Litchi dwarf trait-associated gene snp molecular marker, primer and application thereof

By developing the LcGAMYB23 gene and SNP molecular markers associated with dwarfing traits in litchi, and designing specific primer pairs, the problem of identifying dwarfing traits in litchi was solved, enabling rapid identification and accelerating the breeding process, thus promoting the efficient utilization of litchi dwarfing resources.

CN121023089BActive Publication Date: 2026-02-24SANYA RESEARCH INSTITUTE OF HAINAN ACADEMY OF AGRICULTURAL SCIENCES (HAINAN EXPERIMENTAL ANIMAL RESEARCH CENTER) +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511566103.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-30
Publication Date
2026-02-24
Estimated Expiration
2045-10-30

AI Technical Summary

Technical Problem

The lack of efficient molecular marker tools in existing technologies for the identification and breeding of dwarfing traits in litchi has resulted in a slow progress in the breeding of dwarf litchi varieties.

Method used

The LcGAMYB23 gene and its SNP molecular markers associated with dwarfing traits in litchi were developed, and specific primer pairs were designed to rapidly identify dwarfing traits in litchi through PCR amplification and electrophoresis.

Benefits of technology

This method enables rapid and accurate identification of dwarfing traits in litchi, significantly accelerating the breeding rate and promoting the efficient utilization and genetic improvement of litchi dwarfing resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121023089B_ABST
    Figure CN121023089B_ABST
Patent Text Reader

Abstract

The application relates to the technical field of molecular markers, and discloses a litchi dwarfing trait related gene SNP molecular marker, a primer thereof and application. LcGAMYB23 The litchi dwarfing trait related gene is , the SNP molecular marker is derived from a polymorphic site of the gene, has the advantages of high polymorphism, good genetic stability and simplicity and efficiency, and the site recognition sequence is CAAAATTTTC[T / G]GTCTGCTGGA. The application further discloses a primer pair for detecting the SNP molecular marker, the sequence of an upstream primer is shown as SEQ ID NO. 1, and the sequence of a downstream primer is shown as SEQ ID NO. 2. The SNP molecular marker and the primer pair can be used for quickly identifying the dwarfing trait of litchi germplasm resources, can significantly accelerate the breeding rate of litchi dwarfing varieties, and promote the creation, utilization and genetic improvement of dwarfing resources.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to a SNP molecular marker associated with dwarfing traits in litchi, its primers, and applications. Background Technology

[0002] litchi( Litchi chinensis Sonn . Lychee is an important economic fruit tree in subtropical and tropical regions of my country, possessing extremely high economic value and market prospects. Dwarfing traits offer significant advantages to the lychee industry: firstly, dwarf trees facilitate field management, improving efficiency and reducing production costs; secondly, dwarf trees typically flower earlier, shortening the production cycle and reducing initial capital investment; and thirdly, dwarf planting allows for fuller utilization of sunlight, contributing to improved fruit quality. Therefore, dwarfing traits have become a crucial economic trait for lychee, and the exploration and utilization of dwarfing resources are of great significance to the healthy development of the lychee industry.

[0003] Recent studies have revealed significant differences in the expression levels of gibberellins and their metabolism and signal transduction-related genes between standard and dwarf litchi varieties, suggesting that these genes play an important role in regulating litchi plant height. The present inventors constructed a hybrid population of dwarf and highly standard litchi varieties, plotted a high-density genetic map, and performed QTL analysis on dwarf-related traits to screen for candidate genes. LcGAMYB As a key transcription factor in the gibberellin signal transduction pathway, it is speculated that it is highly likely to be involved in the regulation of the dwarf phenotype in litchi.

