), and the like.

[0024] Further, the DNA includes single-stranded DNA, double-stranded DNA, circular DNA, and ligated DNA.

[0025] Further, the RNA includes mRNA, tRNA, rRNA, snRNA, hRNA, antisense RNA, tCRNA, dsRNA, SCRNA, catalytically active RNA, and various viral RNAs.

[0026] Further, the candidate drug includes various pharmaceutically acceptable salt forms.

[0027] Further, the candidate drug includes a drug used alone or a pharmaceutical composition.

[0028] Further, the pharmaceutical composition refers to the combination of the candidate drug and the pharmaceutically acceptable carrier.

[0029] The term "pharmaceutically acceptable" is used herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit / risk ratio. Suitable carriers can be large, slowly metabolized macromolecules, such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, and amino acid copolymers. Such carriers are well known in the art. Pharmaceutically acceptable carriers in the pharmaceutical composition can include fluids such as water, saline, glycerol, and ethanol. Auxiliary substances such as wetting or emulsifying agents, pH buffering substances, and the like can also be present in such vehicles.

[0030] The fifth aspect of the present application provides the use of the wnt7ba and wnt7bb functional deletion zebrafish mutant obtained according to the method of the first aspect of the present application in the research of the gene function of wnt7ba and wnt7bb and / or in the screening of highly myopic therapeutic drugs.

[0031] The sixth aspect of the present application provides the use of WNT7B in any one of the following: 1) in the preparation of a myopia animal model; 2) in the preparation of a highly myopic gene therapy product.

[0032] In some embodiments, the highly myopic gene therapy product comprises a nucleic acid construct of a WNT7B-specific regulatory sequence.

[0033] Advantages and beneficial effects of the present application: by using CRISPR / Cas9 gene editing technology to knock out or knock down the homologous genes wnt7ba and wnt7bb of WNT7B in zebrafish, an animal model with significantly increased eye axial length, significantly reduced eye movement frequency, and reduced light response is obtained, which provides a favorable tool for the pathogenesis and drug screening of highly myopia. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 Statistical result graph of five eye parameters of participants.

[0035] Figure 2 Mendelian randomization analysis result graph of quantitative traits. A is the Mendelian randomization analysis result of two samples of quantitative traits related to HM (IVW model); B is the association between exposure factors and the risk of HM, and the red p value indicates that there is a significant causal relationship between exposure and outcome; C is Beta, which represents the size of the causal relationship between exposure and outcome; D is the causal effect of eye parameters.

[0036] Figure 3 Figure for WNT7B single cell enrichment analysis results.

[0037] Figure 4 Figure for the characterization of wnt7ba and wnt7bb loss-of-function zebrafish. A, schematic of sgRNA edited wnt7ba and wnt7bb gene positions; B, quantification of expression levels in negative control and loss-of-function zebrafish by qPCR; C-F, quantification of body and eye measurements, including body length (C), interocular distance (D), eye area (E) and eye axial length (F); G, H&E staining of zebrafish larval retina, PCL, photoreceptor cell layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer; H, statistical analysis of the thickness of each layer of the retina; H-I, thickness of GCL (H) and INL (I); J, frequency distribution (times / minute) of zebrafish larva eye movement; K, difference in swimming speed of negative control and loss-of-function zebrafish in 5 minutes light and 5 minutes dark period.

[0038] Figure 5 Figure for the characterization of wnt7ba and wnt7bb loss-of-function zebrafish. A, statistical chart of inner plexiform layer (IPL) thickness, B, statistical chart of photoreceptor layer (PCL) thickness. DETAILED DESCRIPTION

[0039] In order to enable those skilled in the art to better understand the present application, the technical solutions in the embodiments of the present application will be described clearly and completely below in conjunction with the accompanying drawings in the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0040] EMBODIMENT

[0041] I. Experimental methods

[0042] 1. Study design and participants: Participants in this study came from the Myopia Genetics and Intervention Consortium (MAGIC) project, some of whom received ophthalmic examinations, including refractive error measurement and ocular biometry, covering five ocular parameters: spherical equivalent (SE), axial length (AL), corneal curvature (K), axial length to corneal curvature ratio (AL / CR) and white to white distance (WTW). The definition of high myopia was based on the worst eye refractive status or axial length (WSE≤-6.00 D or WAL>26.0 mm). This study was approved by the Eye Hospital of Wenzhou Medical University and was conducted in accordance with the principles of the Helsinki Declaration. All participants provided written informed consent.

