Genetically engineered algae capable of resisting aquatic pathogenic bacteria as well as construction method and application of genetically engineered algae

Abstract

The invention discloses a genetically engineered algae capable of resisting aquatic pathogenic bacteria as well as a construction method and application thereof, and is characterized in that the genetically engineered algae is phaeodactylum tricornutum into which cell wall energizing plasmids pPha-T1-EG01991-eGFP-Linker-Q4 or pPha-T1-EG01991-eGFP-Linker-Q6 are introduced, and the preparation method of the genetically engineered algae comprises the following steps: by taking genome DNA (Deoxyribonucleic Acid) of the phaeodactylum tricornutum as a template, carrying out enzyme deactivation on the phaeodactylum tricornutum, and carrying out enzyme deactivation on the phaeodactylum tricornutum; the method comprises the following steps: constructing a directional expression plasmid pPha-T1-EG01991-eGFP by amplifying a Phatr3EG01991 coding sequence, inserting Q4 and Q6 coding sequences into the downstream of the eGFP of a directional expression vector, constructing a cell wall energizing plasmid, electrically transforming the cell wall energizing plasmid into phaeodactylum tricornutum, coating an f / 2 plate culture medium with transformed phaeodactylum tricornutum cells for culturing, screening positive algae strains, and screening the positive algae strains. The feed additive has the advantage of inhibiting or killing aquatic pathogenic bacteria.

Description

Technical Field

[0001] This invention belongs to the field of plant breeding technology, specifically relating to a genetically engineered alga resistant to aquatic pathogens, its construction method, and its application. Background Technology

[0002] With the rapid development and increasing intensification of aquaculture, microorganisms in aquaculture waters have proliferated, leading to frequent outbreaks of various aquatic diseases. Among these, bacterial diseases, such as those caused by Vibrio parahaemolyticus (V. parahaemolyticus), are particularly prevalent. Vibrio parahaemolyticus ), Vibrio alginolyticus ( Vibrio alginolyticus Aeromonas hydrophila ( ) Aeromonas hydrophila Diseases caused by pests such as septic tanks are particularly common and serious. These diseases not only reduce the quality and yield of aquatic products, causing substantial economic losses each year, but also pose a potential threat to human health.

[0003] For a long time, the aquaculture industry has primarily relied on the application of antibiotics to prevent and control bacterial diseases. However, the long-term overuse of antibiotics has led to a rapid increase in bacterial resistance, the widespread dissemination of drug-resistant genes, and drug residues in aquatic products. Therefore, exploring and developing new disease prevention and control methods has become crucial for promoting the sustainable development and transformation of the aquaculture industry.

[0004] Antimicrobial peptides are a class of small molecule peptides, either naturally derived or synthetically produced, possessing broad-spectrum antimicrobial activity and effectively killing bacteria, fungi, and viruses. Due to their rapid bactericidal action and low risk of inducing drug resistance, antimicrobial peptides have shown great application potential in protecting aquatic animals from pathogens, improving aquaculture efficiency, and ensuring the safety of aquatic products. Therefore, antimicrobial peptides are widely considered a promising antibiotic alternative in the aquaculture industry. However, the effectiveness of antimicrobial peptides in killing aquatic pathogens depends on their concentration in the water. Because of the high production cost of antimicrobial peptides, directly adding large amounts to water is difficult to promote in practical aquaculture. Therefore, developing a low-cost, efficient application method to fully utilize the antimicrobial properties of antimicrobial peptides against aquatic pathogens is of great significance for promoting the healthy development of the aquaculture industry.

[0005] In aquaculture systems, microalgae can achieve very high cell densities and share the same ecological niche with various pathogens, resulting in close and frequent interactions between them. If microalgae were endowed with the ability to inhibit bacteria, it would be possible to achieve highly efficient control of aquatic pathogens through microalgae. Currently, there are very few research reports on microalgae with pathogen-inhibiting or bactericidal abilities and their construction methods. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a positioning tag that can efficiently anchor functional peptides to the cell wall, as well as a genetically engineered algae that has the ability to inhibit or kill aquatic pathogens, its construction method and application.

[0007] The technical solution adopted by the present invention to solve the above-mentioned technical problems is as follows: a genetically engineered algae resistant to aquatic pathogens, wherein the genetically engineered algae is *Phaeodactylum tricornutum* with cell wall-empowering plasmids pPha-T1-EG01991-eGFP-Linker-Q4 or pPha-T1-EG01991-eGFP-Linker-Q6 introduced into it, and the antimicrobial peptide Q4 or antimicrobial peptide Q6 is directionally expressed in the cell wall of *Phaeodactylum tricornutum*. The nucleotide sequence of the cell wall-empowering plasmid pPha-T1-EG01991-eGFP-Linker-Q4 is shown in SEQ ID NO:1, and the nucleotide sequence of the cell wall-empowering plasmid pPha-T1-EG01991-eGFP-Linker-Q6 is shown in SEQ ID NO:2.

[0008] The present invention also provides a method for constructing the above-mentioned genetically engineered algae resistant to aquatic pathogens, comprising the following steps: Step 1: Using the genomic DNA of *Phaeodactylum tricornutum* as a template, amplify the coding sequence of Phatr3_EG01991 and insert it upstream of the eGFP in the basic expression vector pPha-T1-eGFP to construct the directional expression plasmid pPha-T1-EG01991-eGFP; Step 2: Artificially synthesize the codon-optimized Q4 and Q6 coding sequences and insert them downstream of the eGFP in the directed expression vector to construct cell wall-enabled plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6; Step 3: Electroporate the cell wall empowerment plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 into *Phaeodactylum tricornutum*, respectively. Then, spread the transformed *Phaeodactylum tricornutum* cells on f / 2 plates for culture and screen for positive algal strains to obtain genetically engineered algae with cell wall empowerment plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6, respectively.