[0004] However, due to factors such as the long juvenile stage, high heterozygosity, and narrow genetic background of litchi, traditional breeding methods are inefficient. Molecular marker breeding, because it can be closely linked to genes related to important agronomic traits, has become a highly efficient auxiliary breeding method. Among them, SNP molecular markers have advantages such as high polymorphism and good genetic stability compared to earlier molecular markers, and are widely used. However, there is still little research on molecular markers for dwarfing traits in litchi, and there is a lack of molecular marker tools that can be efficiently used for the identification and breeding of dwarfing traits, which restricts the progress of breeding dwarf litchi varieties. Based on this, this invention develops genes, SNP molecular markers, and primers associated with dwarfing traits in litchi to solve the above problems. Summary of the Invention

[0005] The first objective of this invention is to provide information related to the dwarfing trait in litchi. LcGAMYB23 The first objective is to provide primer pairs for identifying dwarfing traits in litchi germplasm resources; the second objective is to provide identification methods and applications based on the aforementioned genes, SNP molecular markers, or primers.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] In the first aspect, this invention is based on published litchi genome databases and screened dwarfing candidate genes. LcGAMYB Sequence, find its family members LcGAMYB23 The full sequence of the gene was obtained, and through cloning and sequencing verification of this gene in representative litchi varieties with different dwarfing traits, it was determined that it is a gene associated with the dwarfing trait in litchi, and the gene number is [gene number missing]. LcGAMYB23 The gene coding sequence is shown in SEQ ID NO.3.

[0008] Secondly, the inventors of this invention used representative litchi varieties with different dwarfing traits as materials to conduct... LcGAMYB23 The gene was resequencing, and the SNP polymorphism sites of the gene were obtained. A SNP molecular marker closely associated with the dwarfing trait of litchi was identified. The SNP site is located at the physical position of 6807646 bp on chromosome 13 of the litchi reference genome. Its nucleotide polymorphism is T / G, and its site recognition sequence is CAAAATTTTC [T / G]GTCTGCTGGA.

[0009] Thirdly, based on the sequence characteristics of the aforementioned SNP polymorphic sites, the inventors have designed specific primer pairs that can specifically amplify gene fragments containing the SNP sites. The primer sequences are as follows:

[0010] Upstream primer (SEQ ID NO.1): 5'-GGGATGAATCTTTCTTTGAG-3';

[0011] Downstream primer (SEQ ID NO.2): 5'-TGGTCTCCAGCAGACA-3'.

[0012] Fourthly, this invention provides a method for identifying dwarfing traits in litchi using the aforementioned primer pairs via PCR amplification and product detection. The specific steps are as follows:

[0013] Step 1: Extract genomic DNA from the litchi germplasm resources to be identified;

[0014] Step 2, PCR amplification: Using the extracted genomic DNA as a template, PCR amplification was performed using the primer pairs described above. The reaction system (50 μL) consisted of: 1 μL genomic DNA, 1 μL each of forward and reverse primers, 5 μL 2*Hieff Robust PCR Master Mix, and ddH2O to a final volume of 50 μL. The amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 10 sec, 55℃ annealing for 20 sec, 72℃ extension for 15-30 sec, for a total of 35 cycles; 72℃ extension for 5 min, and storage at 4℃.

[0015] Step 3, Product Detection: The PCR amplification products were electrophoresed on a 1% agarose gel containing 0.01% Super Red nucleic acid dye. Electrophoresis was performed in 1×TAE buffer at 120V for 20 minutes. The results were observed using a gel imaging system: if an amplification fragment of 614bp appeared, the litchi tested was of the standard trait; if no band appeared, the litchi tested was of the dwarf trait.

[0016] The beneficial effects of this invention are:

[0017] (1) This invention is the first to clearly define the association between dwarfing traits and litchi. LcGAMYB23 The gene was identified, and SNP molecular markers based on the polymorphic sites of this gene were developed. These markers are closely associated with the dwarfing trait of litchi and have the characteristics of high polymorphism and good genetic stability, providing key targets for the genetic analysis of the dwarfing trait of litchi.

[0018] (2) The primer pairs designed in this invention can specifically detect target SNP molecular markers. The dwarfing trait of litchi germplasm resources can be quickly identified through simple PCR amplification and electrophoresis detection. The operation is simple and the detection efficiency is high. There is no need to wait for litchi plants to grow to maturity, which greatly shortens the trait identification cycle.

