Genetically engineered algae against aquatic pathogenic bacteria and construction method and application thereof

Abstract

The application discloses genetically engineered algae against aquatic pathogenic bacteria and a construction method and application thereof, characterized by that the genetically engineered algae is Phaeodactylum tricornutum which is introduced with cell wall enabling plasmid pPha-T1-EG01991-eGFP-Linker-Q4 or pPha-T1-EG01991-eGFP-Linker-Q6, the preparation method comprises the following steps: taking the genomic DNA of the Phaeodactylum tricornutum as a template, amplifying the Phatr3_EG01991 coding sequence to construct a directional expression plasmid pPha-T1-EG01991-eGFP, inserting the Q4 and Q6 coding sequences into the eGFP downstream of the directional expression vector to construct the cell wall enabling plasmid, electrotransforming the cell wall enabling plasmid into the Phaeodactylum tricornutum, and coating the transformed Phaeodactylum tricornutum cells on f / 2 flat plate culture medium for culture and screening positive algae strains, and the genetically engineered algae has the advantages of having the inhibiting or killing capacity to the aquatic pathogenic bacteria.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of plant breeding, and particularly relates to a genetically engineered algae resistant to aquatic pathogenic bacteria and a construction method and application thereof. BACKGROUND

[0002] With the rapid development of aquaculture and the increasing intensification, a large number of microorganisms in the aquaculture water body multiply, causing frequent outbreaks of various aquatic diseases. Among them, bacterial diseases such as diseases caused by Vibrio parahaemolyticus (Vp), Vibrio alginolyticus (Va), Aeromonas hydrophila (Ah) and so on are particularly common and serious. These diseases not only reduce the quality and yield of aquatic products, causing a large amount of economic loss every year, but also pose a potential threat to human health. Vibrio parahaemolyticus Vibrio alginolyticus Aeromonas hydrophila These diseases not only reduce the quality and yield of aquatic products, causing a large amount of economic loss every year, but also pose a potential threat to human health.

[0003] For a long time, the aquaculture industry mainly prevents and controls bacterial diseases by applying antibiotics. However, the long-term overuse of antibiotics leads to rapid increase of bacterial drug resistance, widespread dissemination of drug resistance genes, and drug residue problems in aquatic products. Therefore, exploring and developing new disease control means has become the key to promoting the sustainable development and transformation and upgrading of aquaculture.

[0004] Antibacterial peptides are a class of small molecule peptides of natural origin or artificial synthesis, which have broad-spectrum antimicrobial activity and can effectively kill bacteria, fungi and viruses. Because of its rapid bactericidal effect and low risk of causing drug resistance, antibacterial peptides show great application potential in protecting aquatic animals from pathogen invasion, improving breeding efficiency and ensuring the safety of aquatic products. Therefore, antibacterial peptides are widely considered as a promising antibiotic alternative in the aquaculture industry. However, the effect of antibacterial peptides on killing aquatic pathogenic bacteria depends on their concentration in water. Because the production cost of antibacterial peptides is high, it is difficult to promote the method of adding a large amount of antibacterial peptides directly to the water in actual aquaculture. Therefore, it is of great significance to develop a low-cost and efficient application method to fully exert the antibacterial properties of antibacterial peptides for promoting the healthy development of aquaculture.

[0005] In the aquaculture system, microalgae can reach a very high cell density and coexist with various pathogenic bacteria in the same ecological niche, and there is close and frequent interaction between microalgae and pathogenic bacteria. If microalgae are endowed with the ability to inhibit bacteria, it is expected to achieve efficient prevention and control of aquatic pathogenic bacteria through microalgae. At present, there are few reports on microalgae with the ability to inhibit or kill pathogenic bacteria and their construction methods on the market. SUMMARY

[0006] ​​The technical problem solved by the present application is to provide a localization tag capable of anchoring functional peptide segments to the cell wall efficiently and a genetically engineered algae against aquatic pathogenic bacteria with inhibitory or killing ability and a construction method and application thereof.

[0007] The technical solution adopted by the present application to solve the above technical problem is: a genetically engineered algae against aquatic pathogenic bacteria, wherein the genetically engineered algae is Phaeodactylum tricornutum into which a cell wall enabling plasmid pPha-T1-EG01991-eGFP-Linker-Q4 or pPha-T1-EG01991-eGFP-Linker-Q6 is introduced, and an antibacterial peptide Q4 or an antibacterial peptide Q6 is expressed in the cell wall of the Phaeodactylum tricornutum, the nucleotide sequence of the cell wall enabling plasmid pPha-T1-EG01991-eGFP-Linker-Q4 is shown in SEQ ID NO: 1, and the nucleotide sequence of the cell wall enabling plasmid pPha-T1-EG01991-eGFP-Linker-Q6 is shown in SEQ ID NO: 2.

[0008] The present application also provides a construction method of the genetically engineered algae against aquatic pathogenic bacteria, comprising the following steps:

[0009] Step 1: taking the genomic DNA of Phaeodactylum tricornutum as a template, amplifying the Phatr3_EG01991 coding sequence, and inserting it upstream of eGFP of the basic expression vector pPha-T1-eGFP to construct a directional expression plasmid pPha-T1-EG01991-eGFP;

[0010] Step 2: artificially synthesizing the codon-optimized Q4 and Q6 coding sequences, and inserting them downstream of eGFP of the directional expression vector to construct the cell wall enabling plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6;

[0011] Step 3: electrically transforming the cell wall enabling plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 into Phaeodactylum tricornutum respectively, and coating the transformed Phaeodactylum tricornutum cells on f / 2 plate medium for culture, and screening positive algae strains to obtain the genetically engineered algae into which the cell wall enabling plasmid pPha-T1-EG01991-eGFP-Linker-Q4 is introduced and the genetically engineered algae into which the cell wall enabling plasmid pPha-T1-EG01991-eGFP-Linker-Q6 is introduced.