[0009] Furthermore, step 1 is detailed as follows: (1) Based on the Phatr3_EG01991 coding sequence, forward and reverse amplification primers containing KpnI restriction sites were designed. PCR amplification was performed using Phatr3_EG01991 DNA as a template to obtain the Phatr3_EG01991 coding sequence amplification product. The nucleotide sequence of the forward amplification primer of the Phatr3_EG01991 coding sequence is shown in SEQ ID NO:4: 5'-GACTAATTCGAGCTCGGTACCATGAGGCTGCGTACATCCATTG-3'. The nucleotide sequence of the reverse amplification primer of the Phatr3_EG01991 coding sequence is shown in SEQ ID NO:5: 5'-CACCATGGATCCCCGGGTACCTGGCAAGAGATTCCAAAACGA-3'. (2) The pPha-T1-eGFP plasmid was digested with KpnI restriction endonuclease, and the Phatr3_EG01991 coding sequence amplification product was ligated with the digested pPha-T1-eGFP to construct the directional expression plasmid pPha-T1-EG01991-eGFP.

[0010] Furthermore, step 2 is detailed as follows: (1) Based on the Q4 coding sequence and the flexible linker coding sequence, Q4 double-stranded nucleotides were designed and synthesized artificially; based on the Q6 coding sequence and the flexible linker coding sequence, Q6 double-stranded nucleotides were designed and synthesized artificially. (2) Based on the Q4 coding sequence and HindIII restriction site, Q4 forward and reverse amplification primers were designed, and Q4 double-stranded nucleotides were used as templates for PCR amplification to obtain Q4 nucleotide amplification fragments; based on the Q6 coding sequence and HindIII restriction site, Q6 forward and reverse amplification primers were designed, and Q6 double-stranded nucleotides were used as templates for PCR amplification to obtain Q6 nucleotide amplification fragments. (3) Construction of cell wall empowering plasmids: pPha-T1-EG01991-eGFP was digested with HindIII restriction endonuclease. The Q4 nucleotide amplification fragment and the Q6 nucleotide amplification fragment were ligated with the digested pPha-T1-EG01991-eGFP to construct the corresponding cell wall empowering plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6.

[0011] Further, the nucleotide sequence of the sense strand of the Q4 double-stranded nucleotide synthesized in step (1) is shown in SEQ ID NO:8; GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCGCGCTAACGCCGCTAAGAAGTTCGCTACCATCGCCAAGAAGTTCATCAACTACCTCTGG, and the antisense strand is the reverse complementary sequence of its sense strand; the nucleotide sequence of the sense strand of the Q6 double-stranded nucleotide synthesized is shown in SEQ ID NO:11; GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCATCAAGATTGCGAAGAAGGCTATCACCATCGCTAAGAAGATCGCGAAGATCTACTGG, and the antisense strand is the reverse complementary sequence of its sense strand.

[0012] Further, the nucleotide sequence of the Q4 forward amplification primer in step (2) is shown in SEQ ID NO: 12: 5'-ggtggcggcggttccaagcttGGCGCTAACGCCGCTAAGA-3' and the nucleotide sequence of the Q4 reverse amplification primer is shown in SEQ ID NO: 13: 5'-gatagcacgcttctgaagcttTTACCAGAGGTAGTTGATG-3'; the nucleotide sequence of the Q6 forward amplification primer is shown in SEQ ID NO: 14: 5'-ggtggcggcggttccaagcttGGCATCAAGATTGCGAAGA-3' and the nucleotide sequence of the Q6 reverse amplification primer is shown in SEQ ID NO: 15: 5'-gatagcacgcttctgaagcttTTACCAGTAGATCTTCGCG-3'.

[0013] Furthermore, step 3 is detailed below: (1) Transformation of *Phaeodactylum tricornutum*: Cell wall empowerment plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 were transformed into competent cells. After incubation, the cells were spread onto LB solid medium. Once visible colonies were formed, the colonies were picked and cultured in LB liquid medium on a shaker. The transformed competent cells were collected, and the corresponding cell wall empowerment plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 were extracted and transformed into *Phaeodactylum tricornutum* by electroporation. (2) Screening of positive transformants: Transformed *Phaeodactylum tricornutum* cells were spread on solid f / 2 plates containing bleomycin and placed under light intensity of 50-70 µmol photons m -2 s -1 Cultured at 20-24℃, positive transformation columns were screened to obtain genetically engineered algae resistant to aquatic pathogens.

[0014] The present invention also provides the application of the above-mentioned genetically engineered algae resistant to aquatic pathogens in the preparation of Vibrio alginolyticus inhibitors.

[0015] The present invention also provides the application of the above-mentioned genetically engineered algae resistant to aquatic pathogens in the preparation of Vibrio parahaemolyticus inhibitors.