[0043] 2. Participant exclusion criteria: At the initial stage of data processing, individuals who lack a valid ID card or lack both SE and AL were excluded. Participants who had undergone previous ophthalmic surgery were excluded. In addition, subjects were excluded if the refractive status of the eye was greater than -6.00 diopters (D) or the ocular axial length was less than 26.0 millimeters (mm).

[0044] 3. Genotype data and quality control: All genotype data were retrieved from the patient database collected by the MAGIC project and were subjected to variant filtering using a standardized pipeline. Then, the corresponding genotypes of five eye phenotypes were extracted. The second-stage variant-level quality control included the following exclusion steps: call rate < 90%, Hardy-Weinberg equilibrium p < 1 x 10 6 , minor allele frequency (MAF) < 0.01.

[0045] 4. Gene function annotation: The tissue-specific expression profiles of risk genes were presented in the human eye transcriptome Altas (https: / / eye-transcriptome.com) and the human protein atlas (https: / / www.proteinatlas.org). The single-cell expression profiles of GSE236197 were utilized to assess the cell type specificity of finely mapped genes. The relative expression of candidate genes in a given cell cluster was calculated by the “Seurat” package. The RNA structure was visualized by Pymol. Finally, pathway enrichment analysis was performed by STRING (https: / / string-db.org / ) and gene ontology and KEGG analysis. Python 3.7 was used to visualize the top 10% of pathways. The p-value was adjusted for each pathway using the false discovery rate (FDR) method.

[0046] 5. Generation of wnt7b gene knockout zebrafish: Zebrafish (AB strain) were obtained from Hunter Biotech Co., Ltd. (China) and maintained at 28°C. Wild-type AB strain zebrafish were bred by natural pair mating. The clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein 9 (Cas9) system was used to inject zebrafish single-cell stage embryos using the PICOSPRITZER® III (Park Systems, USA) microinjector to construct CRISPR-mediated zebrafish mutants.

[0047] Design of wnt7ba gene deletion zebrafish: (1) the target position was designed as follows: CATCAGTGTGTCTGGTCTCCTC-CAAAGGGCTTTGTCTTCAGTCGTGGCTTTGGGCGCAAACATCATCTGCAACAAGATCCCCGGCCTGGCCCCCCGACAGCGTGCCATCTGCCAGAGCCGCCCAGATGCCATCATCATC ATTGGGGAAGGC GCTCAGCTGGG CATCAACGAGTGCCAGT ATCAGTTTCGCTACGGCCGGTGG AACTGCTCTGCCCTTGGCGAGAGGACCGTCTTTGGGCAAGAGCTGAGAGTAGGTCAGTAGGTGCAGCCCCGTGAGCTGTGCTTTCATGTCACATTCATAGTATGTGAGTGTGGGTGTGTGTGTGTGTGTATGTATGTTGTTTTGGCTGGATCTGTTTCCATTAGAGCCCTGCAAAACAAATGAGACAAAAAAGAGGTTAA-AGCAGATACAATCAGTCCGCAAT (SEQ ID NO: 1).

