Use of a reagent for detecting a snp molecular marker associated with pork quality traits
By developing a molecular marker detection reagent for SNPs related to pork quality, and using the SNP site of the Ucp3 gene to detect intramuscular fat content in pigs, the problem of long cycle and low efficiency in traditional breeding methods has been solved, and the effect of rapid screening and genetic improvement of high-quality meat traits has been achieved.
Patent Information
- Application Number
- CN202511529104.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-24
- Publication Date
- 2026-05-15
- Estimated Expiration
- 2045-10-24
AI Technical Summary
Current technologies for improving pork quality rely on traditional phenotypic selection, which results in long breeding cycles, low efficiency, and a lack of effective molecular markers for rapid screening of high-quality meat traits.
A molecular marker detection reagent for SNPs associated with pork quality traits was developed. By detecting SNP1 and SNP2 sites in exon 2 of the Ucp3 gene, PCR reaction and sequencing were performed using primer sets to identify intramuscular fat content in pigs and screen out pig breeds with rich intramuscular fat content.
This technology enables rapid and accurate identification of intramuscular fat content in pork, shortens the genetic breeding cycle for high-quality meat traits, and improves breeding efficiency and product quality.
Smart Images

Figure CN121023044B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of animal breeding technology, specifically relating to the application of detection reagents for SNP molecular markers related to pork quality traits. Background Technology
[0002] With economic development and rising consumption levels, the market demand for high-quality pork products is increasing. Although imported pig breeds have undergone intensive selective breeding and exhibit significant advantages in growth performance, their meat quality is generally poor. Therefore, how to effectively utilize my country's abundant local pig breed resources to cultivate new breeds with excellent meat quality and stable genetic performance has become a key issue in current pig breeding work.
[0003] The Songliao Black Pig, the first lean-type maternal breed developed in northern my country, is characterized by its high-quality meat and long carcass. The Leixiang Pig, a local breed containing bloodlines from Bama Xiang Pig, Meishan Pig, and wild boar, is known for its tolerance to roughage and strong adaptability, but suffers from a large, drooping abdomen and relatively small size. The Songlei Black Pig is a new breed developed using the genetic resources of the Songliao Black Pig and Leixiang Pig. It is characterized by its symmetrical structure, full legs and rump, cold resistance, tolerance to roughage, strong environmental adaptability, and high reproductive capacity.
[0004] In current technologies, the improvement of pork quality mainly relies on traditional phenotypic selection methods. These methods have inherent limitations, such as long cycles, low efficiency, and dependence on post-slaughter phenotypic testing, leading to slow breeding progress. Molecular marker technology can more accurately select pig breeds with superior meat quality traits, thereby improving breeding efficiency, farming efficiency, and product quality. However, the number of molecular markers related to pork quality currently developed is relatively small, and many molecular marker loci related to pork quality remain undiscovered. Therefore, identifying molecular markers related to pork quality traits and developing corresponding detection reagents is essential for achieving rapid screening and genetic improvement of pork quality traits. Summary of the Invention
[0005] To address the aforementioned issues, this invention provides the application of a detection reagent for SNP molecular markers related to pork quality traits. This reagent can be used for pig-assisted breeding, pig selection, pork quality trait identification, or pork quality trait screening, which is beneficial for accelerating the genetic breeding of high-quality pork quality trait pigs.
[0006] To achieve the above objectives, the specific technical solution of the present invention is as follows:
[0007] The first aspect of this invention provides an application of a detection reagent for SNP molecular markers related to pork quality traits, wherein the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1; the SNP molecular marker has two polymorphic sites, namely SNP1 and SNP2; SNP1 is located at the 208th bp from the 5' end of the sequence shown in SEQ ID NO.1, and SNP2 is located at the 217th bp from the 5' end of the sequence shown in SEQ ID NO.1; the polymorphism of SNP1 and SNP2 is C / T, and they are synchronously mutated; the application is for pig-assisted breeding, pig selection, pork meat quality trait identification, or pork meat quality trait screening.
[0008] Furthermore, the meat quality characteristic refers to the intramuscular fat content.
[0009] Furthermore, all the polymorphic sites exhibit the same CC, CT, or TT genotype, with the T allele being the dominant allele. Pigs with the TT polymorphic site have a higher intramuscular fat content than those with the CC polymorphic site.
[0010] Furthermore, the detection reagent is a primer set for detecting SNP molecular markers related to pork quality traits; the primer set consists of an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 3.
[0011] Furthermore, the pig in question is a Songlei Black Pig.