[0012] Further, step 1 is specifically as follows:

[0013] (1) According to the coding sequence of Phatr3_EG01991, forward and reverse amplification primers containing KpnI restriction sites were designed, and the coding sequence of Phatr3_EG01991 was amplified by PCR using Phaeodactylum tricornutum DNA as a template, wherein the nucleotide sequence of the forward amplification primer of the coding sequence of Phatr3_EG01991 is shown in SEQ ID NO: 4: 5'-GACTAATTCGAGCTCGGTACCATGAGGCTGCGTACATCCATTG-3', and the nucleotide sequence of the reverse amplification primer of the coding sequence of Phatr3_EG01991 is shown in SEQ ID NO: 5: 5'-CACCATGGATCCCCGGGTACCTGGCAAGAGATTCCAAAACGA-3';

[0014] (2) The pPha-T1-eGFP plasmid was digested using KpnI restriction endonuclease, and the amplified product of the coding sequence of Phatr3_EG01991 was ligated with the digested pPha-T1-eGFP to construct the directional expression plasmid pPha-T1-EG01991-eGFP.

[0015] Further, step 2 is specifically as follows:

[0016] (1) Q4 double-stranded nucleotides were artificially designed and synthesized according to the coding sequence of Q4 and the coding sequence of flexible Linker; Q6 double-stranded nucleotides were artificially designed and synthesized according to the coding sequence of Q6 and the coding sequence of flexible Linker;

[0017] (2) Based on the coding sequence of Q4 and the HindIII restriction site, Q4 forward and reverse amplification primers were designed, and the Q4 nucleotide amplification fragment was obtained by PCR amplification using the Q4 double-stranded nucleotides as a template; based on the coding sequence of Q6 and the HindIII restriction site, Q6 forward and reverse amplification primers were designed, and the Q6 nucleotide amplification fragment was obtained by PCR amplification using the Q6 double-stranded nucleotides as a template;

[0018] (3) Cell wall enabling plasmid construction: pPha-T1-EG01991-eGFP was digested using HindIII restriction endonuclease, and the Q4 nucleotide amplification fragment and the Q6 nucleotide amplification fragment were ligated with the digested pPha-T1-EG01991-eGFP, respectively, to construct the corresponding cell wall enabling plasmid pPha-T1-EG01991-eGFP-Linker-Q4 and the cell wall enabling plasmid pPha-T1-EG01991-eGFP-Linker-Q6.

[0019] Further, the nucleotide sequence of the sense strand of the Q4 double-stranded nucleotide synthesized in step (1) is shown in SEQ ID NO:8; GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCGCGCTAACGCCGCTAAGAAGTTCGCTACCATCGCCAAGAAGTTCATCAACTACCTCTGG, and the antisense strand is the reverse complementary sequence of its sense strand; the nucleotide sequence of the sense strand of the Q6 double-stranded nucleotide synthesized is shown in SEQ ID NO:11; GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCATCAAGATTGCGAAGAAGGCTATCACCATCGCTAAGAAGATCGCGAAGATCTACTGG, and the antisense strand is the reverse complementary sequence of its sense strand.

[0020] Further, the nucleotide sequence of the Q4 forward amplification primer in step (2) is shown in SEQ ID NO: 12: 5'-ggtggcggcggttccaagcttGGCGCTAACGCCGCTAAGA-3' and the nucleotide sequence of the Q4 reverse amplification primer is shown in SEQ ID NO: 13: 5'-gatagcacgcttctgaagcttTTACCAGAGGTAGTTGATG-3'; the nucleotide sequence of the Q6 forward amplification primer is shown in SEQ ID NO: 14: 5'-ggtggcggcggttccaagcttGGCATCAAGATTGCGAAGA-3' and the nucleotide sequence of the Q6 reverse amplification primer is shown in SEQ ID NO: 15: 5'-gatagcacgcttctgaagcttTTACCAGTAGATCTTCGCG-3'.

[0021] Furthermore, step 3 is detailed below:

[0022] (1) Transformation of *Phaeodactylum tricornutum*: Cell wall empowerment plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 were transformed into competent cells. After incubation, the cells were spread onto LB solid medium. Once visible colonies were formed, the colonies were picked and cultured in LB liquid medium on a shaker. The transformed competent cells were collected, and the corresponding cell wall empowerment plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 were extracted and transformed into *Phaeodactylum tricornutum* by electroporation.

[0023] (2) Positive transformant screening: the transformed Phaeodactylum tricornutum cells are coated on solid f / 2 plate medium containing bleomycin, and are cultured under the condition of light intensity 50-70 µmol photons m -2 s -1 Temperature 20-24℃, and the positive transformants are screened, that is, the genetically engineered algae against aquatic pathogenic bacteria are obtained.

[0024] The application further provides application of the genetically engineered algae against aquatic pathogenic bacteria in preparation of Vibrio alginolyticus inhibitors.

[0025] The application further provides application of the genetically engineered algae against aquatic pathogenic bacteria in preparation of Vibrio parahaemolyticus inhibitors.

