Culture medium for improving accumulation amount of secondary metabolites of transgenic engineering material and application of culture medium

Abstract

The invention relates to the technical field of plant culture, in particular to a culture medium for increasing the accumulation amount of secondary metabolites of a transgenic engineering material and application of the culture medium. The invention provides a culture medium for increasing the accumulation amount of plant secondary metabolites. The culture medium comprises a basic culture medium, sucrose and inositol, the concentration of sucrose in the culture medium is 5-60g / L; the concentration of inositol in the culture medium is 100 to 600mg / L; the pH value of the culture medium is 5.7 to 5.9; the basic culture medium comprises an MS liquid culture medium. The culture medium provided by the invention can improve the cell wall thickness of a culture and increase the biomass of the culture, so that the storage capacity of the culture on secondary metabolites (such as anthocyanin) is improved, the purpose of increasing the accumulation amount of the secondary metabolites is achieved, and the culture medium can be used for plant cell culture and other aspects. Compared with the traditional culture medium, the culture medium provided by the invention has the advantages of basically no difference in cost and no difference in preparation method.

Description

[0001] This invention is an application filed on September 20, 2024, with application number 202411316991.4 and titled "A Culture Medium for Increasing the Accumulation of Secondary Metabolites in Transgenic Engineering Materials and Its Application," claiming full priority in China. Technical Field

[0002] This invention relates to the field of plant culture technology, and in particular to a culture medium and its application for increasing the accumulation of secondary metabolites in transgenic engineering materials. Background Technology

[0003] Plant secondary metabolites are non-essential small-molecule organic compounds produced by plants during growth and development. These substances do not directly participate in the basic growth processes of plants, but many plant secondary metabolites are sources of important drugs (such as anthocyanins). Therefore, increasing the yield of plant secondary metabolites can improve the economic value of plants.

[0004] Although genetic engineering can introduce genes that express plant secondary metabolites into plants, thereby increasing the yield of plant secondary metabolites, excessive accumulation of plant secondary metabolites can inhibit plant growth. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides a culture medium and its application for increasing the accumulation of secondary metabolites in transgenic engineering materials. The culture medium provided by this invention can increase the cell wall thickness and biomass of the culture, thereby increasing its storage capacity for secondary metabolites (such as anthocyanins), achieving the goal of increasing the accumulation of secondary metabolites.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] This invention provides a culture medium for increasing the accumulation of plant secondary metabolites, comprising a basal culture medium, sucrose, and inositol; the concentration of sucrose in the culture medium is 5-60 g / L; the concentration of inositol in the culture medium is 100-600 mg / L; the pH value of the culture medium is 5.7-5.9; the basal culture medium includes MS liquid medium.

[0008] Preferably, the concentration of sucrose in the culture medium is 25-35 g / L; and the concentration of inositol in the culture medium is 200-500 mg / L.

[0009] The present invention provides the application of the culture medium described above in increasing the accumulation of secondary metabolites and / or biomass of transgenic engineering materials, wherein the transgenic engineering materials include transgenic plant cell cultures that produce secondary metabolites.

[0010] Preferably, the plant includes tobacco, Arabidopsis thaliana, petunia, ginseng, strawberry, snapdragon, cabbage, potato, carrot, corn, or rice; the secondary metabolite includes anthocyanins.

[0011] Preferably, the transgenic plant cell culture comprises plant suspension cells and hairy roots.

[0012] This invention provides a method for increasing the accumulation of secondary metabolites and / or biomass of transgenic engineering materials, comprising the following steps:

[0013] The transgenic engineering material is inoculated into the culture medium described in the above technical solution and cultured in the dark; the transgenic engineering material includes transgenic plant cell cultures that produce secondary metabolites.

[0014] Preferably, the temperature for the dark culture is 15–50°C, the relative humidity is 10%–90%, and the rotation speed is 10–300 rpm.

[0015] Preferably, the temperature for the dark culture is 25–30°C, the relative humidity is 50%–70%, and the rotation speed is 100–150 rpm.

[0016] Preferably, the transgenic plant cell culture comprises plant suspension cells and hairy roots.

[0017] Preferably, the plant suspension cells are obtained from plant tissue culture; the hairy roots are obtained by Agrobacterium-mediated induction.