[0012] A second aspect of the present invention provides a method for identifying the intramuscular fat content of pork, comprising the following steps:
[0013] DNA was extracted from the pigs to be tested;
[0014] Using the primer set described above, PCR reaction was performed with the DNA of the pig to be tested as a template to obtain PCR products;
[0015] The PCR products were sequenced to identify the genotypes of SNP1 or SNP2 in the sequence shown in SEQ ID NO.1 of the amplified product. The intramuscular fat content of pork was determined based on the genotypes of SNP1 or SNP2: the intramuscular fat content of the TT genotype of SNP1 or SNP2 was greater than that of the CC genotype.
[0016] Furthermore, each 20 μL PCR reaction system contains: 2 μL DNA template, 1 μL upstream primer, 1 μL downstream primer, 10 μL 2x Taq Master Mix, and ddH2O to make up the difference.
[0017] Furthermore, the PCR reaction procedure is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 40 s, 34 cycles; 72℃ extension for 5 min.
[0018] Furthermore, the sequencing was Sanger sequencing.
[0019] Furthermore, the pig to be tested was a black pig.
[0020] Furthermore, the black pig mentioned is the Songlei Black Pig.
[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0022] This invention discloses the application of a detection reagent for SNP molecular markers related to pork quality traits. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1. This molecular marker has two polymorphic sites, SNP1 and SNP2. SNP1 is located at position 208 bp from the 5' end of the sequence shown in SEQ ID NO.1, and SNP2 is located at position 217 bp from the 5' end of the sequence shown in SEQ ID NO.1. Both SNP1 and SNP2 are C / T polymorphic, indicating the same CC, CT, or TT genotype, with the T allele being the dominant allele. Pigs with the TT genotype have a higher intramuscular fat content than those with the CC genotype. This invention develops a reagent for detecting this SNP molecular marker, which can be used for pig-assisted breeding, pig selection, pork meat quality trait identification, or pork meat quality trait screening. This invention also develops a method for identifying the intramuscular fat content of pork, which can be used simply and quickly to identify pork with abundant intramuscular fat, thus shortening the genetic breeding cycle for pigs with high-quality meat traits. Attached Figure Description
[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0024] Figure 1 To demonstrate the alignment results of some PCR product sequences, the sequences in rows corresponding to 2-81-2F_C03.abl, 2-82-2F_C03.abl, 2-83-2F_C03.abl, 2-84-2F_C03.abl, and 2-85-2F_C03.abl are sequences amplified using DNA from different Songlei black pig samples as templates, while the sequence in row corresponding to DNAMAN2.seq Consensus is the reference sequence.
[0025] Figure 2 Songlei Black Pig Ucp3 Genotype sequencing data at positions 208bp and 217bp in image -2, with black arrows indicating two SNP sites. Figure 2 The A in the data indicates that both SNP loci are of the CC genotype. Figure 2 B in the data indicates that the two SNP loci are of the TT genotype. Figure 2 The C in the data indicates that the two SNP loci are of the CT genotype. Detailed Implementation
[0026] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.
[0027] To address the limitations of conventional meat quality breeding, such as long cycles, low efficiency, and reliance on post-slaughter testing, the discovery of new molecular markers and the development of supporting detection reagents are crucial for the rapid identification and efficient genetic improvement of live pig meat quality traits.
[0028] pig Ucp3 The gene, located on chromosome 9, contains 7 exons and encodes 308 amino acids. It is a key protein on the inner mitochondrial membrane, mediating the uncoupling of the mitochondrial respiratory chain. It is specifically highly expressed in skeletal muscle, affecting metabolic homeostasis and oxidative stress levels in muscle cells. This invention investigates the effects of different Songlei black pig samples... Ucp3 After comparing the gene sequence of the second exon, it was found that... Ucp3 Two SNP sites, labeled SNP1 and SNP2, are located at positions 208 bp and 217 bp from the 5' end of the gene sequence in exon 2. Both SNP1 and SNP2 exhibit the same CC, CT, or TT genotype. By analyzing the association between SNP polymorphisms and meat quality traits, molecular markers associated with intramuscular fat content in pork were obtained. A reagent for detecting these SNP molecular markers and a method for identifying intramuscular fat content in pork were developed.
[0029] Example 1: Application of detection reagents for SNP molecular markers related to pork quality traits
[0030] I. Development of Molecular Markers and Their Detection Reagents
[0031] 1. Sample collection
[0032] Eighty-eight Songlei Black Pigs of market age were randomly selected. After slaughter, the longissimus dorsi muscle tissue on the left side was collected, and its meat quality was tested according to NY / T821-2019 "Specifications for the Determination of Pig Muscle Quality". Simultaneously, pea-sized muscle tissue samples were collected using surgical scissors and forceps, placed in 1.5mL centrifuge tubes, labeled with ear numbers and dates, and brought back to the laboratory. The muscle tissue samples were stored at -80℃ for later use.