[0019] (3) The genes, SNP molecular markers and primers of the present invention can be widely used in the identification of dwarfing traits in litchi, breeding of dwarfing varieties and creation of dwarfing resources. They can significantly accelerate the breeding rate of dwarfing litchi varieties, promote the efficient utilization of dwarfing litchi resources, and promote the genetic improvement of dwarfing traits in litchi. They have important practical significance for the high-quality development of the litchi industry. Attached Figure Description

[0020] Figure 1 Representative litchi varieties with different degrees of dwarfing LcGAMYB23 Gene polymorphic sequence alignment.

[0021] Figure 2 Electrophoresis diagrams of amplified products from litchi varieties with different dwarfing traits: lane M is the marker, varieties that can amplify a 614bp fragment are standard varieties, and varieties that cannot amplify this fragment are dwarf varieties. Detailed Implementation

[0022] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0023] Description of the Sequence List: The underlined bases indicate polymorphic SNP sites

[0024] SEQ ID NO.1:

[0025] 5'-GGGATGAATCTTTCTTTGAG-3'

[0026] SEQ ID NO.2:

[0027] 5'-TGGTCTCCAGCAGACA-3'

[0028] SEQ ID NO.3:

[0029] ATGTCTAAGAGGAGGGGGGATGAAGAAGGTAGGAATGGATTGAAAAAGGGTCCATGGACATCAACGGAGGATGCCATTTTGGTCGAACATGTCAAGAGGTTTGGAGAGGGAAACTGGAACGCTGTTCAAAAGCACTCTGGCCTTTCTCGCTGTGGAAAAAGCTGCCGTTTGAGGTGGACTAATCACCTCCGACCTGACTTGAAGAAGGGTGCTTTCACTCCCGAAGAGGAGCACCGCATCATCCAACTCCATGCCCAGATGGGTAACAAGTGGGCTCGTATGGTTCCTGAGTTGCCTGGGCGTACAGATAATGAGATAAAGAACTATTGGAATACTAGAGTTAAGAGACTGCAACGTGCTGGCTTACCAATTTACCCTCCCGATGTGTGCCTGCAAGTACTGAATAGAAGTCCAGAAAGTCTGAACATGGGTGCATTACCAAATGGGGGCACAAACAATCCTGGTCTCCAGCAGAC A

[0030] SEQ ID NO.4:

[0031] 5'-ATGTCTAAGAGGAGGGGGGATGA-3'

[0032] SEQ ID NO.5:

[0033] 5'-CTAGTAGTCACTGCACGAGTCCT-3'

[0034] Example 1: Lychee LcGAMYB23 Obtaining genes, SNP molecular markers and primers

[0035] 1. Gene screening and cloning: Based on the litchi genome database and dwarfing candidate genes LcGAMYB Sequence, filter to obtain family members LcGAMYB23 Given the full sequence, design cloning primers:

[0036] Upstream primer (SEQ ID NO.4): 5'-ATGTCTAAGAGGAGGGGGGATGA-3';

[0037] Downstream primer (SEQ ID NO.5): 5'-CTAGTAGTCACTGCACGAGTCCT-3'.

[0038] Using genomic DNA from different litchi varieties as templates, PCR cloning was performed, and the coding sequence of the LcGAMYB23 gene (SEQ ID NO.3) was obtained by sequencing.

[0039] 2. SNP Locus Mining: Genome resequencing was performed on 32 litchi germplasm resources (including 'B13', 'D13', '9919', '127', 'Liaoyuan No. 1', 'Zaonuo', 'B7B7', 'B14', '098', '99149', '9918', 'Feizixiao', 'Sanyuehong', 'Xiantaoli', 'Nanxizaosheng', 'Jingganghongnuo', 'Shuangxili', 'Wangzili', 'Lingfengnuo', 'Ziniangxi', 'Seedless Litchi', 'Longtanli', 'Xinqiumili', 'Yuezhouhong', 'Haikeqingpi', 'Yamulong', 'Baitangying', 'Guiwei', 'Lüjuren', 'Jumeiren', 'Xiangheli', and 'Yuanbaoli') for analysis. LcGAMYB23 Gene sequence polymorphism was used to identify SNP sites associated with the dwarfing trait, and the recognition sequence was CAAAATTTTC [T / G] GTCTGCTGGA.

