Avian salmonella nucleic acid rapid detection method and kit based on RAA-CRISPR-Cas13a technology

Abstract

The invention discloses an avian salmonella nucleic acid rapid detection method based on a RAA-CRISPR-Cas13a technology and a kit, and belongs to the technical field of biochemistry and molecular biology. On the basis of the designed RAA primer pair and crRNA, the avian salmonella nucleic acid detection based on an RAA-CRISPR-Cas13a enzyme molecular system is established, the system is high in specificity and sensitivity, rapid detection of avian salmonella can be achieved within 30 minutes, the detection sensitivity of a fluorescence method can reach 100 copies / microliter, and the detection sensitivity of a test paper method can reach 102 copies / microliter. In addition, according to the system, expensive test equipment does not need to be operated in a standard professional laboratory, and field detection of clinical samples can be achieved through the portable visual transverse flow test strip.

Description

Technical Field

[0001] This invention belongs to the field of biochemistry and molecular biology technology, and relates to a rapid detection method and kit for avian Salmonella nucleic acid based on RAA-CRISPR-Cas13a technology. Background Technology

[0002] Salmonella, a Gram-negative enteric pathogen, has significant zoonotic characteristics. In the livestock industry, this pathogen can lead to decreased reproductive performance (15-30% reduction in egg production) and increased mortality (40-80% mortality rate in chicks), causing over US$12 billion in economic losses to the global livestock industry annually, according to FAO statistics. At the public health level, Salmonella is a major foodborne pathogen, with WHO data showing over 115 million cases globally each year, approximately 20% of which are related to contaminated poultry products.

[0003] Avian salmonellosis is a general term for poultry diseases caused by infection with one or more Salmonella species. It not only causes severe losses at all stages from production to sales, but also contaminated poultry and their products have become a major source of Salmonella infection and food poisoning in humans, posing significant public health risks. Avian Salmonella bacteria possess numerous fimbriae adhesins on their surface, which promote bacterial adhesion to target cells. Type I fimbriae are ubiquitous in avian Salmonella and are crucial for initiating and exerting pathogenic effects. Furthermore, type I fimbriae exhibit high intragenus conservation in both molecular and structural aspects. The sequence of the *fimY* gene in avian Salmonella fimbriae differs significantly from that of *fmY* genes in other prokaryotic bacteria and is widely present in all serotypes of avian Salmonella; therefore, it can be used as a target gene for specific detection of avian Salmonella.

[0004] Currently, the main clinical diagnostic method for avian Salmonella is traditional biochemical culture, which is time-consuming, typically requiring four to seven days to obtain results. With technological advancements, nucleic acid-based molecular biology methods, such as PCR and qPCR, are widely used for Salmonella detection due to their high sensitivity, specificity, and speed. However, these methods require specialized equipment and are not suitable for grassroots testing. To overcome these limitations, isothermal amplification techniques, such as LAMP and RAA, have gradually developed. However, these require gel electrophoresis for observation and are prone to false positives. Combining CRISPR / Cas with RAA is a promising approach. CRISPR / Cas can eliminate the non-specific amplification signal of RAA, while RAA can further improve the sensitivity of the CRISPR / Cas system. This method, used for on-site pathogen detection, is of great significance for the prevention and control of avian Salmonella. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide a method and application for rapid and accurate detection of avian Salmonella based on RAA-CRISPR-Cas13a. The detection method established by this invention can be used for on-site detection (also known as field detection), without the need for professional equipment and personnel. It is simple to operate, and the results are rapid and reliable. Diagnosis can be made by observing the fluorescence state and the results of the test strip, providing a powerful molecular tool for the prevention and control of avian Salmonella epidemics.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a crRNA molecule for detecting avian Salmonella virus based on the RAA-CRISPR-Cas13a system, the sequence of which is shown in SEQ ID NO. 3.

[0007] In a second aspect, the present invention provides the application of the above-mentioned crRNA molecule in the preparation of products for detecting avian Salmonella.

[0008] Preferably, the product is a kit for detecting avian Salmonella virus or a test strip for detecting avian Salmonella virus.