[0026] Compared with the prior art, the application has the advantages that: the application discloses an efficient cell wall localization tag, compared with the existing Frustulins (Fru2, Phatr3_J48054), Phatr3_EG01991 can more efficiently anchor the target peptide segment on the cell wall, greatly improving the cell wall enabling efficiency; meanwhile, the application discloses genetically engineered algae against aquatic pathogenic bacteria and a construction method and application thereof, the Phatr3_EG01991 protein is used as a localization tag, and the antibacterial peptide with the activity of inhibiting aquatic pathogenic bacteria is expressed in microalgae, so that the antibacterial peptide is positioned on the cell wall of the microalgae, thereby endowing the microalgae with the ability of inhibiting or killing aquatic pathogenic bacteria. The genetically engineered algae constructed by the method not only fully plays the ecological function of the microalgae, but also endows the microalgae with the disease resistance, and provides an innovative and efficient disease prevention and treatment scheme for the aquaculture industry. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 It is an agarose gel electrophoresis map of Phatr3_EG01991 coding sequence, wherein, lane 1: 2000 bpMarker, lanes 2 and 3: Phatr3_EG01991 amplified fragments;

[0028] Figure 2 It is a screening result of the positive transformants of Phaeodactylum tricornutum by using the plate method with the help of antibiotics;

[0029] Figure 3 It is a comparative analysis of the Phatr3_EG01991 transcription abundance in the wild strain, the basic plasmid pPha-T1-eGFP transformant, the pPha-T1-EG01991-eGFP-Linker-Q4 transformant and the pPha-T1-EG01991-eGFP-Linker-Q6 transformant based on the real-time quantitative PCR method, and * represents that the P value is less than 0.05;

[0030] Figure 4For comparative analysis of eGFP localization in wild type, pPha-T1-eGFP transformed strain, pPha-T1-EG01991-eGFP-Linker-Q4 transformed strain, pPha-T1-EG01991-eGFP-Linker-Q6 transformed strain based on laser confocal means, wherein green is eGFP signal, red is chloroplast autofluorescence;

[0031] Figure 5 For comparative analysis of eGFP signal intensity in wild type, pPha-T1-eGFP transformed strain, pPha-T1-EG01991-eGFP-Linker-Q4 transformed strain, pPha-T1-EG01991-eGFP-Linker-Q6 transformed strain, pPha-T1-J48054-eGFP-Linker-Q4 transformed strain, pPha-T1-J48054-eGFP-Linker-Q6 transformed strain based on flow cytometry;

[0032] Figure 6 For antibacterial circle experiment of crude protein of different strains of Phaeodactylum tricornutum on Vibrio alginolyticus and Vibrio parahaemolyticus;

[0033] Figure 7 For fluorescence microscope examination results of aseptic Phaeodactylum tricornutum of different strains and Vibrio alginolyticus and Vibrio parahaemolyticus during co-culture, wherein small green dot signal represents SYBR Green I stained bacteria, and larger green signal represents SYBR Green I stained Phaeodactylum tricornutum; wherein a is pPha-T1-EG01991-eGFP-Linker-Q4 / Q6 transformed strain, b is pPha-T1-J48054-eGFP-Linker-Q4 / Q6 transformed strain, the fluorescence signal of wild type is derived from chloroplast autofluorescence, the fluorescence signal of pPha-T1-eGFP transformed strain is derived from chloroplast autofluorescence and eGFP in cytoplasm, and the fluorescence signal of other four enabled strains is derived from chloroplast autofluorescence and eGFP in cell wall, * indicates that P value is less than 0.05;

[0034] Figure 8 For bacterial density analysis of Vibrio alginolyticus and Vibrio parahaemolyticus during algal-bacterial co-culture with aseptic Phaeodactylum tricornutum wild type, pPha-T1-EG01991-eGFP-Linker-Q4 transformed strain, pPha-T1-EG01991-eGFP-Linker-Q6 transformed strain. DETAILED DESCRIPTION

[0035] The application will be further described in detail below with reference to the accompanying drawings.

[0036] Microalgae: Phaeodactylum tricornutum; base plasmid: pPha-T1-eGFP; amplification kit: 2x Phanta Flash Master Mix (Dye Plus) (Vazyme, P520-01); competent cells: DH5a; ligation kit: ClonExpress® II One Step Cloning Kit (Vazyme, C112-02); DNA extraction: 2x CTAB (Coolaber, SL2071); plasmid extraction kit: FastPure Plasmid Mini Kit (Vazyme, DC201-01) and the like. The medium used is f / 2 medium configured according to the literature (Guillard RRL, Ryther JH. Studies of marine planktonic diatoms: I. Cyclotella nana Hustedt, and Detonula confervacea (Cleve) Gran [J]. Canadian Journal of Microbiology, 1962, 8(2): 229-239); microalgae culture equipment: Zhichu ZQZY-88CGES full-temperature shaking incubator; microalgae culture conditions: light intensity 60 µmol photons m -2 s -1 , temperature 22℃, shaking speed 90 rpm. The pPha-T1-J48054-eGFP-Linker-Q4 transformant and the pPha-T1-J48054-eGFP-Linker-Q6 transformant are both prepared by the method described in the patent No. CN202510131566.6, entitled: A genetically engineered algae against aquatic pathogenic bacteria and a construction method and application thereof.

[0037] Different genetic transformation systems of different microalgae, different cell wall proteins and related localization tags or peptide segments, and different antibacterial peptides can be used for the construction of the anti-aquatic pathogenic bacteria microalgae germplasm of the present patent. The specific embodiments only list the use of Phaeodactylum tricornutum as the research material, the use of the electroporation method, the use of pPha-T1-eGFP as the basic plasmid, the use of Phatr3_EG01991 as the localization tag, and the use of antibacterial peptides Q4 and Q6 as the enabling guest to carry out the construction of the anti-pathogenic bacteria microalgae germplasm, respectively obtain the genetically engineered Phaeodactylum tricornutum into which the cell wall enabling plasmid pPha-T1-EG01991-eGFP-Linker-Q4 is introduced and the genetically engineered Phaeodactylum tricornutum into which the cell wall enabling plasmid pPha-T1-EG01991-eGFP-Linker-Q6 is introduced, wherein the nucleotide sequence of the cell wall enabling plasmid pPha-T1-EG01991-eGFP-Linker-Q4 is shown in SEQ ID NO: 1, and the nucleotide sequence of the cell wall enabling plasmid pPha-T1-EG01991-eGFP-Linker-Q6 is shown in SEQ ID NO: 2.