[0016] Compared with existing technologies, the advantages of this invention are as follows: This invention discloses a highly efficient cell wall localization tag. Compared with existing frustulins (Fru2, Phatr3_J48054), Phatr3_EG01991 can more efficiently anchor target peptides to the cell wall, significantly improving cell wall empowerment efficiency. Simultaneously, this invention discloses a genetically engineered algae resistant to aquatic pathogens, its construction method, and its application. Using the Phatr3_EG01991 protein as a localization tag, it is expressed in microalgae along with antimicrobial peptides that inhibit aquatic pathogens. This allows the antimicrobial peptides to be localized to the microalgal cell wall, thereby endowing the microalgae with the ability to inhibit or kill aquatic pathogens. The genetically engineered algae constructed by this method not only fully utilizes the ecological functions of microalgae but also endows them with disease resistance characteristics, providing an innovative and efficient disease prevention and control solution for aquaculture. Attached Figure Description

[0017] Figure 1 Agarose gel electrophoresis image of the Phatr3_EG01991 coding sequence, where lane 1: 2000 bp marker, lanes 2 and 3: Phatr3_EG01991 amplified fragment; Figure 2 The results of screening positive transformants of *Phaeodactylum tricornutum* using the plate method with the aid of antibiotics; Figure 3 To compare the transcriptional abundance of Phatr3_EG01991 in wild-type strains, transformants with the basal plasmid pPha-T1-eGFP, transformants with pPha-T1-EG01991-eGFP-Linker-Q4, and transformants with pPha-T1-EG01991-eGFP-Linker-Q6 using real-time quantitative PCR, * indicates P value less than 0.05; Figure 4The results of comparative analysis of eGFP localization in wild-type strain, pPha-T1-eGFP transformant, pPha-T1-EG01991-eGFP-Linker-Q4 transformant, and pPha-T1-EG01991-eGFP-Linker-Q6 transformant were obtained using laser confocal microscopy. Green represents eGFP signal and red represents chloroplast autofluorescence. Figure 5 This study compares and analyzes the eGFP signal intensity in wild-type strain, pPha-T1-eGFP transformant, pPha-T1-EG01991-eGFP-Linker-Q4 transformant, pPha-T1-EG01991-eGFP-Linker-Q6 transformant, pPha-T1-J48054-eGFP-Linker-Q4 transformant, and pPha-T1-J48054-eGFP-Linker-Q6 transformant using flow cytometry. Figure 6 The inhibition zone experiment of crude protein from different strains of *Phaeodactylum tricornutum* against *Vibrio alginolyticus* and *Vibrio parahaemolyticus*. Figure 7 The results are shown under fluorescence microscopy during the co-culture of different strains of sterile *Phaeodactylum tricornutum* with *Vibrio alginolyticus* and *Vibrio parahaemolyticus*. Small green dots represent bacteria stained with SYBR GreenI, while larger green dots represent *Phaeodactylum tricornutum* stained with SYBR GreenI. *a* represents the pPha-T1-EG01991-eGFP-Linker-Q4 / Q6 transformant, and *b* represents the pPha-T1-J48054-eGFP-Linker-Q4 / Q6 transformant. The fluorescence signal of the wild-type strain originates from chloroplast autofluorescence, the fluorescence signal of the pPha-T1-eGFP transformant originates from chloroplast autofluorescence and eGFP in the cytoplasm, while the fluorescence signals of the other four transformed strains originate from chloroplast autofluorescence and eGFP in the cell wall. * indicates a P-value less than 0.05. Figure 8 To analyze the bacterial density of Vibrio alginolyticus and Vibrio parahaemolyticus during co-culture with sterilized wild-type Phaeodactylum tricornutum, pPha-T1-EG01991-eGFP-Linker-Q4 transformant, and pPha-T1-EG01991-eGFP-Linker-Q6 transformant. Detailed Implementation

[0018] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments.

[0019] Microalgae: *Phaeodactylum tricornutum*; Basic plasmid: pPha-T1-eGFP; Amplification kit: 2×Phanta FlashMaster Mix (Dye Plus) (Vazyme, P520-01); Competent cells: DH5α; Ligation kit: ClonExpress® II One Step Cloning Kit (Vazyme, C112-02); DNA extraction: 2×CTAB (Coolaber, SL2071); Plasmid extraction kit: FastPure Plasmid Mini Kit (Vazyme, DC201-01), etc. The culture medium used was f / 2 medium prepared according to the literature (Guillard RRL, Ryther JH. Studies of marine planktonic diatoms: I. Cyclotella nana Hustedt, and Detonula confervacea (Cleve) Gran[J]. Canadian Journal of Microbiology, 1962, 8(2): 229–239); the microalgae culture equipment was: Zhichu ZQZY-88CGES full-temperature shaking incubator; the microalgae culture conditions were: light intensity 60 µmol photons m -2 s -1 The temperature was 22℃ and the shaking speed was 90 rpm. Both the pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6 transformants were prepared using the method described in patent number CN202510131566.6, entitled "A Genetically Engineered Algae Resistant to Aquatic Pathogens and Its Construction and Application Methods".

[0020] Different genetic transformation systems of different microalgae, different cell wall proteins and related positioning tags or peptides, and different antimicrobial peptides can all be used to construct microalgae germplasm resistant to aquatic pathogens in this patent. This specific embodiment only lists the use of *Phaeodactylum tricornutum* as research material, employing electroporation, using pPha-T1-eGFP as the basic plasmid, Phatr3_EG01991 as the localization tag, and antimicrobial peptides Q4 and Q6 as enablers to construct anti-pathogenic microalgal germplasm. Genetically engineered *Phaeodactylum tricornutum* with the cell wall enabler plasmid pPha-T1-EG01991-eGFP-Linker-Q4 and genetically engineered *Phaeodactylum tricornutum* with the cell wall enabler plasmid pPha-T1-EG01991-eGFP-Linker-Q6 are obtained. The nucleotide sequence of the cell wall enabler plasmid pPha-T1-EG01991-eGFP-Linker-Q4 is shown in SEQ ID NO:1, and the nucleotide sequence of the cell wall enabler plasmid pPha-T1-EG01991-eGFP-Linker-Q6 is shown in SEQ ID NO:2.