[0009] In a third aspect, the present invention provides a kit for detecting avian Salmonella RAA-CRISPR-Cas13a, the kit comprising: a specific RAA primer pair, the above-mentioned crRNA, an RNA fluorescent reporter probe, Cas13a and avian Salmonella positive plasmid standards; The nucleotide sequences of the RAA primer pairs are shown in SEQ ID NO.1-SEQ ID NO.2; The RNA fluorescent reporter probe is FAM-rUrUrUrUrUrU-BHQ1.

[0010] The avian Salmonella positive plasmid standard was prepared by the following method: The fimY gene of Salmonella avianis was amplified to obtain an amplification product. The amplification product was ligated into the PMD-19T vector, positive clones were screened, and plasmid DNA was extracted to prepare positive plasmid standards for Salmonella avianis.

[0011] The method for detecting avian Salmonella using a kit includes the following steps: (1) Extract DNA from the sample to be tested; (2) Using the DNA obtained in step (1) as a template, perform real-time PCR amplification on the test sample using the RAA-CRISPR-Cas13a detection kit described in claim 5, and observe the amplification curve.

[0012] In a fourth aspect, the present invention provides a test strip for the RAA-CRISPR-Cas13a detection of avian Salmonella, wherein the method for detecting avian Salmonella using the test strip includes the following steps: (1) Extract DNA from the sample to be tested; (2) Using the DNA obtained in step (1) as a template, the reaction is carried out based on the RAA-CRISPR-Cas13a system detection reaction system. The reaction product is diluted 2-20 times. The test strip is inserted into the reaction dilution solution. After the reading area is soaked, it is taken out and laid flat. The result is interpreted within 10 minutes.

[0013] In step (2), the result interpretation criteria are as follows: if a red band appears at the T line position of the test strip or both the T line and the C line position appear red bands, it indicates that the sample to be tested is positive; if no red band appears at the T line position of the test strip, but a red band appears on the C line, it indicates that the sample to be tested is negative; if no red band appears at either the T line or the C line position of the test strip, it indicates that the test strip or amplification reagent used has been damaged, expired, or there has been an error in the operation during the detection process.

[0014] In a fifth aspect, the present invention provides the application of the above-described reagent kit or test strip in conducting epidemiological surveys of avian Salmonella.

[0015] The detection sensitivity of the kit is 10. 0 copies / μL, the detection sensitivity of the test strip method is 10. 2 copies / μL.

[0016] The present invention has the following beneficial effects 1. This invention uses the avian Salmonella fimY gene as a detection target, designs RAA primer pairs and crRNA, and establishes an avian Salmonella detection method based on the RAA-CRISPR-Cas13a system. This detection system has high specificity for avian Salmonella, avoids false positives, and can achieve rapid detection of avian Salmonella within 30 minutes at room temperature. The fluorescence detection sensitivity can reach 10. 0 The sensitivity of the test strip method can reach 10 copies / μL. 2 copies / μL.

[0017] 2. The nucleic acid detection method for avian Salmonella based on the RAA-CRISPR-Cas13a enzyme molecular system established in this invention does not require the operation of expensive experimental equipment in a standard professional laboratory. It can realize the on-site detection of clinical samples through portable visual transverse flow test strips. The operation is simple, and the results are rapid and reliable. It provides a new and practical technology for the epidemiological investigation and diagnosis of avian Salmonella, especially for veterinary grassroots and farms, and is conducive to the effective prevention and control of avian Salmonella. Attached Figure Description

[0018] Figure 1 This diagram illustrates the detection based on the RAA-CRISPR-Cas13a system, as well as the RAA primer screening and crRNA sequence design.

[0019] Figure 2 This is a graph showing the specificity results of fluorescence detection based on the RAA-CRISPR-Cas13a system.

[0020] Figure 3 This is a graph showing the sensitivity results of fluorescence detection based on the RAA-CRISPR-Cas13a system; where... Figure 3 In Figure A, fluorescence detection of Salmonella avianis at different concentrations using the RAA-CRISPR-Cas13a system is performed. Figure 3 In the figure, B represents the ratio of fluorescence intensity to time.

[0021] Figure 4 This is a graph showing the repeatability results of fluorescence detection based on the RAA-CRISPR-Cas13a system.