[0038] Specific embodiment one, constructing the directional expression plasmid pPha-T1-EG01991-eGFP, includes the following steps:

[0039] Step 1, extraction of Phaeodactylum tricornutum genomic DNA: collect the Phaeodactylum tricornutum algal liquid in the logarithmic phase (cell density is 5×10 6 cells / mL), and extract the genomic DNA;

[0040] Step 2, PCR amplification: according to the Ensembl Protists database, find the Phatr3_EG01991 open reading frame sequence, obtain the nucleotide sequence of Phatr3_EG01991 as shown in SEQ ID NO: 3, and design the forward and reverse amplification primers containing the KpnI enzyme cutting site according to the Phatr3_EG01991 coding sequence, wherein the nucleotide sequence of the Phatr3_EG01991 coding sequence forward amplification primer is shown in SEQ ID NO: 4: 5’-GACTAATTCGAGCTCGGTACCATGAGGCTGCGTACATCCATTG-3’, and the nucleotide sequence of the Phatr3_EG01991 coding sequence reverse amplification primer is shown in SEQ ID NO: 5: 5’-CACCATGGATCCCCGGGTACCTGGCAAGAGATTCCAAAACGA-3’;

[0041] PCR amplification system: 0.5 μL Phaeodactylum tricornutum DNA, 10 μL 2x Phanta Flash Master Mix, 0.5 μL Phatr3_EG01991 coding sequence forward and reverse amplification primer, 8.5 μL ddH2O;

[0042] PCR amplification procedure: 94℃ 5 min; 94℃ 30 sec, 65℃ 30 sec, 72℃ 1 min, cycle 35 times, 4℃ preservation;

[0043] Step 3, PCR amplification product identification: after amplification, the PCR product was separated and verified by agarose gel electrophoresis. The results are shown in Figure 1 , lane 1 is DNA Marker, lane 2, 3 is the amplified Phatr3_EG01991 coding sequence, the length of the amplified fragment is consistent with the theoretical length, and then the gel recovery and sequencing are carried out.

[0044] Step 4, directional expression vector construction: KpnI restriction enzyme was used to cut the pPha-T1-eGFP plasmid, and the Phatr3_EG01991 coding sequence amplification product obtained in step 3 was connected with the enzyme cut pPha-T1-eGFP, and the reaction was carried out at 37℃ for 30 min, and the directional expression plasmid pPha-T1-EG01991-eGFP was constructed.

[0045] Specific embodiment two, construction of cell wall enabled plasmid pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6.

[0046] Step 1, synthesis of double-stranded nucleotide encoding Q4 and Q6: the amino acid sequence of antibacterial peptide Q4 is shown as SEQ ID NO: 6: GANAAKKFATIAKKFINYLW, the nucleotide sequence encoding Q4 is shown as SEQ ID NO: 7 according to the codon optimization of the amino acid sequence of antibacterial peptide Q4: 5'-GGCGCTAACGCCGCTAAGAAGTTCGCTACCATCGCCAAGAAGTTCATCAACTACCTCTGG-3', Q4 double-stranded nucleotide is artificially designed and synthesized according to the coding sequence of Q4 and the coding sequence of flexible Linker ((G4S)2), wherein the nucleotide sequence of Q4 sense strand is shown as SEQ ID NO: 8: 5'-GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCGCTAACGCCGCTAAGAAGTTCGCTACCATCGCCAAGAAGTTCATCAACTACCTCTGG-3'; the antisense strand of Q4 is the reverse complement of the sense strand;

[0047] The amino acid sequence of antibacterial peptide Q6 is shown as SEQ ID NO: 9: GIKIAKKAITIAKKIAKIYW, the nucleotide sequence encoding Q6 is shown as SEQ ID NO: 10 according to the codon optimization of the amino acid sequence of antibacterial peptide Q6: 5'-GGCATCAAGATTGCGAAGAAGGCTATCACCATCGCTAAGAAGATCGCGAAGATCTACTGG-3', Q6 double-stranded nucleotide is artificially designed and synthesized according to the coding sequence of Q6 and the coding sequence of flexible Linker ((G4S)2), wherein the nucleotide sequence of Q6 sense strand is shown as SEQ ID NO: 11: 5'-GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCATCAAGATTGCGAAGAAGGCTATCACCATCGCTAAGAAGATCGCGAAGATCTACTGG-3'; the antisense strand of Q6 is the reverse complement of the sense strand.

[0048] Step 2, amplification of Q4 and Q6 coding sequences: based on the Q4 coding sequence and the Hind III restriction site, the Q4 forward and reverse amplification primers are designed, the nucleotide sequence of the Q4 forward amplification primer is shown as SEQ ID NO: 12: 5'-ggtggcggcggttccaagcttGGCGCTAACGCCGCTAAGA-3' and the nucleotide sequence of the Q4 reverse amplification primer is shown as SEQ ID NO: 13: 5'-gatagcacgcttctgaagcttTTACCAGAGGTAGTTGATG-3'; PCR amplification is carried out with the Q4 double-stranded nucleotide as the template;

[0049] PCR amplification system: 0.5 μL double-stranded nucleotide, 10 μL 2x PrimeSTAR Max Premix, 0.5 μL Q4 coding sequence forward and reverse amplification primer, 8.5 μL ddH2O;

[0050] PCR program: 94℃ 5 min; 94℃ 30 sec, 65℃ 30 sec, 72℃ 1 min, cycle 35 times, 4℃ preservation.

[0051] Meanwhile, based on Q6 coding sequence and Hind III enzyme cutting site, Q6 forward and reverse amplification primers were designed, the nucleotide sequence of Q6 forward amplification primer is shown in SEQ ID NO: 14: 5'-ggtggcggcggttccaagcttGGCATCAAGATTGCGAAGA-3' and the nucleotide sequence of Q6 reverse amplification primer is shown in SEQ ID NO: 15: 5'-gatagcacgcttctgaagcttTTACCAGTAGATCTTCGCG-3'; Q6 double-stranded nucleotide was used as a template for PCR amplification; PCR amplification system: 0.5 μL double-stranded nucleotide, 10 μL 2x PrimeSTAR Max Premix, 0.5 μL Q6 coding sequence forward and reverse amplification primer, 8.5 μL ddH2O; PCR program is the same as above.