[0021] Specific Example 1: Constructing the directed expression plasmid pPha-T1-EG01991-eGFP, including the following steps: Step 1, Extraction of genomic DNA from *Phaeodactylum tricornutum*: Collect cells in the logarithmic growth phase (cell density 5 × 10⁻⁶). 6 Genomic DNA was extracted from a solution of *Phaeodactylum triangularis* containing cells / mL. Step 2, PCR amplification: Using the Ensembl Protists database, the open reading frame sequence of Phatr3_EG01991 was located. The nucleotide sequence of Phatr3_EG01991 is shown in SEQ ID NO:3. Based on the coding sequence of Phatr3_EG01991, forward and reverse amplification primers containing KpnI restriction sites were designed. The nucleotide sequence of the forward amplification primer for the Phatr3_EG01991 coding sequence is shown in SEQ ID NO:4: 5'-GACTAATTCGAGCTCGGTACCATGAGGCTGCGTACATCCATTG-3', and the nucleotide sequence of the reverse amplification primer for the Phatr3_EG01991 coding sequence is shown in SEQ ID NO:5: 5'-CACCATGGATCCCCGGGTACCTGGCAAGAGATTCCAAAACGA-3'. The PCR amplification system consisted of: 0.5 μL of *Phaeodactylum tricornutum* DNA, 10 μL of 2×Phanta Flash Master Mix, 0.5 μL each of the forward and reverse amplification primers for the Phatr3_EG01991 coding sequence, and 8.5 μL of ddH2O. The PCR amplification program was as follows: 94℃ for 5 min; 94℃ for 30 sec, 65℃ for 30 sec, 72℃ for 1 min, for 35 cycles, and stored at 4℃. Step 3: Identification of PCR Amplification Products: After amplification, the PCR products were separated and verified by agarose gel electrophoresis. The results are as follows: Figure 1 As shown, lane 1 is the DNA Marker, and lanes 2 and 3 are the amplified Phatr3_EG01991 coding sequences. The length of the amplified fragment is consistent with the theoretical length. Subsequently, the fragments were cut into gels, recovered, and sequenced.

[0022] Step 4: Construction of the directional expression vector: The pPha-T1-eGFP plasmid was digested with KpnI restriction endonuclease. The Phatr3_EG01991 coding sequence amplification product obtained in step 3 was ligated with the digested pPha-T1-eGFP and reacted at 37℃ for 30 min to construct the directional expression plasmid pPha-T1-EG01991-eGFP.

[0023] Specific Example 2: Constructing cell wall-energized plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6.

[0024] Step 1: Synthesize the double-stranded nucleotides encoding Q4 and Q6: The amino acid sequence of the antimicrobial peptide Q4 is shown in SEQ ID NO:6: GANAAKKFATIAKKFINYLW. Codon optimization was performed based on the amino acid sequence of the antimicrobial peptide Q4 to obtain the nucleotide sequence encoding Q4 as shown in SEQ ID NO:7: 5'-GGCGCTAACGCCGCTAAGAAGTTCGCTACCATCGCCAAGAAGTTCATCAACTACCTCTGG-3'. Based on the Q4 coding sequence and the coding sequence of the flexible linker ((G4S)2), the Q4 double-stranded nucleotides were artificially designed and synthesized. The nucleotide sequence of the positive strand of Q4 is shown in SEQ ID NO:8: 5'-GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCGCTAACGCCGCTAAGAAGTTCGCTACCATCGCCAAGAAGTTCATCAACTACCTCTGG-3'. The antisense strand of Q4 is the reverse complementary sequence of the positive strand. The amino acid sequence of antimicrobial peptide Q6 is shown in SEQ ID NO:9: GIKIAKKAITIAKKIAKIYW. Codon optimization was performed based on the amino acid sequence of antimicrobial peptide Q6 to obtain the nucleotide sequence encoding Q6 as shown in SEQ ID NO:10: 5'-GGCATCAAGATTGCGAAGAAGGCTATCACCATCGCTAAGAAGATCGCGAAGATCTACTGG-3'. Based on the Q6 coding sequence and the coding sequence of the flexible linker ((G4S)2), the Q6 double-stranded nucleotide was artificially designed and synthesized. The nucleotide sequence of the positive strand of Q6 is shown in SEQ ID NO:11: 5'-GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCATCAAGATTGCGAAGAAGGCTATCACCATCGCTAAGAAGATCGCGAAGATCTACTGG-3'. The antisense strand of Q6 is the reverse complementary sequence of the positive strand.

[0025] Step 2: Amplify the Q4 and Q6 coding sequences: Based on the Q4 coding sequence and HindIII restriction site, design forward and reverse amplification primers for Q4. The nucleotide sequence of the forward amplification primer is shown in SEQ ID NO: 12: 5'-ggtggcggcggttccaagcttGGCGCTAACGCCGCTAAGA-3' and the nucleotide sequence of the reverse amplification primer is shown in SEQ ID NO: 13: 5'-gatagcacgcttctgaagcttTTACCAGAGGTAGTTGATG-3'. PCR amplification is performed using Q4 double-stranded nucleotides as templates. The PCR amplification system consisted of: 0.5 μL double-stranded nucleotides, 10 μL 2×PrimeSTAR Max Premix, 0.5 μL each of the forward and reverse amplification primers for the Q4 coding sequence, and 8.5 μL ddH2O. The PCR program was as follows: 94℃ for 5 min; 94℃ for 30 sec, 65℃ for 30 sec, 72℃ for 1 min, for 35 cycles, and stored at 4℃.

[0026] Simultaneously, based on the Q6 coding sequence and HindIII restriction site, forward and reverse amplification primers for Q6 were designed. The nucleotide sequence of the forward amplification primer is shown in SEQ ID NO: 14: 5'-ggtggcggcggttccaagcttGGCATCAAGATTGCGAAGA-3', and the nucleotide sequence of the reverse amplification primer is shown in SEQ ID NO: 15: 5'-gatagcacgcttctgaagcttTTACCAGTAGATCTTCGCG-3'. PCR amplification was performed using Q6 double-stranded nucleotides as templates. The PCR amplification system consisted of: 0.5 μL double-stranded nucleotides, 10 μL 2×PrimeSTAR Max Premix, 0.5 μL each of the forward and reverse amplification primers for the Q6 coding sequence, and 8.5 μL ddH2O. The PCR procedure was the same as above.