[0040] 3. Primer design: Specific primer pairs were designed around the above SNP sites using primer design software. Effective primer pairs were obtained after screening and verification (upstream primer: 5'-GGGATGAATCTTTCTTTGAG-3', downstream primer: 5'-TGGTCTCCAGCAGACA-3').

[0041] Example 2: Identification and Verification of Dwarfing Traits in Litchi

[0042] 1. Selection of experimental materials

[0043] Different dwarf litchi germplasm resources from Haikou City, Hainan Province, including 'B13', 'D13', '9919', '127', 'Liaoyuan No. 1', 'Zaonuo', 'B7B7', 'B14', '098', '99149', '9918', 'Feizixiao', 'Sanyuehong', 'Xiantaoli', 'Nanxizaosheng', 'Jingganghongnuo', 'Shuangxili', 'Wangzili', 'Lingfengnuo', 'Ziniangxi', 'Seedless Litchi', 'Longtanli', 'Xinqiumili', 'Yuezhouhong', 'Haikeqingpi', 'Yamulong', 'Baitangying', 'Guiwei', 'Lüjuren', 'Jumeiren', 'Xiangheli', and 'Yuanbaoli', were used for the verification of SNP primer molecular markers.

[0044] 2. Detection of SNP primer molecular markers

[0045] 2.1 DNA was extracted from the above experimental materials using the optimized CTAB method;

[0046] 2.2 Using the DNA extracted in step 2.1 as an amplification template, and the developed pair of SNP molecular marker primers as amplification primers, PCR amplification was performed;

[0047] 2.3 PCR reaction system (10 μL): 1 μL of DNA from litchi varieties with different degree of tree formation, 1 μL each of upstream and downstream polymorphic primers, 5 μL of 2*Hieff Robust PCR Master Mix, and ddH2O to a total volume of 50 μL;

[0048] 2.4 Reaction amplification program: 4℃ pre-denaturation for 5 min; 94℃ denaturation for 10 sec, 55℃ annealing for 20 sec, 72℃ extension for 15-30 sec, 35 cycles; 72℃ extension for 5 min, store at 4℃;

[0049] 2.5 PCR amplification product detection: The PCR amplification products were electrophoresed on a 1% agarose gel containing 0.01% Super Red nucleic acid dye. Electrophoresis was performed at 120 V for 20 min in 1×TAE buffer. The gel running results were photographed and recorded in a gel imaging system. The genotype was determined based on the electrophoresis results of the amplification products, and the degree of dwarfing of the litchi resources to be analyzed was determined.

[0050] 3. Test Results:

[0051] like Figure 1 As shown, LcGAMYB23 Gene sequence alignment results show that, compared with the dwarf varieties 'Ziniangxi' and 'Yamulong', the extremely tall varieties 'Feizixiao', 'Sanyuehong', and '9918' have significantly different genetic characteristics. LcGAMYB23 There are significant base differences in the gene sequence.

[0052] like Figure 2 As shown, the SNP molecular marker primers for the following litchi varieties—'B13', 'D13', '9919', '127', 'Liaoyuan No. 1', 'Zaonuo', 'B7B7', 'B14', '098', '99149', '9918', 'Feizixiao', 'Sanyuehong', 'Xiantaoli', and 'Nanxizaosheng'—were able to successfully amplify 614 bp sequence fragments. However, the primers for the following litchi varieties—'Jingganghongnuo', 'Shuangxili', 'Wangzili', 'Lingfengnuo', 'Ziniangxi', 'Henheli', 'Longtanli', 'Xinqiumili', 'Yuezhouhong', 'Haikeqingpi', 'Yamulong', 'Baitangying', 'Guiwei', 'Lüjuren', 'Jumeiren', 'Xiangheli', and 'Yuanbaoli'—failed to amplify the sequence fragments. The test results were completely consistent with the known dwarfing / standard traits of each variety, proving that the SNP molecular markers and primer pairs of the present invention can accurately identify the dwarfing trait of litchi.