[0052] Step 3, cell wall enabling plasmid construction: pPha-T1-EG01991-eGFP was cut by Hind III restriction endonuclease, and the Q4 nucleotide amplification fragment and the Q6 nucleotide amplification fragment obtained in step 2 were respectively connected with the cut pPha-T1-EG01991-eGFP to construct the corresponding cell wall enabling plasmid pPha-T1-EG01991-eGFP-Linker-Q4 and the cell wall enabling plasmid pPha-T1-EG01991-eGFP-Linker-Q6.

[0053] Specific embodiment three, construction of anti-aquatic pathogenic bacteria genetically engineered algae, the steps are as follows:

[0054] Step 1, cell wall competent plasmid transformation: the cell wall competent plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 were transformed into competent cells respectively, after incubation, they were coated on LB solid medium, and after visible colonies were formed, the colonies were picked to LB liquid medium and cultured in a constant temperature shaking incubator at 37°C. The transformed competent cells were collected, and the corresponding cell wall competent plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 were extracted, and then they were transformed into Phaeodactylum tricornutum by electroporation method, and the electric conversion parameters were as follows: 500 V, 25 μF, 400 Ω;

[0055] Step 2, positive transformant screening: the transformed Phaeodactylum tricornutum cells were coated on f / 2 plate medium containing 1.0% agar with a concentration of 75 μg / mL of bleomycin, and cultured under the condition of light intensity 60 µmol photons m -2 s -1 -2℃, and after about 3 weeks, the successfully transformed strains formed algal colonies on the f / 2 plate, and the results are shown in Figure 2 ; the visible algal colonies were picked to liquid f / 2 medium with a concentration of 75 μg / mL of bleomycin and cultured for 1 week to obtain Phaeodactylum tricornutum algal liquid, and the algal liquid DNA was extracted as an identification template;

[0056] Step 3, positive transformant identification: identification primers were designed based on the eGFP coding sequence, wherein the nucleotide sequence of the forward identification primer is shown in SEQ ID NO: 16: 5'-GACGACGGCAACTACAAGAC-3', and the nucleotide sequence of the reverse identification primer is shown in SEQ ID NO: 17: 5'-CGAACTCCAGCAGGACCAT-3';

[0057] The PCR amplification system was as follows: 0.5 μL of Phaeodactylum tricornutum DNA, 10 μL of 2×Phanta Flash Master Mix, 0.5 μL of forward and reverse identification primers designed based on the eGFP coding sequence, and 8.5 μL of ddH2O;

[0058] The PCR amplification program was as follows: 94℃ for 5 min; 94℃ for 30 sec, 58℃ for 30 sec, 72℃ for 1 min, for 35 cycles, 4℃ for storage, and the PCR product was separated by agarose gel electrophoresis and then sequenced. The Sanger sequencing results showed that the amplified fragment was derived from the eGFP coding region of the competent plasmid, indicating that the competent plasmid had been successfully transformed into Phaeodactylum tricornutum.

[0059] Specific Implementation Example 4: Validation of positive transformation strains of *Phaeodactylum tricornutum*.

[0060] 1. Transcriptional Level Validation: Total RNA was extracted from each strain of *Phaeodactylum tricornutum* and reverse transcribed to obtain cDNA. Using cDNA as a template, the transcription of *Phatr3_EG01991* in wild-type and positively transformed strains was compared and analyzed using real-time quantitative PCR. Wild-type strain and *pPha-T1-eGFP* basal plasmid transformant strain were designated as negative control 1 and negative control 2, respectively.

[0061] Real-time quantitative PCR forward and reverse primers were designed based on the Phatr3_EG01991 sequence. The nucleotide sequence of the real-time quantitative PCR forward primer is shown in SEQ ID NO:18: 5'-TCTCTTCGCTGGCACTTCTG-3'; the nucleotide sequence of the real-time quantitative PCR reverse primer is shown in SEQ ID NO:19: 5'-GAAGGAGATCCATTGTTGCC-3'.

[0062] Real-time quantitative PCR system: 0.5 μL of *Phaeodactylum tricornutum* cDNA, 10 μL of 2×PhantaQuantiNovaSYBRGreen PCR Master Mix, 0.5 μL each of real-time quantitative PCR forward and reverse primers, and 8.5 μL of ddH2O;

[0063] The real-time quantitative PCR program was as follows: 94℃ for 5 min; 94℃ for 15 sec, 60℃ for 30 sec, for 40 cycles.

[0064] like Figure 3 As shown, the lines transformed with cell wall-empowered plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 exhibited a relative transcription abundance of Phatr3_EG01991 several times higher than that of the wild-type line (negative control 1) and the line transformed with the pPha-T1-eGFP basal plasmid (negative control 2). This indicates that the target fragment in the cell wall-empowered plasmid can be successfully transcribed in the transformed lines.

[0065] 2. Protein level verification: Each strain of *Phaeodactylum tricornutum* was cultured to the logarithmic growth phase (cell density approximately 5 × 10⁻⁶). 6After 48h (OD680= 1.0, 1.0 x 106cells / mL), the eGFP signal position and intensity of each strain of Phaeodactylum tricornutum were detected and compared by means of laser confocal microscope and flow cytometry, respectively, under the condition of excitation and emission wavelength of 488 nm and 507 nm. Among them, the wild strain and the pPha-T1-eGFP basic plasmid transformation strain were negative control 1 and negative control 2, respectively.