[0027] Step 3: Construction of cell wall empowerment plasmids: pPha-T1-EG01991-eGFP was digested with HindIII restriction endonuclease. The Q4 and Q6 nucleotide amplification fragments obtained in Step 2 were ligated to the digested pPha-T1-EG01991-eGFP to construct the corresponding cell wall empowerment plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6.

[0028] Specific Implementation Example 3: Constructing genetically engineered algae resistant to aquatic pathogens, the steps are as follows: Step 1: Transformation with cell wall-empowering plasmids: The cell wall-empowering plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 were transformed into competent cells, respectively. After incubation, the cells were spread onto LB solid medium. Once visible colonies formed, the colonies were picked and transferred to LB liquid medium. The transformed competent cells were then cultured in a constant temperature shaking incubator at 37°C. The transformed competent cells were collected, and the corresponding cell wall-empowering plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 were extracted and transformed into *Phaeodactylum tricornutum* by electroporation. The electroporation parameters were: 500 V, 25 μF, and 400 Ω. Step 2, Screening of positive transformants: Transformed *Phaeodactylum tricornutum* cells were plated on f / 2 plates containing 1.0% agar at a bleomycin concentration of 75 μg / mL and placed under light at an intensity of 60 µmol photons / m². -2 s -1After being cultured at 22℃ for approximately 3 weeks, the successfully transformed strains formed algal colonies on f / 2 plates, as shown in the results. Figure 2 As shown; visible algal colonies were picked and cultured in liquid f / 2 medium with a bleomycin concentration of 75 μg / mL for 1 week to obtain the algal solution of *Phaeodactylum tricornutum*, and the DNA of the algal solution was extracted as an identification template; Step 3, identification of positive transformants: Identification primers were designed based on the eGFP coding sequence. The nucleotide sequence of the forward identification primer is shown in SEQ ID NO:16: 5'-GACGACGGCAACTACAAGAC-3', and the nucleotide sequence of the reverse identification primer is shown in SEQ ID NO:17: 5'-CGAACTCCAGCAGGACCAT-3'. The PCR amplification system consisted of: 0.5 μL of *Phaeodactylum tricornutum* DNA, 10 μL of 2×Phanta Flash Master Mix, 0.5 μL each of the forward and reverse identification primers designed based on the eGFP coding sequence, and 8.5 μL of ddH2O. The PCR amplification program was as follows: 94℃ for 5 min; 94℃ for 30 sec, 58℃ for 30 sec, 72℃ for 1 min, for 35 cycles, and stored at 4℃. The PCR products were separated by agarose gel electrophoresis and then sequenced. Sanger sequencing results showed that the amplified fragment originated from the eGFP coding region of the empowered plasmid, indicating that the empowered plasmid had been successfully transformed into *Phaeodactylum tricornutum*.

[0029] Specific Example 4: Validation of positive transformation strains of *Phaeodactylum tricornutum*.

[0030] 1. Transcriptional Level Validation: Total RNA was extracted from each strain of *Phaeodactylum tricornutum* and reverse transcribed to obtain cDNA. Using cDNA as a template, the transcription of *Phatr3_EG01991* in wild-type and positively transformed strains was compared and analyzed using real-time quantitative PCR. Wild-type strain and *pPha-T1-eGFP* basal plasmid transformant strain were designated as negative control 1 and negative control 2, respectively.

[0031] Real-time quantitative PCR forward and reverse primers were designed based on the Phatr3_EG01991 sequence. The nucleotide sequence of the real-time quantitative PCR forward primer is shown in SEQ ID NO:18: 5'-TCTCTTCGCTGGCACTTCTG-3'; the nucleotide sequence of the real-time quantitative PCR reverse primer is shown in SEQ ID NO:19: 5'-GAAGGAGATCCATTGTTGCC-3'. Real-time quantitative PCR system: 0.5 μL of *Phaeodactylum tricornutum* cDNA, 10 μL of 2×PhantaQuantiNovaSYBRGreen PCR Master Mix, 0.5 μL each of real-time quantitative PCR forward and reverse primers, and 8.5 μL of ddH2O; The real-time quantitative PCR program was as follows: 94℃ for 5 min; 94℃ for 15 sec, 60℃ for 30 sec, for 40 cycles.

[0032] like Figure 3 As shown, the lines transformed with cell wall-empowered plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 exhibited a relative transcription abundance of Phatr3_EG01991 several times higher than that of the wild-type line (negative control 1) and the line transformed with the pPha-T1-eGFP basal plasmid (negative control 2). This indicates that the target fragment in the cell wall-empowered plasmid can be successfully transcribed in the transformed lines.

[0033] 2. Protein level verification: Each strain of *Phaeodactylum tricornutum* was cultured to the logarithmic growth phase (cell density approximately 5 × 10⁻⁶). 6 After detecting the number of cells / mL, the location and intensity of the eGFP signal in each strain of *Phaeodactylum tricornutum* were detected and compared using laser confocal microscopy and flow cytometry at excitation and emission wavelengths of 488 nm and 507 nm, respectively. The wild-type strain and the pPha-T1-eGFP basal plasmid-transformed strain were used as negative control 1 and negative control 2, respectively.