[0022] Figure 5 This is a schematic diagram of the principle of lateral flow detection using a portable test strip based on the RAA-CRISPR-Cas13a graph.

[0023] Figure 6 This is a graph showing the specificity results of the test based on the RAA-CRISPR-Cas13a portable test strip.

[0024] Figure 7 The graph shows the sensitivity results of the RAA-CRISPR-Cas13a portable test strip. Figure 7 Image A shows the sensitivity results of the portable test strip detection. Figure 7 Figure B is a bar chart showing the relative intensity of the portable test strip for Salmonella avianis.

[0025] Figure 8 The image shows the results of testing clinical samples using the RAA-CRISPR-Cas13a system; Figure 8 Figures A and B show the results of testing known samples using three different detection methods. Figure 8 Figures C and D show the results of three detection methods for detecting unknown samples. Detailed Implementation

[0026] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0027] The poultry farming industry faces challenges from various pathogens, among which avian Salmonella is a widespread pathogen that poses a serious threat to poultry health and production efficiency. Poultry play a crucial role in the storage and transmission of avian Salmonella serotypes. Therefore, developing efficient pathogen detection technologies to control the spread of avian Salmonella in poultry is essential for maintaining the healthy development of the poultry farming industry and ensuring food safety.

[0028] The fimY gene is widely present in avian Salmonella, but its sequence differs significantly from that of other prokaryotic bacteria (such as Escherichia coli and Shigella), effectively avoiding cross-reactivity and improving detection specificity. Furthermore, fimY exhibits high conservation in its molecular structure and sequence, reducing the risk of false negatives. This invention screens primers for the conserved region of the fimY protein-coding gene in prevalent avian Salmonella strains. Two RAA-F primers and two RAA-R primers were designed, and primer pairs were combined one-to-one for screening. The optimal primer sequences shown in SEQ ID NO.1-SEQ ID NO.2 of this invention were ultimately obtained.

[0029] In the prior art, researchers have established a visual detection method for avian Salmonella based on the invA gene of avian Salmonella using RPA-CRISPR / Cas12a, which can specifically detect avian Salmonella within 1.5 hours. The present invention can specifically detect avian Salmonella within 30 minutes, which is more advantageous in the detection of a large number of samples in farms and can achieve faster, more efficient and on-site avian Salmonella screening.

[0030] The Cas13a used in this invention specifically recognizes single-stranded RNA (ssRNA) and can cleave reporter RNA molecules guided by crRNA. Since early markers of avian Salmonella infection are ssRNA (such as virulence factor mRNA), Cas13a is more suitable for detecting avian Salmonella. Secondly, Cas13a possesses paracleavage activity, capable of non-specifically cleaving any single-stranded RNA, resulting in excellent signal-to-noise ratio in Cas13a detection.

[0031] To better understand this invention, specific examples are provided below for further explanation. Unless otherwise specified, all reagents and consumables used in this invention are commercially available. The experimental techniques and methods described in the examples are conventional methods and methods recommended in the reagent instructions.

[0032] The Salmonella isolate used in this example is named SDXT15, which comes from the master's thesis "Investigation and Drug Resistance Analysis of Three Bacterial Diseases in Ducks in Tai'an and Laiwu Areas of Shandong Province", Shandong Agricultural University, by Tu Guangyun.

[0033] S. pyogenes, E. coli, S. aureus, and S. flexneri are all epidemic strains isolated from diseased poultry in large-scale poultry farms. Example 1: RAA amplification primer design The *Salmonella fimY* gene sequence was downloaded from NCBI, and its conserved nucleotide region was selected as the attachment site for RAA primers. During primer design, since primers that were too long or too short would affect amplification efficiency, the primer length was controlled within 30-50 bases, the GC content between 40-60%, and the size of the target fragment to be amplified was controlled within 100-200 bp. At the same time, special sequences such as forward / reverse repeats and palindromes were avoided in the primers to prevent the formation of secondary structures or hairpin structures.