[0033] 2. Genomic DNA extraction
[0034] Genomic DNA was extracted using the genomic DNA extraction kit from Tiangen Biotech Co., Ltd. The concentration and purity of the DNA were detected using an ultra-micro spectrophotometer, and qualified samples were selected and stored at -80℃ for later use.
[0035] 3. Primer design and synthesis
[0036] pig Ucp3 The gene's Ensembl ID in the Ensemble database is ENSSCG00105009109.1. Ucp3 The nucleotide sequence of exon 2 of the gene is shown in SEQ ID NO.1. This invention will... Ucp3 The marker of the second exon of the gene is Ucp3 -2, according to Ucp3 The nucleotide sequence of -2 is designed for amplification. Ucp3 The primer set -2 contains an upstream primer with the nucleotide sequence shown in SEQ ID NO.2 and a downstream primer with the nucleotide sequence shown in SEQ ID NO.3. The primer set was synthesized by Suzhou Genewiz Biotechnology Co., Ltd.
[0037] SEQ ID NO.1:
[0038] GGCAGGGCCAGTCCCCTGCTGGTGCTGCGGGAGCCGGGGGACCGTCCCAGAAGCCCGGGCTCCGTGGCTCGGCTCTGCAGCCTCCCCCGCACGGAAGCCCAGGCCGGGCAGCTCTCCTGGAACCTCCCTGCTGGGCCCTGGGGGA CCTGGCAGAGCCCTGGGACATGGTGGGCCTGAAGCCTCCCGAGGTGCCGCCCACGACGGCCGTGAAGCTCCTGGGGGCGGGCACCGCGGCCTGCTTCGCCGACCTCCTCACCTTCCCACTGGACACGGCCAAGGTCCGCCTGCAG.
[0039] SEQ ID NO. 2: 5'-CCCAACCAGAGCCAGTGTA-3'.
[0040] SEQ ID NO. 3: 5'-GAGTCGTCAGTGGCTTGTCC-3'.
[0041] 4. PCR amplification
[0042] Using the primer set from step 3, and the DNA extracted in step 2 as a template, PCR amplification was performed according to the following PCR reaction system and procedure to obtain the amplification product. After the PCR product was identified as correct by agarose gel electrophoresis, it was sent to Suzhou Genewiz Biotechnology Co., Ltd. for Sanger sequencing.
[0043] Each 20 μL PCR reaction system contains: 2 μL DNA template, 1 μL upstream primer, 1 μL downstream primer, 10 μL 2x TaqMaster Mix, and ddH2O to make up the difference.
[0044] PCR reaction procedure: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 40 s, for a total of 34 cycles; 72℃ extension for 5 min; store at 4℃.
[0045] 5. Ucp3 -2 gene polymorphism detection
[0046] The sequencing results of PCR products were compared with the pig genomic DNA sequences published in the Ensemble database using DANMAN and Chromas software. For mutation sites, the peak diagrams were analyzed using Chromas software.
[0047] The PCR product sequence is shown in SEQ ID NO.4, with the underlined part indicating... Ucp3 -2 nucleotide sequence, where Y represents C or T.
[0048] SEQ ID NO.4:
[0049] tcccaaccagagccagtgtagaccaagctctgggcagaggctgggggaggatggcgagagctacgggaggaaagccccattcttacacgtcgaatccacag GGCAGGGCCAGTCCCCTGCTGGTGCTGCGGGAGCCGGGGGACC GTCCCAGAAGCCCGGGCTCCGTGGCTCGGCTCCTGCAGCCTCCCCCGCACGGAAGCCCAGGCCGGGCAGCTCTCCT GGAACCTCCCTGCTGGGCCCTGGGGGACCTGGCAGAGCCCCTGGGACATGGTGGGCCTGAAGCCTCCCGAGGTGCC GCCCACGACGGCYGTGAAGCTYCTGGGGGCGGGCACCGCGGCCTGCTTCGCCGACCTCCTCACCTTCCCACTGGAC ACGGCCAAGGTCCGCCTGCAGgtaggtgccctttggccaaaggtcactgttcccagaggggaggggtcgagtccgccaccagggccccgggccctctgcctgctggtcctcaagaagggcctgagcagcccagtcgccccgcgtcccaccgcccca tcaccatcgcccaagaccaaaggagcttaactccttggcttgacgagccaggtccccccttgccctgctctgtaaaccataaagtgaagtccacgcaaggaagctctctgggagcttggacaagccactgacgact.
[0050] like Figure 1 and Figure 2 As shown, it was found Ucp3 -2 There is a SNP site at position 208 (labeled SNP1) and a SNP site at position 217 (labeled SNP2). Both SNP1 and SNP2 are C / T mutations, and the mutations are synchronous, with three genotypes: CC, CT, and TT.