[0034] Laser confocal results are as follows Figure 4 As shown, in *Phaeodactylum tricornutum* strains transformed with cell wall-empowering plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6, the green fluorescence signal was accurately localized to the cell wall; in wild-type cells (negative control 1), no eGFP signal was observed; in strains transformed with the basal plasmid pPha-T1-eGFP (negative control 2), the eGFP signal was localized to the cytoplasm. This indicates that the target fragment in the cell wall-empowering plasmid can be successfully expressed in the transformed strains; it also shows that Phatr3_EG01991 can directionally express the target peptide in the cell wall of *Phaeodactylum tricornutum*.

[0035] Flow cytometry results as follows Figure 5The fluorescence signal intensity of the wild-type strain was significantly lower than that of the pPha-T1-eGFP transformant, the pPha-T1-EG01991-eGFP-Linker-Q4 transformant, and the pPha-T1-EG01991-eGFP-Linker-Q6 transformant. Furthermore, the fluorescence signal intensity of the pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 transformants was comparable to that of the pPha-T1-eGFP transformant. This indicates that Phatr3_EG01991 can anchor the vast majority of target peptides to the cell wall of *Phaeodactylum tricornutum*. The fluorescence signal intensity of the pPha-T1-J48054-eGFP-Linker-Q4 and pPha-T1-J48054-eGFP-Linker-Q6 transformants was significantly lower than that of the pPha-T1-eGFP, pPha-T1-EG01991-eGFP-Linker-Q4, and pPha-T1-EG01991-eGFP-Linker-Q6 transformants. This indicates that Phatr3_J48054, as a cell wall localization tag, can anchor the target functional peptide to the cell wall, but the anchoring efficiency is significantly lower than that of Phatr3_EG01991. That is, some target functional peptides fused with Phatr3_J48054 cannot be anchored to the cell wall and become secreted proteins.

[0036] In summary, the transcription and protein expression level identification results showed that the expression plasmids constructed using Phatr3_J48054 and Phatr3_EG01991 as localization tags were able to anchor the Q4 and Q6 carried by them to the cell wall of *Phaeodactylum tricornutum*, but the anchoring efficiency of Phatr3_EG01991 was significantly higher than that of Phatr3_J48054.

[0037] Specific Implementation Example 5: Validation of the antibacterial effect based on the positive transformation strain of *Phaeodactylum tricornutum*.

[0038] The antibacterial effects of the cell wall-energized plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 were verified based on crude protein extract and co-culture of algae and bacteria.

[0039] 1. Validation of antibacterial effect based on crude protein Step 1: Cultivating *Phaeodactylum tricornutum*: Wild-type *Phaeodactylum tricornutum* (negative control), pPha-T1-EG01991-eGFP-Linker-Q4 positive transformant, and pPha-T1-EG01991-eGFP-Linker-Q6 positive transformant were inoculated into liquid f / 2 medium at the same initial density (cell density approximately 1×10⁻⁶). 6 The cells were cultured in a constant-temperature, light-controlled shaker until the plateau phase (cell density approximately 1.5 × 10⁻⁶ cells / mL). 7 (cells / mL); culture conditions: light intensity 60 µmol photons / mL. -2 s -1 The temperature was 22℃ and the rotation speed was 90 rpm. Subsequently, the algal cells were collected by centrifugation and crude protein was extracted.

[0040] Step 2, inhibition zone verification: Crude protein (equal amounts) of each strain was added dropwise onto 2216E solid plates coated with Vibrio alginolyticus and Vibrio parahaemolyticus, and the bacteria were incubated in a constant temperature incubator at 22℃ for 72 hours. During this period, the antibacterial effect of crude protein of each strain was observed. Crude protein extracted from wild strains was used as a negative control, and 2216E solid plates with 50ug / mL kanamycin were used as a positive control.

[0041] The results are as follows Figure 6 As shown, compared to the wild-type strain (negative control), the crude protein of *Phaeodactylum tricornutum* transformed with pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 formed a significant inhibition zone, and the diameter of the inhibition zone was similar to that of 50 μm. The inhibition zones of g / mL kanamycin (positive control) were comparable, demonstrating that both pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 transformants exhibited significant inhibitory effects against Vibrio alginolyticus and Vibrio parahaemolyticus.

[0042] 2. Validation of antibacterial effect based on nucleic acid staining in an algae-bacteria co-culture system. Step 1: Algae-bacteria co-culture: Transformation was performed on sterile wild-type *Phaeodactylum tricornutum*, pPha-T1-EG01991-eGFP-Linker-Q4 positive transformants, and pPha-T1-EG01991-eGFP-Linker-Q6 positive transformants (cell density approximately 1×10⁻⁶). 6 The cells / mL were supplemented with Vibrio alginolyticus and Vibrio parahaemolyticus (bacterial density approximately 1×10⁻⁶ cells / mL), respectively. 6 (CFU / mL). Subsequently, each strain was placed in a constant-temperature, light-controlled shaker for co-culture of algae and bacteria.

[0043] Step 2, Fluorescence Microscopy Observation: After co-culturing for 48 hours, the nucleic acids of *Phaeodactylum tricornutum*, *Vibrio alginolyticus*, and *Vibrio parahaemolyticus* were stained with SYBR Green I and observed under a fluorescence microscope. Under the microscope, the bacterial nucleic acids appeared as small green dots; while the nucleic acids of *Phaeodactylum tricornutum* also emitted green fluorescence, they were larger.