[0034] This patent application focuses on the efficient detection of avian Salmonella infection. In nature, poultry are the most important reservoir hosts for Salmonella. Among Salmonella species, the serotypes of Salmonella infecting poultry are mainly group D Salmonella pullorum and Salmonella typhi. The FimY gene of avian Salmonella has developed a unique single nucleotide polymorphism (SNP) site during evolution, exhibiting a 12.7% sequence difference compared to common Salmonella strains, especially showing significant variation in the antigen-binding domain. The fimY gene of avian Salmonella targeted in this invention differs significantly from the fimY gene of common Salmonella strains. Furthermore, the alanine at position 43 of the fimY gene protein encoded by avian Salmonella (valine in mammalian strains) alters the fimbriae adhesion characteristics, increasing the difficulty of primer design. This invention avoids cross-reaction with the GTG sequence of mammalian strains in the amplification primer design. To address the 12.7% sequence difference in the antigen-binding domain of the fimY gene, a "mismatch tolerance algorithm" is used to optimize the annealing temperature of the 3' end of the primers. Meanwhile, by utilizing the specific recognition of ssRNA by Cas13a, the virulence factor mRNA expressed in the early stage of avian Salmonella infection can be directly detected, further improving the detection sensitivity and signal-to-noise ratio of the reporter signal.

[0035] Following the RAA amplification primer design principles outlined above, specific RAA primer sequences were designed. After confirming their specificity using NCBI, extensive optimization and testing were conducted during primer design to ensure sufficient specificity. Two RAA-F primers and two RAA-R primers were designed, and primer pairs were combined one-to-one for screening to obtain the optimal primer sequences for this invention. A T7 RNA polymerase promoter (5'-TAATACGACTCACTATAGGG-3') was added to the 5' end of the forward primer. The RAA amplification primer sequences are shown in SEQ ID NO.1-SEQ ID NO.2. SEQ ID NO.1 (forward primer RAA-F-1): TAATACGACTCACTATAGGGCATTTCTTTGTGGATTGAAAAGGGGTCGCTC; SEQ ID NO.2 (Reverse primer RAA-R-2): CTGATACCAGCAGGGTAAATCTGGATATCGCT.

[0036] Example 2: crRNA Design Cas13a is an RNA-dependent endonuclease. When the target RNA has a protospacer flanking sequence (PFS), the Cas13a-crRNA complex recognizes the PFS, and the crRNA guide sequence pairs with the target RNA, inducing a co-conformal change in Cas13a. This activates the RNase activity of Cas13a, which specifically cleaves the target RNA in cis, and then non-specifically cleaves nearby RNA in trans.

[0037] The PFS sequence of Cas13a is located at the 3' end of the spacer region and consists of A, U, or C bases. Therefore, crRNA can be designed based on the PFS. Specifically, a highly conserved target region of the Salmonella fimY gene with an A, U, or C 3' end is found, and 28 nt is selected forward (GGCGCTACCTGTCTCCTGTATTGAGGCG). Finally, the selected sequence is added to the fixed hairpin structure sequence of Cas13a (GATTTAGACTACCCCAAAAACGAAGGGGACTAAAAC) to obtain the crRNA sequence shown in SEQ ID NO.3.

[0038] Table 1: crRNA nucleic acid sequences Note: According to the WIPO ST.26 standard, the uracil "U" in the crRNA nucleotide sequence is represented by "T" in the sequence listing.

[0039] Example 3: Construction of Salmonella positive plasmid standards The PCR primer pairs shown in SEQ ID NO.4-SEQ ID NO.5 were designed to amplify the fimY gene of Salmonella avianis. The PCR amplification products were purified using a gel extraction kit (Sangon Biotec, cat. no. B518131), ligated into the pMD-19T vector, and transformed into competent DH5α cells. Positive clones were screened by sequencing, and plasmids were extracted using a kit (Sangon Biotec, cat. no. B518191) to obtain positive plasmid standards for Salmonella avianis.

[0040] SEQ ID NO.4 (Avian Salmonella-F): GCCGTTATCACTCTCCAAC; SEQ ID NO.5 (Avian Salmonella-R): GATAAGGTACGCTTTGCTGAC.