[0048] wherein CATCAGTGTGTCTGGTCTCCTC (SEQ ID NO: 2), AGCAGATACAATCAGTCCGCAAT (SEQ ID NO: 3) are sequence amplification primers, CATCAGTGTGTCTGGTCTCCTCCAAAGGGCTTTGTCTTCAGTCGTGGCTTTGGGCGCAAACATCATCTGCAACAAGATCCCCGGCCTGGCCCCCCGACAGCGTGCCATCTGCCAGAGCCGCCCAGATGCCATCATCATCATTGGGGAAGGCGCTCAGCTGGGCATCAACGAGTGCCAGTATCAGTTTCGCTACGGCCGGTGGAACTGCTCTGCCCTTGGCGAGAGGACCGTCTTTGGGCAAGAGCTGAGAGTAG (SEQ ID NO: 4) is gene exon sequence, and ATTGGGGAAGGCGCTCAGCTGGG (SEQ ID NO: 5), ATCAGTTTCGCTACGGCCGGTGG (SEQ ID NO: 6) are target sequences.

[0049] (2) the target detection primer was designed and synthesized as follows:

[0050] wnt7ba-F1: CATCAGTGTGTCTGGTCTCCTC (SEQ ID NO: 2).

[0051] wnt7ba-R1: ATTGCGGACTGATTGTATCTGCT (SEQ ID NO: 7).

[0052] (3) Target sequence verification:

[0053] The wild type zebrafish genome was used as a template for PCR amplification with synthetic detection primers and ExTaq enzyme, and the product length was 425 bp. The sequence downloaded from the ENSEMBL database was compared and analyzed with the sequencing results, and it was found that the actual sequence of Target 1 and Target 2 and the target sequence designed according to the database were consistent.

[0054] (4) The designed target sequence is as follows:

[0055] wnt7ba-Target1: ATTGGGGAAGGCGCTCAGCT GGG (SEQ ID NO: 5) Forward.

[0056] wnt7ba-Target2: ATCAGTTTCGCTACGGCCGG TGG (SEQ ID NO: 6) Forward.

[0057] (5) The forward primer for amplifying the target sgRNA is (where the underlined sequence is the target sequence):

[0058] wnt7ba-Target1F: TTAATACGACTCACTATA GATTGGGGAAGGCGCTCAGCT GTTTTAGAGCTAGAAATAG (SEQ ID NO: 8).

[0059] wnt7ba-Target2F: TTAATACGACTCACTATA GATCAGTTTCGCTACGGCCGG GTTTTAGAGCTAGAAATAG (SEQ ID NO: 9).

[0060] (6) The reverse primer for transcribing the target sgRNA is:

[0061] T7gRNA-R: AAAAAAAGCACCGACTCGGTGCCAC (SEQ ID NO: 10).

[0062] (7) Amplification and transcription of target sgRNA

[0063] The target point forward primer and T7gRNA-R primer were used to amplify and recover the transcription template, in vitro transcription was performed using E2040s transcription kit, the transcribed target point sgRNA was recovered using AM1561 kit, the product was dissolved in NF water, the concentration was detected by ultraviolet spectrophotometer, and the product was used for embryo injection.

[0064] Design of wnt7bb gene deletion zebrafish: (1) The target position was designed as follows:

[0065] TTACAGGTTACGGATGAGGGAC-CAGCTGCGATCAATCATATCATGTGCTTCTCTCGAAATTAGTTTGTAAAAGTTTACTAAGAAGACTTTTTTTGCAGTGTAGTTTTAACTTAATGTGAATTGTTCACTTTTTTAAGCTAGTTTTTCAGTGACTGTTCACTATTTCACTTAATTTACTTCGTTTTTTTTTTGACCAATCGTTTTAGTTTTCGTTAACTAATATAACCTTGGTTTGCGTGTCTTCTGTCCTGCAG-GGCTCTTT CCTCAGTGGTGGCTCTCGGTGCG AACATCATCTGCAATAAGATTCCGGGTCTCGCCCCCCGTCAGCGCGCCATCTGCCAGAGCCGGCCGGACGCCATCATCGTGATCGGAGAAGGAGCGCAGCTGGGCATTAACGAA TGCCAGTACCAGTTCAGATACGG CCGCTGGAACTGTTCAGCGTTGGGCGAACGCACCGTCTTCGGCCAGGAGCTGCGAGTAG-GTCAGTGCTTGCTTTTTGTTTGGGGATCTGGATTATTGATCGATGGACGTCATTGACATTTCTCTTAGTCTCTGTGGCAGCTTCTTCAACCTCTGGTT-GATGCAGGTGGACTTGTAATGA(SEQ ID NO:11)。