[0053] Specific embodiments have been used to illustrate the principles and implementation methods of this invention. The descriptions of the embodiments above are only for the purpose of helping to understand the method and core ideas of this invention. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the ideas of this invention. Therefore, the content of this specification should not be construed as a limitation of this invention.

Claims

1. A specific primer pair for identifying dwarfing traits in litchi varieties, characterized in that, It consists of an upstream primer with the nucleotide sequence shown in SEQ ID NO. 1 and a downstream primer with the nucleotide sequence shown in SEQ ID NO.

2. The site recognition sequence of the identification sites of the upstream and downstream primers is CAAAATTTTC[T / G]GTCTGCTGGA. The litchi varieties include: B13, D13, 9919, 127, Liaoyuan No. 1, Zaonuo, B7B7, B14, 098, 99149, 9918, Feizixiao, Sanyuehong, Xiantaoli, Nanxi Zaosheng, Jinggang Hongnuo, Shuangxili, Wangzili, Lingfengnuo, Ziniangxi, Wuheli, Longtanli, Xinqiumili, Yuezhouhong, Haike Qingpi, Yamulong, Baitangying, Guiwei, Lüjuren, Jumeiren, Xiangheli, and Yuanbaoli.

2. The application of the specific primer pair according to claim 1 in identifying dwarfing traits in litchi varieties, characterized in that, The lychee varieties mentioned include: B13, D13, 9919, 127, Liaoyuan No. 1, Zaonuo, B7B7, B14, 098, 99149, 9918, Feizixiao, Sanyuehong, Xiantaoli, Nanxi Zaosheng, Jinggang Hongnuo, Shuangxili, Wangzili, Lingfengnuo, Ziniangxi, Wuheli, Longtanli, Xinqiumili, Yuezhouhong, Haike Qingpi, Yamulong, Baitangying, Guiwei, Lüjuren, Jumeiren, Xiangheli, and Yuanbaoli. PCR amplification was performed using the specific primer pair. If a 614bp electrophoresis band was observed, the litchi to be identified was of the standard trait; if no band appeared, the litchi to be identified was of the dwarf trait.

3. A method for identifying dwarfing traits in litchi varieties, characterized in that, Includes the following steps: Step 1: Extract genomic DNA from the litchi germplasm resources to be identified; Step 2: Using the genomic DNA extracted in Step 1 as a template, perform PCR amplification using the specific primer pair described in claim 1; Step 3: Detect PCR amplification products: If there is a 614bp electrophoresis band, the litchi germplasm resource to be identified has the standard trait. If no bands appear, the litchi germplasm resource to be identified is a dwarf trait; The lychee varieties mentioned include: B13, D13, 9919, 127, Liaoyuan No. 1, Zaonuo, B7B7, B14, 098, 99149, 9918, Feizixiao, Sanyuehong, Xiantaoli, Nanxi Zaosheng, Jinggang Hongnuo, Shuangxili, Wangzili, Lingfengnuo, Ziniangxi, Wuheli, Longtanli, Xinqiumili, Yuezhouhong, Haike Qingpi, Yamulong, Baitangying, Guiwei, Lüjuren, Jumeiren, Xiangheli, and Yuanbaoli.

4. The method according to claim 3, characterized in that, The PCR amplification reaction system is as follows: 1 μL genomic DNA, 1 μL each of upstream and downstream primers, 5 μL 2×Robust PCR Master Mix, and ddH2O to a final volume of 50 μL.

Citation Information

Patent Citations

  • Molecular marker for identifying early blossoming / late blossoming of lichee in early stage and applications thereof

    CN105925669A

  • Development and application of CAPS marker of SNP site related to ripening stage of litchi fruit

    CN118773371A