[0041] Example 4: RAA Amplification Using the RAA nucleic acid amplification kit (Qitian, cat.no.B00000) from Jiangsu Qitian Gene Biotechnology Co., Ltd., amplification was performed using the standard positive plasmid pMD-19T-Avian Salmonella fimY as a template and the RAA primers with the T7 promoter shown in SEQ ID NO.1-SEQ ID NO.2. All reaction reagents except template DNA and magnesium acetate were premixed and transferred to reaction tubes containing lyophilized powder. The lyophilized powder was gently tapped to fully reconstitute, and the liquid was collected to the bottom of the tube after brief centrifugation. The reaction unit was opened, and 5 µL of magnesium acetate was added to the tube cap. Then, 1 µL of template DNA was added to each reaction unit, and the mixture was gently tapped and collected by centrifugation. The reaction was carried out at 37°C for 40 min. The specific reaction system is as follows: Table 2: RAA amplification system After the reaction was complete, 50 µL of phenol / chloroform (1:1) was added to the tube, vortexed to mix, and centrifuged until the layers separated. A 2% agarose gel was prepared, and 10 µL of the supernatant was aspirated for electrophoresis detection. The amplified products were then recovered from the gel (Sangon Biotec, cat.no. B518131).

[0042] Example 5: Nucleic acid detection system based on RRA-CRISPR-Cas13a Using the RAA amplification product obtained in Example 4 as a template, it was added to the CRISPR / Cas13a restriction enzyme digestion system to prepare the RAA-CRISPR-Cas13a detection system described in Table 3. After the system was prepared on ice, it was mixed, centrifuged, and then placed on a real-time PCR instrument. The FAM lane was selected, and the reaction was carried out at 37°C for 30 minutes. The fluorescence signal was collected every 30 seconds. After the reaction, the data was saved for analysis. Then, the reaction tube was placed in a blue light gel imaging instrument to observe the fluorescence state and take pictures for recording.

[0043] Table 3: RAA-CRISPR-Cas13a detection system Example 6: Methodological detection of fluorescence in the RAA-CRISPR-Cas13a system (1) Specificity test of the fluorescence detection method of the RAA-CRISPR-Cas13a system: Streptococcus pyogenes, Escherichia coli, Staphylococcus aureus, and Shigella flexneri were selected, and bacterial DNA was extracted. After isothermal amplification using RAA, the complete system shown in Table 4 was prepared on ice using ssRNA fluorescent reporter molecules and placed in a BIOER fluorescence PCR instrument. The system was incubated at 37°C for 30 minutes, and the fluorescence signal was recorded every 30 seconds. After the reaction, the numerical results were saved and the fluorescence status was observed.

[0044] Table 4: RAA-CRISPR-Cas13a detection system based on fluorescence detection The results are as follows Figure 2 As shown, the fluorescence value of the avian Salmonella sample increased rapidly after the reaction started, while no fluorescence was observed in S. pyogenes, E. coli, S. aureus, and S. flexneri. These results demonstrate that the RAA-CRISPR-Cas13a fluorescence detection method established in this invention has good specificity.

[0045] (2) Sensitivity test of the fluorescence detection method of the RAA-CRISPR-Cas13a system: The concentration of the standard positive plasmid pMD-19T-avian Salmonella fimY was determined, and its copy number was calculated according to the formula. After serial dilution tenfold (10... 7 copies / μL-10 0 RAA amplification was performed using copies / μL. The amplification product was used as a template. The complete system shown in Table 4 was prepared using ssRNA fluorescent reporter molecules on ice and placed in a BIOER real-time PCR instrument. The system was incubated at 37°C for 30 minutes, and the fluorescence signal was recorded every 30 seconds.

[0046] The results are as follows Figure 3 As shown, the limit of detection for the RAA-CRISPR-Cas13a fluorescence detection method established in this invention is 10. 0 The fluorescence intensity gradually decreased with increasing dilution, and the initial rate of fluorescence enhancement at 30 minutes of reaction was linearly related to the concentration of the Salmonella avianis template, which is consistent with the kinetics of the enzyme reaction.