[0066] TTACAGGTTACGGATGAGGGAC (SEQ ID NO: 12), GATGCAGGTGGACTTGTAATGA (SEQ ID NO: 13) are sequence amplification primers, GGCTCTTTCCTCAGTGGTGGCTCTCGGTGCGAACATCATCTGCAATAAGATTCCGGGTCTCGCCCCCCGTCAGCGCGCCATCTGCCAGAGCCGGCCGGACGCCATCATCGTGATCGGAGAAGGAGCGCAGCTGGGCATTAACGAATGCCAGTACCAGTTCAGATACGGCCGCTGGAACTGTTCAGCGTTGGGCGAACGCACCGTCTTCGGCCAGGAGCTGCGAGTAG (SEQ ID NO: 14) is gene exon sequence, CCTCAGTGGTGGCTCTCGGTGCG (SEQ ID NO: 15), TGCCAGTACCAGTTCAGATACGG (SEQ ID NO: 16) are target sequences.

[0067] (2) The target detection primer is designed and synthesized as follows:

[0068] wnt7bb-F1: TTACAGGTTACGGATGAGGGAC (SEQ ID NO: 12).

[0069] wnt7bb-R1: TCATTACAAGTCCACCTGCATC (SEQ ID NO: 17).

[0070] (3) Target sequence verification:

[0071] The wild type zebrafish genome is used as a template, and the synthesized detection primer and ExTaq enzyme are used for PCR amplification, and the product length is 601 bp. The sequence downloaded from the ENSEMBL database is compared and analyzed with the sequencing results, and it is found that the actual sequence of Target 1 and Target 2 and the target sequence designed according to the database are consistent.

[0072] (4) The designed target sequence is as follows:

[0073] wnt7bb-Target1: CGCACCGAGAGCCACCACTG AGG (SEQ ID NO: 18) Reverse.

[0074] wnt7bb-Target2: TGCCAGTACCAGTTCAGATA CGG (SEQ ID NO: 19) Forward.

[0075] (5) The target sgRNA amplification forward primer is (where the underlined sequence is the target sequence):

[0076] wnt7bb-Target1F: TTAATACGACTCACTATA GCGCACCGAGAGCCACCACTG GTTTTAGAGCTAGAAATAG (SEQ ID NO: 20).

[0077] wnt7bb-Target2F: TTAATACGACTCACTATA GTGCCAGTACCAGTTCAGATA GTTTTAGAGCTAGAAATAG (SEQ ID NO: 21).

[0078] (6) The target gRNA transcription reverse primer is:

[0079] T7gRNA-R: AAAAAAAGCACCGACTCGGTGCCAC (SEQ ID NO: 10).

[0080] (7) The target gRNA amplification transcription

[0081] The transcription template is amplified and recovered using the target forward primer and T7gRNA-R primer, respectively, in vitro transcription is performed using an E2040s transcription kit, the transcribed target gRNA is recovered using an AM1561 kit, the product is dissolved in NF water, the concentration is detected using an ultraviolet spectrophotometer, and the product is used for embryo injection.

[0082] The knockout sgRNA target site of wnt7b is used to construct a deletion group. After comparing the knockdown efficiency, the sgRNA of the target gene selected for subsequent experiments is 5'-ATTGGGGAAGGCGCTCAGCT GGG-3' (SEQ ID NO: 5) and 5'-CGCACCGAGAGCCACCACTG AGG-3' (SEQ ID NO: 15), the last three bases are PAM sequences, located at the downstream 3nt of the target gene, used for Cas9 protein recognition. The Cas9 protein (EnGen® SpyCas9 NLS (catalog number M0646T, NEB, USA)) that has been synthesized, capped, and purified is diluted in nuclease-free water and used for control injection.