[0044] Microscopic examination results as follows Figure 7 a and Figure 7 As shown in Figure b, the number of *Vibrio alginolyticus* in the wild-type strain was significantly higher than that in the Q4 and Q6 expression strains (bacterial nucleic acids are indicated by red circles, and *Phaeodactylum tricornutum* nucleic acids are indicated by yellow arrows); the results for *Vibrio parahaemolyticus* were similar. This indicates that the assisted strains can effectively inhibit the growth of *Vibrio alginolyticus* and *Vibrio parahaemolyticus* in water. Notably, the number of surviving bacteria in the assisted strain tagged with *Phatr3_EG01991* was significantly less than that in the assisted strain tagged with *Phatr3_J48054*, indicating that *Phatr3_EG01991* is more efficient at anchoring antimicrobial peptides to the cell wall than the traditional *Phatr3_J48054*.

[0045] 3. Validation of antibacterial effect based on plate colony count in the algae-bacteria co-culture system. Step 1: Algae-bacteria co-culture: Sterile wild-type *Phaeodactylum tricornutum* (negative control), pPha-T1-EG01991-eGFP-Linker-Q4 positive transformant, pPha-T1-EG01991-eGFP-Linker-Q6 positive transformant, pPha-T1-J48054-eGFP-Linker-Q4 transformant, and pPha-T1-J48054-eGFP-Linker-Q6 transformant were cultured to the exponential growth phase (cell density approximately 5 × 10⁻⁶). 6 cells / mL), and equal amounts of Vibrio alginolyticus culture medium (Vibrio alginolyticus density OD) were added to each strain of *Phaeodactylum tricornutum*. 600 =0.5, the volume ratio of algal solution to bacterial solution is 100:1) and Vibrio parahaemolyticus culture medium (the density of Vibrio parahaemolyticus is OD). 600 =0.5, the volume ratio of algae solution to bacterial solution was 100:1); then, it was placed in a constant temperature and light shaker for co-cultivation for 5 days. The co-cultivation conditions for algae and bacteria were: temperature 22℃, light intensity 60 µmol photons m -2 s -1 The shaking speed is 90 rpm.

[0046] Step 2, bacterial density determination: During co-culture, the cell density of Vibrio alginolyticus and Vibrio parahaemolyticus in each strain was detected by the dilution plate counting method based on 2216E solid plates, and the antibacterial effect of Q4 positive transformants and Q6 positive transformants in the culture system was evaluated.

[0047] The results are as follows Figure 8 As shown, in the algae-bacteria co-culture system, the cell densities of *Vibrio alginolyticus* and *Vibrio parahaemolyticus* in the pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 positive transformants were significantly lower than those in the wild-type *Phaeodactylum tricornutum* (negative control). At the end of the culture, the densities of *Vibrio alginolyticus* and *Vibrio parahaemolyticus* in the pPha-T1-EG01991-eGFP-Linker-Q4 positive transformant were 0.9 × 10⁻⁶ and 0.9 × 10⁻⁶, respectively. 5 CFU / mL and 1.2×10 5 The CFU / mL concentrations were approximately 1 / 43 and 1 / 40 of those in the wild-type strain, respectively. Similarly, the densities of Vibrio alginolyticus and Vibrio parahaemolyticus in the pPha-T1-EG01991-eGFP-Linker-Q6 positive transformant were 1.1 × 10⁻⁶, respectively. 5 CFU / mL and 0.7×10 5 The CFU / mL concentrations were 1 / 32 and 1 / 64 of those of the wild-type strain.

[0048] The densities of Vibrio alginolyticus and Vibrio parahaemolyticus in the pPha-T1-J48054-eGFP-Linker-Q4 positive transformant were 2.7 × 10⁻⁶. 5 CFU / mL and 2.3×10 5 The CFU / mL concentrations were approximately 1 / 12 and 1 / 18 of those in the wild-type strain, respectively. Similarly, the densities of Vibrio alginolyticus and Vibrio parahaemolyticus in the pPha-T1-J48054-eGFP-Linker-Q6 positive transformant were 3.6 × 10⁻⁶. 5 CFU / mL and 2.6×10 5 The CFU / mL values ​​were 1 / 9 and 1 / 16 of those of the wild-type strains, respectively. This indicates that both energized lines can effectively inhibit aquatic pathogens.

[0049] It is worth noting that although the two enabled strains constructed using J48054 as the localization tag showed ideal inhibitory effects against aquatic pathogens, they were significantly weaker than the two enabled strains using Phatr3_EG01991 as the localization tag. This further demonstrates that Phatr3_EG01991, as the localization tag, can more efficiently anchor antimicrobial peptides to the cell walls of *Phaeodactylum tricornutum*. It also indicates that the *Phaeodactylum tricornutum* germplasm improved in this invention exhibits ideal inhibitory effects against aquatic pathogens in water.

[0050] The foregoing description is not intended to limit the invention, nor is the invention limited to the examples given. Any changes, modifications, additions, or substitutions made by those skilled in the art within the scope of the invention should also be considered within the protection scope of the invention.

Claims

1. A genetically engineered algae resistant to aquatic pathogens, characterized in that: The genetically engineered algae is *Phaeodactylum tricornutum*, in which cell wall-empowering plasmids pPha-T1-EG01991-eGFP-Linker-Q4 or pPha-T1-EG01991-eGFP-Linker-Q6 are introduced. Antimicrobial peptide Q4 or Q6 is directionally expressed in the cell wall of *Phaeodactylum tricornutum*. The nucleotide sequence of the cell wall-empowering plasmid pPha-T1-EG01991-eGFP-Linker-Q4 is shown in SEQ ID NO:1, and the nucleotide sequence of the cell wall-empowering plasmid pPha-T1-EG01991-eGFP-Linker-Q6 is shown in SEQ ID NO:

2.