[0051] II. Verification of the association between molecular markers and pork quality traits
[0052] 1. Genotype frequency and gene frequency
[0053] The genotype frequencies, gene frequency calculation results, and chi-square goodness test results of the SNP loci are shown in Table 1.
[0054] Table 1. Statistical table of genotype frequencies and gene frequencies
[0055]
[0056] Table 1 shows that the CC genotype was the most numerous and therefore the dominant genotype; C was the dominant gene. The chi-square test of fitness indicates that the gene distribution at the C / T locus in Songlei black pigs conforms to Hardy-Weinberg equilibrium. P >0.05.
[0057] 2. Population genetic diversity
[0058] Table 2 shows the genetic homozygosity, genetic heterozygosity, effective number of alleles, and polymorphism information content of SNPs in the population.
[0059] Table 2. Genetic diversity of SNP loci
[0060]
[0061] The genetic heterozygosity of the SNPs is at a moderate level; the effective number of alleles is close to 2, indicating that these alleles are evenly distributed in the population; the polymorphism information content is greater than 0.25 and less than 0.5, indicating moderate polymorphism.
[0062] 3. Association analysis between SNP molecular markers and pork quality traits
[0063] This invention first tested the initial moisture content, pressure loss rate, pH, brightness, redness, yellowness, tenderness, and intramuscular fat content of pork from 88 Songlei black pig samples. Then, an association analysis was performed on the three genotypes of SNPs in the Songlei black pig population with meat quality traits. Among them, there were 28 samples with the CC genotype, 36 samples with the CT genotype, and 24 samples with the TT genotype. The results of the association analysis are shown in Table 3.
[0064] Table 3. Association analysis between genotype and meat quality traits
[0065]
[0066] Note: Different capital letters in the superscript of the table indicate extremely significant differences. P <0.01.
[0067] As shown in Table 3, the three genotypes were significantly correlated with intramuscular fat content, but not significantly different from other tested meat quality traits. Individuals with the TT genotype had significantly higher intramuscular fat content than those with the CC and CT genotypes, indicating that individuals carrying the T allele had significantly higher intramuscular fat content than homozygous wild-type CC individuals.
[0068] It should be noted that when numerical ranges are involved in this invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as in the embodiments, preferred embodiments are described here to avoid redundancy. Although preferred embodiments of the invention have been described, those skilled in the art, once they understand the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this invention.
[0069] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. The application of detection reagents for SNP molecular markers related to pork quality traits, wherein the application is for breeding Songlei Black pig breeds with high intramuscular fat content, identifying or screening pork meat quality traits, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1; the SNP molecular marker has two polymorphic sites, namely SNP1 and SNP2; SNP1 is located at the 208th bp from the 5' end of the sequence shown in SEQ ID NO.1, and SNP2 is located at the 217th bp from the 5' end of the sequence shown in SEQ ID NO.1; the polymorphism of SNP1 and SNP2 is C / T; the meat quality trait is intramuscular fat content; the pig is Songlei Black Pig.
2. The application of the detection reagent for SNP molecular markers related to pork quality traits according to claim 1, characterized in that, The SNP1 and SNP2 showed the same CC, CT or TT genotypes, and the intramuscular fat content of pigs with the TT genotype was greater than that of pigs with the CC genotype.
3. The application of the detection reagent for SNP molecular markers related to pork quality traits according to claim 1, characterized in that, The detection reagent is a primer set for detecting SNP molecular markers related to pork quality traits; the primer set consists of an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.
3.
4. A method for determining the intramuscular fat content of pork, characterized in that, The pig in question is a Songlei Black Pig; the following steps are included: DNA was extracted from the pigs to be tested; Using the primer set described in claim 3, a PCR reaction was performed with the DNA of the pig to be tested as a template to obtain PCR products; The PCR products were sequenced to identify the genotypes of SNP1 or SNP2 in the sequence shown in SEQ ID NO.
1. SNP1 is located at position 208 bp from the 5' end of the sequence shown in SEQ ID NO.1, and SNP2 is located at position 217 bp from the 5' end of the sequence shown in SEQ ID NO.
1. The intramuscular fat content of pork was determined based on the genotypes of SNP1 or SNP2: the intramuscular fat content of the TT genotype of SNP1 or SNP2 was greater than that of the CC genotype.
5. The method for identifying intramuscular fat content in pork according to claim 4, characterized in that, Each 20 μL PCR reaction system contains: 2 μL DNA template, 1 μL upstream primer, 1 μL downstream primer, 10 μL 2x Taq Master Mix, and ddH2O to make up the difference.
6. The method for identifying intramuscular fat content in pork according to claim 4, characterized in that, The PCR reaction procedure was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 40 s, for 34 cycles; 72℃ extension for 5 min.