[0083] The target sgRNA and Cas9 protein are mixed and injected into AB wild-type zebrafish embryos, the final concentration of Cas9 protein is 800 ng / μL, and the final concentration of sgRNA is 320 ng / μL. Microinjection is performed at the 1-embryo stage of zebrafish, 1 nL is injected per embryo, and about 200 embryos are injected per target.

[0084] We then evaluated the cleavage efficiency of each target gene using 15 randomly selected zebrafish by Sanger sequencing. We randomly selected 20 larvae and detected the expression level of the target gene using qPCR. All procedures performed in this study were in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Visual Research. At the same time, the handling of zebrafish used in this study has been approved by the Institutional Animal Care and Use Committee of Wenzhou Medical University.

[0085] 6. Ocular measurements and morphological analysis: Phenotypic abnormalities of all embryos were evaluated at 5 dpf (days post fertilization). For each experiment, 8-20 larvae were collected as negative control and deletion of target gene group, respectively. Vertical and lateral images of each larva were captured by stereomicroscope (SZX16 and MVX10, OLYMPUS, Japan). Body length, eye area and interocular distance were calculated by ImageJ. Axial length was measured by built-in program (OLYMPUS cellsens standard 1.14).

[0086] 7. Zebrafish behavior experiment: This study analyzed optokinetic response (OKR) according to the method of OKR measurement published by Brockerhoff et al. in 2006 (Nature Protocols, Vol. 1, pp. 2448-2451), which is hereby incorporated in its entirety. We randomly selected 16 injected larvae at 5 dpf and performed routine experiments. We used OKR software (ViewPoint OKR 2.0, ViewPoint, France) to record the eye movement of larvae within 1 minute.

[0087] 8. Zebrafish swimming ability determination: Swimming behavior was performed at 5 dpf and recorded by a behavioral evaluation system (ZebraLab 3.22.3.31, Viewpoint, France). Ten larvae were collected from non-targeted and targeted groups to measure the speed. The average speed was measured in two cycles, each 5 minutes of dark and 5 minutes of light. The difference in swimming speed per minute under light and dark stimuli was calculated to assess visual function.

[0088] 9. Cryosectioning and H&E staining: We fixed zebrafish embryos at 5 days post-fertilization larval stage by immersion in 4% paraformaldehyde for 24 hours. The samples were embedded using an embedding mold. The larvae were dehydrated in graded concentrations of ethanol (75%, 85%, and 90%). Then, cryosections were performed using JB-P5 (Wuhan Jianjian Electronic Co., Ltd.) and RM2016 (Leica Microsystems Shanghai Co., Ltd.) with a section thickness of 2.5 pm. These images were taken using Pannoramic MIDI (3DHISRECH, Hungary). The thickness of the ganglion cell layer (GCL), inner nuclear layer (INL), photoreceptor layer (PR), and inner plexiform layer (IPL) of the retina was calculated using CaseViewer and Photoshop.

[0089] 10. Statistical analysis: Data are presented as mean ± standard error. Wilcox rank-sum test and t-test were used to determine statistical significance between datasets using R (version 4.1.1). A p-value < 0.05 was considered statistically significant.

[0090] II. Results

[0091] 1. Participant demographics associated with five ocular parameters: Five ocular parameters (spherical equivalent (SE), axial length (AL), corneal curvature (K), AL / CR ratio, and white-to-white distance (WTW)) were obtained for 4540 participants. After applying quality control procedures, a total of 3642 participants were included in the final analysis. As shown in Table 1, data for each ocular parameter were summarized. Figure 1

[0092] In addition, Table 3 summarizes the demographics and ocular characteristics. Among the people who participated in this study, 1961 (53.84%) participants were male and 1681 (46.16%) were female, aged between 3 and 22 years. A total of 3474 participants had available data for SE, 1206 for AL, 1341 for K, 1341 for AL / CR ratio, and 1112 for WTW. In the poor vision group, the average SE was -8.01 ± 2.61 D, and the average AL was 27.40 ± 0.86 mm. The average K was 43.36 ± 2.07 D. The average AL / CR ratio for the poor vision group was 3.49 ± 0.02. The average WTW was 12.09 ± 0.16 mm.