[0066] The laser confocal results are shown in Figure 4 As shown in the figure, the green fluorescence signal of the Phaeodactylum tricornutum strain transformed with the cell wall enabling plasmid pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 was accurately positioned to the cell wall; no eGFP signal was observed in the wild strain (negative control 1); the eGFP signal of the strain transformed with the basic plasmid pPha-T1-eGFP was positioned in the cytoplasm. It is shown that the target fragment in the cell wall enabling plasmid can be successfully expressed in the transformed strain; it is also shown that Phatr3_EG01991 can direct the expression of the target peptide segment to the cell wall of Phaeodactylum tricornutum.

[0067] The flow cytometry results are shown in Figure 5 As shown in the figure, the fluorescence signal intensity of the wild strain was significantly lower than that of the pPha-T1-eGFP transformation strain and the pPha-T1-EG01991-eGFP-Linker-Q4 transformation strain and the pPha-T1-EG01991-eGFP-Linker-Q6 transformation strain, and the fluorescence signal intensity of the pPha-T1-EG01991-eGFP-Linker-Q4 transformation strain and the pPha-T1-EG01991-eGFP-Linker-Q6 transformation strain was comparable to that of the pPha-T1-eGFP transformation strain; it is shown that Phatr3_EG01991 can anchor most of the target peptide segments to the cell wall of Phaeodactylum tricornutum. The fluorescence signal intensity of the pPha-T1-J48054-eGFP-Linker-Q4 transformation strain and the pPha-T1-J48054-eGFP-Linker-Q6 transformation strain was significantly lower than that of the pPha-T1-eGFP transformation strain, the pPha-T1-EG01991-eGFP-Linker-Q4 transformation strain and the pPha-T1-EG01991-eGFP-Linker-Q6 transformation strain; it is shown that Phatr3_J48054 as a cell wall positioning tag can anchor the target functional peptide segment to the cell wall, but the anchoring efficiency is significantly lower than that of Phatr3_EG01991, that is, part of the target functional peptide fused with Phatr3_J48054 cannot be anchored to the cell wall and becomes a secretory protein.

[0068] In summary, the results of transcriptional and protein expression level identification showed that the expression plasmids constructed with Phatr3_J48054 and Phatr3_EG01991 as localization tags could anchor Q4 and Q6 carried by them to the cell wall of Phaeodactylum tricornutum, but the anchoring efficiency of Phatr3_EG01991 was significantly higher than that of Phatr3_J48054.

[0069] Specific embodiment five, verification of the antibacterial effect based on the positive transformants of Phaeodactylum tricornutum.

[0070] The antibacterial effect of the transformants of cell wall enabled plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 based on crude protein extract and based on algal-bacterial co-culture was verified.

[0071] 1. Verification of the antibacterial effect based on crude protein

[0072] Step 1, culture of Phaeodactylum tricornutum: Phaeodactylum tricornutum wild strain (negative control), pPha-T1-EG01991-eGFP-Linker-Q4 positive transformant and pPha-T1-EG01991-eGFP-Linker-Q6 positive transformant were inoculated into liquid f / 2 medium with the same initial density (cell density about 1×10 6 cells / mL) and placed in a constant temperature and light incubator for culture to the stationary phase (cell density about 1.5×10 7 cells / mL); the culture conditions were light intensity 60 µmol photons m -2 s -1 -1, temperature 22℃ and rotation speed 90 rpm. Then, the algal cells were collected by centrifugation and crude protein was extracted.

[0073] Step 2, verification of antibacterial circle: the crude protein of each strain (equal amount) was added dropwise onto the 2216E solid plate coated with Vibrio alginolyticus and Vibrio parahaemolyticus, and the bacteria were cultured in a constant temperature incubator, with the culture condition being temperature 22℃ and culture time 72h; during the culture, the antibacterial effect of the crude protein of each strain was observed, with the crude protein extracted from the wild strain as the negative control and the 2216E solid plate added with kanamycin at a concentration of 50ug / mL as the positive control.

[0074] The results, as shown in Figure 6 , compared with the wild strain (negative control), the crude protein of Phaeodactylum tricornutum transformed with pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 could form obvious antibacterial circles, and the diameters of the antibacterial circles were significantly larger than those of the wild strain (negative control) and the positive control added with kanamycin at a concentration of 50ug / mL. The inhibition zone of 100 g / mL kanamycin (positive control) was equivalent; it was proved that pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 transformants both showed obvious inhibitory effect on Vibrio alginolyticus and Vibrio parahaemolyticus.

[0075] 2. Inhibition effect verification based on nucleic acid staining under algal-bacterial co-culture system

[0076] Step 1, algal-bacterial co-culture: 1 x 10 6 cells / mL) of Vibrio alginolyticus and Vibrio parahaemolyticus (bacterial density of about 1 x 10 6 CFU / mL) were added, respectively. Then, each strain was placed in a constant temperature and light incubator for algal-bacterial co-culture.

[0077] Step 2, fluorescence microscope observation: after 48 hours of co-culture, the nucleic acids of Phaeodactylum tricornutum, Vibrio alginolyticus and Vibrio parahaemolyticus were stained with SYBR Green I and observed by fluorescence microscope. In the microscope, bacterial nucleic acids were green dots with small volume; although Phaeodactylum tricornutum nucleic acids also emitted green fluorescence, they had larger volume.

[0078] The microscope results are shown in Figure 7 a and Figure 7 b, the number of Vibrio alginolyticus in the wild strain was much higher than that in Q4 and Q6 expression strains (bacterial nucleic acids are marked by red circles, and Phaeodactylum tricornutum nucleic acids are marked by yellow arrows); the results of Vibrio parahaemolyticus were similar. It showed that the enabled strains could effectively inhibit the growth of Vibrio alginolyticus and Vibrio parahaemolyticus in water. It is worth noting that the number of surviving bacteria in the enabled strains with Phatr3_EG01991 as the positioning tag was significantly less than that in the enabled strains with Phatr3_J48054 as the positioning tag, indicating that Phatr3_EG01991 anchored the antibacterial peptide to the cell wall more efficiently than the traditional Phatr3_J48054.