[0047] (3) Repeatability test of the fluorescence detection method of the RAA-CRISPR-Cas13a system Use 10 7 copies / μL-10 0Using purified RAA product at a dilution of copies / μL as a template, three intra-batch replicate experiments were performed, and inter-batch replicate experiments were performed at different times. A negative control was set up (sterile deionized water was used as the template during RAA amplification). After the system was prepared, it was placed in a BIOER fluorescence PCR instrument and incubated at 37°C for 30 minutes, with the fluorescence signal recorded every 30 seconds.

[0048] The results are as follows Figure 4 As shown, the RAA-CRISPR-Cas13a fluorescence detection method established in this invention exhibits good repeatability.

[0049] Example 7: Construction of a portable test strip based on the RAA-CRISPR-Cas13a system (1) Construction principle of portable test strip for avian Salmonella based on RAA-CRISPR-Cas13a system like Figure 5 As shown, on the transverse flow test strip, a biotin-ligand line binds to biotin, capturing all intact RNA probes. If the sample is negative, the FITC-RNA-Biotin reporter gene is first fully conjugated with the anti-FITC antibody, and the conjugation product is then intercepted by the biotin ligand at the control line (C line). If the sample is positive, Cas13a is activated and exerts its accessory cleavage activity, subsequently cleaving the FITC-RNA-Biotin reporter gene. The gold nanoparticle (NP)-labeled anti-FITC antibody flows to the top band indicating the presence of the target. The anti-FITC antibody-FITC conjugate accumulates more at the detection line (T line) and less at the C line.

[0050] (2) Construction method of portable test strip for avian Salmonella based on RAA-CRISPR-Cas13a system The test strip consists of a sample pad, a conjugate pad, a detection line, a control line, and an absorbent pad. Based on the test strip's capillary effect, the liquid dropped onto the strip passes sequentially through the conjugate pad, detection line, and control line. First, chloroauric acid solution is added to gold nitrate solution and stirred until homogeneous. Then, sodium hydroxide solution is added and stirred until the solution turns red, completing the preparation of the colloidal gold solution, which is then purified. An antibody that specifically binds to the target is selected, and its solution is mixed with the colloidal gold solution to immobilize the antibody on the colloidal gold surface. An NC membrane is attached to a substrate and scribed, then sprayed with gold and dried. The absorbent paper and gold-labeled pad are then assembled, finally completing the construction of the portable Salmonella avianis test strip.

[0051] (3) Detection of Salmonella in Avian birds using portable test strips based on the RAA-CRISPR-Cas13a system DNA was extracted from the sample to be tested and used as a template for RAA amplification to obtain RAA amplification products. Further, using the RAA amplification products as templates, the RAA-CRISPR-Cas13a system test strip detection reaction system shown in Table 5 was prepared. The reaction system was placed in a metal bath and incubated at 37°C for 30 minutes to obtain reaction products. The reaction products were diluted 20 times. The binding pad end of the test strip was inserted into the reaction dilution solution. After the reading area was soaked, it was taken out and laid flat, and the results were interpreted within 10 minutes.

[0052] Table 5: RAA-CRISPR-Cas13a detection system based on test strip detection If a red band appears at the T-line position of the sample to be tested, or if red bands appear at both the T-line and C-line positions, then the sample to be tested is positive. If no red band appears at the T line position of the sample to be tested, but a red band appears at the C line, it indicates that the sample to be tested is negative; If no red bands appear at either the T-line or C-line of the sample being tested, it indicates that the test strip or amplification reagent may be damaged, expired, or there may have been an error in the testing process.

[0053] Example 8: Methodological Detection of Portable Test Strips Using the RAA-CRISPR-Cas13a System (1) Specificity test of the RAA-CRISPR-Cas13a system portable test strip detection method Using DNA from avian Salmonella, S. pyogenes, E. coli, S. aureus, and S. flexneri as templates, the tests were performed according to the test strip detection method shown in Example 7, and the results were interpreted promptly after the reaction was completed.

[0054] The results are as follows Figure 6 As shown, only the test strip for detecting avian Salmonella showed a positive result with a colored T line, while the test strips for other virus samples were all negative. These results demonstrate that the method for detecting avian Salmonella established in this invention has high specificity and does not cross-react with other viruses.