[0093] Table 3. Statistical summary of high myopia multi-dimensional ocular parameters

[0094]

[0095] ​2. Mendelian randomization to prove causal relationship between multi-dimensional phenotypes: Colocalization analysis observed phenotypic correlations between SE and AL / CR, K and AL, WTW and AL, and WTW and K, however, the explicit causal relationship between these eye features has not been investigated (A-B in Figure 2 To further investigate the possible causal relationship, we used genetic variation as a tool and performed two-sample bidirectional Mendelian randomization (MR) analysis based on inverse-variance weighting method (IVW). When SE was taken as exposure and AL / CR as outcome, SE became a risk factor for AL / CR ( ) (B-C in Figure 2 ). When AL / CR was taken as exposure and SE as outcome, the causal relationship still existed ( ). Therefore, SE and AL / CR showed bidirectional connection. When K was taken as exposure and AL as outcome, the result supported that K was a risk factor for AL ( , Figure 2 ) (B-C in ). However, when AL was taken as exposure and K as outcome, no causal relationship was observed between AL and K ( ). In addition, Mendelian randomization analysis showed that there was no causal relationship between AL and WTW. When WTW was taken as exposure and K as outcome, a negative correlation was observed (

[0096] MR-PRESSO test showed that there was no evidence of directional pleiotropy between SE and AL / CR, K and AL, and WTW and AL, further confirming the validity of the results (Table 4). However, the sensitivity analysis of IVW method showed that there was significant heterogeneity and pleiotropy in the bidirectional Mendelian randomization between WTW and K (p(heterogeneity) WTWvsK = 0.007, p(pleiotropy) WTWvsK = 0.113, p(non-heterogeneity) KvsWTW = 0.001, p(pleiotropy) KvsWTW

[0097] Table 4. Colocalization analysis results

[0098]

[0099] The key gene WNT7B was obtained by screening the eye phenotypes related to high myopia and the corresponding genotypes, and was subjected to computational analysis. The tissue-specific expression profile showed that WNT7B was most strongly expressed in choroid, retinal pigment epithelium (RPE), cornea and conjunctiva (K-W test, p = 3.874 x 10 -8 ​Wilcoxon rank-sum test, p strongest vs others =1.02×10 -10 However, as observed in the human protein atlas, WNT7B exhibits low expression in different cell types of the retina. Figure 3 Interestingly, previous studies have shown that WNT7B is highly expressed in the mouse retina, suggesting a potential role in eye development. Furthermore, WNT7B is highly enriched in the Wnt signaling pathway and has been shown to regulate intraretinal vascular development (FDR p-value = 3.39 × 10⁻⁶). -21 ).

[0100] 3. Zebrafish model reveals the regulatory role of wnt7b: wnt7ba and wnt7bb represent zebrafish homologs of wnt7b. Therefore, two sgRNAs were designed to target exon 2 of wnt7ba and wnt7bb, respectively (see...). Figure 4 The method shown in Figure A). Furthermore, qPCR analysis showed that compared to the negative control group (NC(wnt7ba+wnt7bb)), the expression of wnt7ba and wnt7bb in the deletion group (KD(wnt7ba+wnt7bb)) was significantly reduced (p<0.001). The results indicate that the knockout of wnt7b (including wnt7ba and wnt7bb) was successfully achieved. Figure 4 (B in the middle).

[0101] Furthermore, phenotypic analysis of KD(wnt7ba+wnt7bb) zebrafish showed that, compared with the negative control group, body length, eye area, and interocular distance were reduced (body length = 0.034, interocular distance < 0.014, eye area < 0.001). Figure 4 (CE in the text). Notably, compared to the negative control, the axial length of wnt7b KD larvae was significantly increased, supporting the potential role of wnt7b in HM development (an increase of 2.34%, p=0.05). Figure 4 In addition, HE staining showed that the Wnt7b-deficient GCL and INL appeared to be thicker compared with the negative control; however, the difference did not reach statistical significance. Figure 4 (Medium GI). For example Figure 5 As shown in Figure AB, compared with the negative control group, both IPL and PCL in the KD(wnt7ba+wnt7bb) group showed a trend of increased thickness (p>0.05). Furthermore, the OKR study results showed that with the absence of wnt7ba and wnt7bb, the eye movement frequency decreased sharply within one minute (a decrease of 50%, p=0.002). Figure 4 J in the middle). Compared with the KD (wnt7ba+wnt7bb) group, the control group had a greater difference in average swimming speed per minute under light and dark conditions (Figure 4 K, a decrease of 71.68%, p < 0.001). Overall, the results indicate that wnt7ba and wnt7bb deletion leads to a decrease in sensitivity to light stimulation.