2. A method for constructing a genetically engineered algae resistant to aquatic pathogens as described in claim 1, characterized in that... Includes the following steps: Step 1: Using the genomic DNA of *Phaeodactylum tricornutum* as a template, amplify the coding sequence of Phatr3_EG01991 and insert it upstream of the eGFP in the basic expression vector pPha-T1-eGFP to construct the directional expression plasmid pPha-T1-EG01991-eGFP; Step 2: Artificially synthesize the codon-optimized Q4 and Q6 coding sequences and insert them downstream of the eGFP in the directed expression vector to construct cell wall-enabled plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6; Step 3: Electroporate the cell wall empowerment plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 into *Phaeodactylum tricornutum*, respectively. Then, spread the transformed *Phaeodactylum tricornutum* cells on f / 2 plates for culture and screen for positive algal strains to obtain genetically engineered algae with cell wall empowerment plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6, respectively.

3. The method for constructing a genetically engineered algae resistant to aquatic pathogens according to claim 2, characterized in that... Step 1 is as follows: (1) Based on the Phatr3_EG01991 coding sequence, forward and reverse amplification primers containing KpnI restriction sites were designed. PCR amplification was performed using Phatr3_EG01991 DNA as a template to obtain the Phatr3_EG01991 coding sequence amplification product. The nucleotide sequence of the forward amplification primer of the Phatr3_EG01991 coding sequence is shown in SEQ ID NO:4: 5'-GACTAATTCGAGCTCGGTACCATGAGGCTGCGTACATCCATTG-3'. The nucleotide sequence of the reverse amplification primer of the Phatr3_EG01991 coding sequence is shown in SEQ ID NO:5: 5'-CACCATGGATCCCCGGGTACCTGGCAAGAGATTCCAAAACGA-3'. (2) The pPha-T1-eGFP plasmid was digested with KpnI restriction endonuclease, and the Phatr3_EG01991 coding sequence amplification product was ligated with the digested pPha-T1-eGFP to construct the directional expression plasmid pPha-T1-EG01991-eGFP.

4. The method for constructing a genetically engineered algae resistant to aquatic pathogens according to claim 2, characterized in that... Step 2 is as follows: (1) Based on the Q4 coding sequence and the flexible linker coding sequence, Q4 double-stranded nucleotides were designed and synthesized artificially; based on the Q6 coding sequence and the flexible linker coding sequence, Q6 double-stranded nucleotides were designed and synthesized artificially. (2) Based on the Q4 coding sequence and HindIII restriction site, Q4 forward and reverse amplification primers were designed, and Q4 double-stranded nucleotides were used as templates for PCR amplification to obtain Q4 nucleotide amplification fragments; based on the Q6 coding sequence and HindIII restriction site, Q6 forward and reverse amplification primers were designed, and Q6 double-stranded nucleotides were used as templates for PCR amplification to obtain Q6 nucleotide amplification fragments. (3) Construction of cell wall empowering plasmids: pPha-T1-EG01991-eGFP was digested with HindIII restriction endonuclease. The Q4 nucleotide amplification fragment and the Q6 nucleotide amplification fragment were ligated with the digested pPha-T1-EG01991-eGFP to construct the corresponding cell wall empowering plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6.

5. The method for constructing a genetically engineered algae resistant to aquatic pathogens according to claim 4, characterized in that... The nucleotide sequence of the sense strand of the Q4 double-stranded nucleotide synthesized in step (1) is shown in SEQ ID NO:8; GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCGCGCTAACGCCGCTAAGAAGTTCGCTACCATCGCCAAGAAGTTCATCAACTACCTCTGG, and the antisense strand is the reverse complementary sequence of its sense strand; the nucleotide sequence of the sense strand of the Q6 double-stranded nucleotide synthesized is shown in SEQ ID NO:11; GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCATCAAGATTGCGAAGAAGGCTATCACCATCGCTAAGAAGATCGCGAAGATCTACTGG, and the antisense strand is the reverse complementary sequence of its sense strand.

6. The method for constructing a genetically engineered algae resistant to aquatic pathogens according to claim 4, characterized in that... The nucleotide sequence of the Q4 forward amplification primer in step (2) is shown in SEQ ID NO: 12: 5'-ggtggcggcggttccaagcttGGCGCTAACGCCGCTAAGA-3' and the nucleotide sequence of the Q4 reverse amplification primer is shown in SEQ ID NO: 13: 5'-gatagcacgcttctgaagcttTTACCAGAGGTAGTTGATG-3'; the nucleotide sequence of the Q6 forward amplification primer is shown in SEQ ID NO: 14: 5'-ggtggcggcggttccaagcttGGCATCAAGATTGCGAAGA-3' and the nucleotide sequence of the Q6 reverse amplification primer is shown in SEQ ID NO: 15: 5'-gatagcacgcttctgaagcttTTACCAGTAGATCTTCGCG-3'.

7. The method for constructing a genetically engineered algae resistant to aquatic pathogens according to claim 2, characterized in that... Step 3 is as follows: (1) Transformation of *Phaeodactylum tricornutum*: Cell wall empowerment plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 were transformed into competent cells. After incubation, the cells were spread onto LB solid medium. Once visible colonies were formed, the colonies were picked and cultured in LB liquid medium on a shaker. The transformed competent cells were collected, and the corresponding cell wall empowerment plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 were extracted and transformed into *Phaeodactylum tricornutum* by electroporation. (2) Screening of positive transformants: Transformed *Phaeodactylum tricornutum* cells were spread on solid f / 2 plates containing bleomycin and placed under light intensity of 50-70 µmol photons m -2 s -1 Cultured at 20-24℃, positive transformation columns were screened to obtain genetically engineered algae resistant to aquatic pathogens.

8. The application of a genetically engineered algae resistant to aquatic pathogens as described in claim 1 in the preparation of Vibrio alginolyticus inhibitors.

9. The application of a genetically engineered algae resistant to aquatic pathogens according to claim 1 in the preparation of Vibrio parahaemolyticus inhibitors.

Images