[0055] (2) Sensitivity test of portable test strip detection method of RPA-CRISPR-Cas13a system pMD-19T-avian Salmonella fimY standard quality plasmids were serially diluted 10-fold. 7 copies / μL-10 0 Using copies / μL as a template, the test strips were tested according to the method shown in Example 7, and the results were interpreted promptly after the reaction was completed.

[0056] The results are as follows Figure 7 As shown, the detection limit of the method for detecting avian Salmonella established in this invention is 10. 2 copies / μL.

[0057] Example 9: Clinical application detection of avian Salmonella based on the RAA-CRISPR-Cas13a system Thirty known samples (20 positive and 10 negative) were tested using PCR, qPCR, and RAA-CRISPR, respectively. The results of the three methods were consistent. Figure 8 A, B). Subsequently, 30 samples suspected of avian Salmonella infection were tested. Of these, 16 samples tested positive using all three methods, and 12 samples tested negative using all three methods. Two other samples tested positive by both qPCR and RAA-CRISPR, but negative by PCR. Figure 8 (C, D) indicates that the results of RAA-CRISPR and qPCR are highly consistent, and the sensitivity is higher than that of PCR, showing good application prospects and clinical value.

[0058] The above description is merely a preferred embodiment of this application and is not intended to limit the application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications made within the spirit and principles of this application are not permitted. Equivalent substitutions and improvements should all be included within the scope of protection of this application.

Claims

1. A crRNA molecule for detecting avian Salmonella virus based on the RAA-CRISPR-Cas13a system, characterized in that, The sequence of the crRNA molecule is shown in SEQ ID NO.

3.

2. The use of the crRNA molecule according to claim 1 in the preparation of products for detecting avian Salmonella.

3. The application according to claim 2, characterized in that, The product is a kit or test strip for detecting avian salmonella virus.

4. A kit for detecting avian Salmonella RAA-CRISPR-Cas13a, characterized in that, The kit includes: a specific RAA primer pair, the crRNA as described in claim 1, an RNA fluorescent reporter probe, Cas13a and Salmonella avian positive plasmid standards; The nucleotide sequences of the RAA primer pairs are shown in SEQ ID NO.1-SEQ ID NO.2; The RNA fluorescent reporter probe is FAM-rUrUrUrUrUrU-BHQ1.

5. The reagent kit according to claim 4, characterized in that, The avian Salmonella positive plasmid standard was prepared by the following method: The fimY gene of Salmonella avianis was amplified to obtain an amplification product. The amplification product was ligated into the PMD-19T vector, positive clones were screened, and plasmid DNA was extracted to prepare positive plasmid standards for Salmonella avianis.

6. The reagent kit according to claim 4, characterized in that, The method for detecting avian Salmonella using a kit includes the following steps: (1) Extract DNA from the sample to be tested; (2) Using the DNA obtained in step (1) as a template, perform real-time PCR amplification on the test sample using the RAA-CRISPR-Cas13a detection kit described in claim 5, and observe the amplification curve.

7. A test strip for the detection of avian Salmonella using RAA-CRISPR-Cas13a, characterized in that, The method for detecting avian Salmonella using test strips includes the following steps: (1) Extract DNA from the sample to be tested; (2) Using the DNA obtained in step (1) as a template, the reaction is carried out based on the RAA-CRISPR-Cas13a system detection reaction system. The reaction product is diluted 2-20 times. The test strip is inserted into the reaction dilution solution. After the reading area is soaked, it is taken out and laid flat. The result is interpreted within 10 minutes.

8. The test strip according to claim 7, characterized in that, In step (2), the result interpretation criteria are as follows: if a red band appears at the T line position of the test strip or both the T line and the C line position appear red bands, it indicates that the sample to be tested is positive; if no red band appears at the T line position of the test strip, but a red band appears on the C line, it indicates that the sample to be tested is negative; if no red band appears at either the T line or the C line position of the test strip, it indicates that the test strip or amplification reagent used has been damaged, expired, or there has been an error in the operation during the detection process.

9. The application of the kit according to claim 4 or the test strip according to claim 7 in conducting epidemiological surveys of avian Salmonella.

10. The application according to claim 9, characterized in that, The detection sensitivity of the kit is 10. 0 copies / μL, the detection sensitivity of the test strip method is 10. 2 copies / μL.

Images