[0102] This study involved 4540 highly myopic patients aged 3 to 22 years from the MAgic cohort, who had data on five ocular parameters, namely SE, AL, K, AL / CR, and WTW. We found the key gene WNT7B significantly associated with Chinese highly myopic (HM). In this study, WNT7B was enriched in the choroid, RPE, and cornea. Finally, according to the zebrafish model validation, wnt7b deletion led to a delayed ocular response and a decrease in swimming speed relative to the control group. Notably, axial elongation was also observed, suggesting that Wnt signaling is involved in the regulation of eye growth and myopia development. Despite these phenotypic changes, there were no significant differences in retinal layer thickness between groups, which could be due to the relatively low expression of WNT7B in the retina observed in our study. These findings suggest that wnt7b can regulate axial elongation through mechanisms unrelated to retinal structure.

[0103] The above description of the embodiments is only for the purpose of understanding the method of the present application and its core idea. It should be noted that for those skilled in the art, without departing from the principles of the present application, a number of improvements and modifications can be made to the present application, and these improvements and modifications will also fall within the scope of protection of the claims of the present application.

Claims

1. A method for constructing a myopic zebrafish animal model, characterized in that, The method includes constructing wnt7ba and wnt7bb loss-of-function zebrafish mutants based on the sgRNAs shown in SEQ ID NO:5 and SEQ ID NO:

15.

2. The method according to claim 1, characterized in that, The method includes the following steps: S1. In vitro transcription of sgRNA, wherein the recognition sequence of the sgRNA is located in the second exon of the zebrafish wnt7ba and wnt7bb genes, and the nucleotide sequence of the sgRNA is shown in SEQ ID NO:5 and SEQ ID NO:15; S2. The sgRNA and Cas9 protein were co-injected into zebrafish fertilized eggs and cultured to obtain zebrafish mutants with loss of function of wnt7ba and wnt7bb. S3. The injected fertilized eggs were cultured into adult fish to obtain F0 generation wnt7ba and wnt7bb zebrafish with functional deficiencies. S4. Cross the F0 generation zebrafish with missing wnt7ba and wnt7bb functions with wild-type zebrafish to obtain F1 generation zebrafish, and identify the F1 generation zebrafish with missing wnt7ba and wnt7bb functions. S5. Cross the F1 generation female and male zebrafish with missing wnt7ba and wnt7bb functions to obtain F2 generation zebrafish, and identify homozygous F2 generation zebrafish with missing wnt7ba and wnt7bb functions to obtain zebrafish mutants with stable inheritance of missing wnt7ba and wnt7bb functions.

3. The method according to claim 2, characterized in that, The final injection concentration of sgRNA in step S2 is 320 ng / μL, and the final injection concentration of Cas9 protein is 800 ng / μL.

4. The method according to claim 2, characterized in that, The zebrafish fertilized eggs mentioned in step S2 are single-cell embryos, and 1 nL is injected into each embryo.

5. A group of sgRNAs targeting the zebrafish wnt7ba and wnt7bb genes, characterized in that, The recognition sequence of the sgRNA is located in the second exon of the zebrafish wnt7ba and wnt7bb genes, and the nucleotide sequence of the sgRNA is shown in SEQ ID NO:5 and SEQ ID NO:

15.

6. The use of the sgRNA according to claim 5 in constructing wnt7ba and wnt7bb loss-of-function zebrafish mutants.

Images