[0079] 3. Inhibition effect verification based on plate bacterial colony number under algal-bacterial co-culture system

[0080] Step 1, algae-bacteria co-culture: sterile Phaeodactylum tricornutum wild type (negative control), pPha-T1-EG01991-eGFP-Linker-Q4 positive transformant, pPha-T1-EG01991-eGFP-Linker-Q6 positive transformant, pPha-T1-J48054-eGFP-Linker-Q4 transformant and pPha-T1-J48054-eGFP-Linker-Q6 transformant were cultured to exponential phase (cell density about 5x10 6 cells / mL), and equal amount of Vibrio alginolyticus culture solution (Vibrio alginolyticus density OD 600 =0.5, algae solution and bacteria solution mixed volume ratio 100:1) and Vibrio parahaemolyticus culture solution (Vibrio parahaemolyticus density OD 600 =0.5, algae solution and bacteria solution mixed volume ratio 100:1) were added to each Phaeodactylum tricornutum strain, respectively. Then, they were placed in a constant temperature light incubator for co-culture for 5 days, and the algae-bacteria co-culture conditions were temperature 22℃, light intensity 60 µmol photons m -2 s -1 -1, and shaking speed 90 rpm.

[0081] Step 2, bacteria density determination: during the co-culture, the cell density of Vibrio alginolyticus and Vibrio parahaemolyticus in each strain was detected based on the dilution plate counting method of 2216E solid plate, and the antibacterial effect of Q4 positive transformant and Q6 positive transformant in the culture system was evaluated.

[0082] The results are shown in Table 1. Figure 8 As shown in Table 1, in the algae-bacteria co-culture system, the cell density of Vibrio alginolyticus and Vibrio parahaemolyticus in pPha-T1-EG01991-eGFP-Linker-Q4 positive transformant and pPha-T1-EG01991-eGFP-Linker-Q6 positive transformant was much lower than that in wild type Phaeodactylum tricornutum (negative control); at the end of the culture, the density of Vibrio alginolyticus and Vibrio parahaemolyticus in pPha-T1-EG01991-eGFP-Linker-Q4 positive transformant was 0.9x10 5 CFU / mL and 1.2x10 5 CFU / mL, respectively, about 1 / 43 and 1 / 40 of the wild type; similarly, the density of Vibrio alginolyticus and Vibrio parahaemolyticus in pPha-T1-EG01991-eGFP-Linker-Q6 positive transformant was 1.1x10 5 CFU / mL and 0.7x10 5 CFU / mL, respectively, about 1 / 32 and 1 / 64 of the wild type.

[0083] The densities of Vibrio alginolyticus and Vibrio parahaemolyticus in the pPha-T1-J48054-eGFP-Linker-Q4 positive transformant were 2.7×10 5 CFU / mL and 2.3×10 5 CFU / mL, which were about 1 / 12 and 1 / 18 of the wild strain; similarly, the densities of Vibrio alginolyticus and Vibrio parahaemolyticus in the pPha-T1-J48054-eGFP-Linker-Q6 positive transformant were 3.6×10 5 CFU / mL and 2.6×10 5 CFU / mL, which were 1 / 9 and 1 / 16 of the wild strain. It was shown that the two enabled strains could effectively inhibit water pathogens.

[0084] It is worth noting that although the two enabled strains constructed with J48054 as the positioning tag showed ideal inhibitory effect on water pathogens, they were significantly weaker than the two enabled strains with Phatr3_EG01991 as the positioning tag; it was again shown that Phatr3_EG01991 as the positioning tag could more efficiently anchor the antibacterial peptide on the cell wall of Phaeodactylum tricornutum. It was also shown that the improved Phaeodactylum tricornutum germplasm of the present application showed ideal inhibitory effect on water pathogens.

[0085] The above description is not a limitation of the present application, and the present application is not limited to the above examples. Changes, modifications, additions or substitutions made by those skilled in the art within the essential scope of the present application should also be within the protection scope of the present application.

Claims

1. A genetically engineered algae resistant to aquatic pathogens, characterized in that: The genetically engineered algae is *Phaeodactylum tricornutum*, in which cell wall-empowering plasmids pPha-T1-EG01991-eGFP-Linker-Q4 or pPha-T1-EG01991-eGFP-Linker-Q6 are introduced. Antimicrobial peptide Q4 or Q6 is directionally expressed in the cell wall of *Phaeodactylum tricornutum*. The nucleotide sequence of the cell wall-empowering plasmid pPha-T1-EG01991-eGFP-Linker-Q4 is shown in SEQ ID NO:1, and the nucleotide sequence of the cell wall-empowering plasmid pPha-T1-EG01991-eGFP-Linker-Q6 is shown in SEQ ID NO:

2.

2. A method for constructing a genetically engineered algae resistant to aquatic pathogens as described in claim 1, characterized in that... Includes the following steps: Step 1: Using the genomic DNA of *Phaeodactylum tricornutum* as a template, amplify the coding sequence of Phatr3_EG01991 and insert it upstream of the eGFP of the basic expression vector pPha-T1-eGFP to construct the directional expression plasmid pPha-T1-EG01991-eGFP, wherein the coding sequence of Phatr3_EG01991 is shown in SEQ ID NO:3; Step 2: Synthesize codon-optimized Q4 and Q6 coding sequences and insert them downstream of eGFP in the targeted expression vector to construct cell wall-enabled plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6. The Q4 coding sequence is shown in SEQ ID NO:7: 5'-GGCGCTAACGCCGCTAAGAAGTTCGCTACCATCGCCAAGAAGTTCATCAACTACCTCTGG-3', and the Q6 coding sequence is shown in SEQ ID NO:10: 5'-GGCATCAAGATTGCGAAGAAGGCTATCACCATCGCTAAGAAGATCGCGAAGATCTACTGG-3'. Step 3: Electroporate the cell wall empowerment plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 into *Phaeodactylum tricornutum*, respectively. Then, spread the transformed *Phaeodactylum tricornutum* cells on f / 2 plates for culture and screen for positive algal strains to obtain genetically engineered algae with cell wall empowerment plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6, respectively.

3. The method for constructing a genetically engineered algae resistant to aquatic pathogens according to claim 2, characterized in that... Step 1 is as follows: (1) Based on the Phatr3_EG01991 coding sequence, forward and reverse amplification primers containing KpnI restriction sites were designed. PCR amplification was performed using Phatr3_EG01991 DNA as a template to obtain the Phatr3_EG01991 coding sequence amplification product. The nucleotide sequence of the forward amplification primer of the Phatr3_EG01991 coding sequence is shown in SEQ ID NO:4: 5'-GACTAATTCGAGCTCGGTACCATGAGGCTGCGTACATCCATTG-3'. The nucleotide sequence of the reverse amplification primer of the Phatr3_EG01991 coding sequence is shown in SEQ ID NO:5: 5'-CACCATGGATCCCCGGGTACCTGGCAAGAGATTCCAAAACGA-3'. (2) The pPha-T1-eGFP plasmid was digested with KpnI restriction endonuclease, and the Phatr3_EG01991 coding sequence amplification product was ligated with the digested pPha-T1-eGFP to construct the directional expression plasmid pPha-T1-EG01991-eGFP.

4. The method for constructing a genetically engineered algae resistant to aquatic pathogens according to claim 2, characterized in that... Step 2 is as follows: (1) Based on the Q4 coding sequence and the flexible linker coding sequence, Q4 double-stranded nucleotides were designed and synthesized artificially; based on the Q6 coding sequence and the flexible linker coding sequence, Q6 double-stranded nucleotides were designed and synthesized artificially. (2) Based on the Q4 coding sequence and HindIII restriction site, Q4 forward and reverse amplification primers were designed, and Q4 double-stranded nucleotides were used as templates for PCR amplification to obtain Q4 nucleotide amplification fragments; based on the Q6 coding sequence and HindIII restriction site, Q6 forward and reverse amplification primers were designed, and Q6 double-stranded nucleotides were used as templates for PCR amplification to obtain Q6 nucleotide amplification fragments. (3) Construction of cell wall empowering plasmids: pPha-T1-EG01991-eGFP was digested with HindIII restriction endonuclease. The Q4 nucleotide amplification fragment and the Q6 nucleotide amplification fragment were ligated with the digested pPha-T1-EG01991-eGFP to construct the corresponding cell wall empowering plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6.

5. The method for constructing a genetically engineered algae resistant to aquatic pathogens according to claim 4, characterized in that... The nucleotide sequence of the sense strand of the Q4 double-stranded nucleotide synthesized in step (1) is shown in SEQ ID NO:8; GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCGCGCTAACGCCGCTAAGAAGTTCGCTACCATCGCCAAGAAGTTCATCAACTACCTCTGG, and the antisense strand is the reverse complementary sequence of its sense strand; the nucleotide sequence of the sense strand of the Q6 double-stranded nucleotide synthesized is shown in SEQ ID NO:11; GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCGGCATCAAGATTGCGAAGAAGGCTATCACCATCGCTAAGAAGATCGCGAAGATCTACTGG, and the antisense strand is the reverse complementary sequence of its sense strand.

6. The method for constructing a genetically engineered algae resistant to aquatic pathogens according to claim 4, characterized in that... The nucleotide sequence of the Q4 forward amplification primer in step (2) is shown in SEQ ID NO: 12: 5'-ggtggcggcggttccaagcttGGCGCTAACGCCGCTAAGA-3' and the nucleotide sequence of the Q4 reverse amplification primer is shown in SEQ ID NO: 13: 5'-gatagcacgcttctgaagcttTTACCAGAGGTAGTTGATG-3'; the nucleotide sequence of the Q6 forward amplification primer is shown in SEQ ID NO: 14: 5'-ggtggcggcggttccaagcttGGCATCAAGATTGCGAAGA-3' and the nucleotide sequence of the Q6 reverse amplification primer is shown in SEQ ID NO: 15: 5'-gatagcacgcttctgaagcttTTACCAGTAGATCTTCGCG-3'.

7. The method for constructing a genetically engineered algae resistant to aquatic pathogens according to claim 2, characterized in that... Step 3 is as follows: (1) Transformation of *Phaeodactylum tricornutum*: Cell wall empowerment plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 were transformed into competent cells. After incubation, the cells were spread onto LB solid medium. Once visible colonies were formed, the colonies were picked and cultured in LB liquid medium on a shaker. The transformed competent cells were collected, and the corresponding cell wall empowerment plasmids pPha-T1-EG01991-eGFP-Linker-Q4 and pPha-T1-EG01991-eGFP-Linker-Q6 were extracted and transformed into *Phaeodactylum tricornutum* by electroporation. (2) Screening of positive transformants: Transformed *Phaeodactylum tricornutum* cells were spread on solid f / 2 plates containing bleomycin and placed under light intensity of 50-70 µmol photons m -2 s -1 Cultured at 20-24℃, positive transformation columns were screened to obtain genetically engineered algae resistant to aquatic pathogens.

8. The application of a genetically engineered algae resistant to aquatic pathogens as described in claim 1 in the preparation of Vibrio alginolyticus inhibitors.

9. The application of a genetically engineered algae resistant to aquatic pathogens according to claim 1 in the preparation of Vibrio parahaemolyticus inhibitors.

Images