[0018] Beneficial effects:

[0019] This invention provides a culture medium for increasing the accumulation of plant secondary metabolites, comprising a basal medium, sucrose, and inositol; the concentration of sucrose in the medium is 5–60 g / L; the concentration of inositol in the medium is 100–600 mg / L; the pH value of the culture medium is 5.7–5.9; the basal medium includes MS liquid medium. The culture medium provided by this invention can increase the cell wall thickness of the culture, increase the biomass of the culture, and increase cell tolerance, thereby increasing its storage capacity for secondary metabolites (such as anthocyanins), achieving the purpose of increasing the accumulation of secondary metabolites. It can be used in many aspects such as plant cell culture. The culture medium provided by this invention is essentially the same in cost and preparation method as traditional culture media. Furthermore, the method provided by this invention uses the same culture conditions as traditional methods; culturing with a suitable culture medium can significantly increase the biomass of plant cell cultures, thereby increasing the accumulation of secondary metabolites. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0021] Figure 1 Results of biomass and anthocyanin content of plant cell cultures cultured in media with different inositol concentrations for 30 days. Detailed Implementation

[0022] This invention provides a culture medium for increasing the accumulation of plant secondary metabolites, comprising a basal culture medium, sucrose, and inositol; the concentration of sucrose in the culture medium is 5-60 g / L; the concentration of inositol in the culture medium is 100-600 mg / L; the pH value of the culture medium is 5.7-5.9; the basal culture medium includes MS liquid medium.

[0023] As an embodiment of the present invention, the concentration of sucrose in the culture medium is 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 g / L; and the concentration of inositol in the culture medium is 100, 120, 140, 160, 180, 200, 250, 300, 400, 500, or 600 mg / L.

[0024] The present invention provides the application of the culture medium described above in increasing the accumulation of secondary metabolites and / or biomass of transgenic engineering materials, wherein the transgenic engineering materials include transgenic plant cell cultures that produce secondary metabolites.

[0025] As an embodiment of the present invention, the plant may be tobacco, Arabidopsis thaliana, petunia, ginseng, strawberry, snapdragon, cabbage, potato, carrot, corn or rice; the secondary metabolite may be anthocyanin.

[0026] As an embodiment of the present invention, the transgenic plant cell culture can be plant suspension cells and hairy roots; the plant suspension cells are obtained by plant tissue culture, and the plant suspension cells can be BY-2 cells; the hairy roots are obtained by Agrobacterium-mediated induction, and the induction culture conditions can be 110 rpm, 28°C, 60% humidity, and dark culture.

[0027] This invention provides a method for increasing the accumulation of secondary metabolites and / or biomass of transgenic engineering materials, comprising the following steps:

[0028] The transgenic engineering material is inoculated into the culture medium described in the above technical solution and cultured in the dark; the transgenic engineering material includes transgenic plant cell cultures that produce secondary metabolites.

[0029] As an embodiment of the present invention, the temperature of the dark culture is 15-50°C, the relative humidity is 10%-90%, and the rotation speed is 10-300 rpm.

[0030] As an embodiment of the present invention, the temperature of the dark culture is 25-30°C, the relative humidity is 50%-70%, and the rotation speed is 100-150 rpm.

[0031] As an embodiment of the present invention, the temperature of the dark culture is 27°C, the relative humidity is 60%, and the rotation speed is 110 rpm.

[0032] As an embodiment of the present invention, the transgenic plant cell culture can be plant suspension cells and hairy roots; the plant suspension cells are obtained by plant tissue culture; and the hairy roots are obtained by Agrobacterium-mediated induction.

[0033] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, describes a culture medium for increasing the accumulation of secondary metabolites in transgenic engineering materials and its application, but these descriptions should not be construed as limiting the scope of protection of the present invention.

[0034] Example 1

[0035] Induction of plant tissues.

[0036] 1. Experimental materials.

[0037] Sterile seedlings of snapdragon.

[0038] Rinse the wild-collected snapdragon seeds twice with sterile water, discard the unripe seeds on the top layer, rinse with 75% alcohol for 2 min, rinse three times with sterile water, vortex with 5% NaClO for 5 min, rinse five times with sterile water, inoculate onto MS medium, incubate at 25℃ for 16 h light / 8 h dark, and when the sterile seedlings have 6-8 leaves, use them for hairy root induction.

[0039] 2. Experimental reagents.

[0040] MS medium, sucrose, agar, pCambia1301-GUS vector (purchased from Newp Biotechnology), and Agrobacterium rhizogenes MSU440 (purchased from Weidi Biotechnology).

[0041] 3. Instruments and Equipment

[0042] Balance (Sartorius Scientific Instruments, SQP), plant incubator (Shanghai Yiheng Scientific Instruments Co., Ltd.), laminar flow hood (Suzhou Antai Air Technology Co., Ltd., SW-CJ-2FD), autoclave (Shanghai Boneng Instruments Co., Ltd., CT-90B), alcohol lamp, tissue culture flask, pipette, pipette tip, sealing film, rubber band, petri dish.

[0043] 4. Experimental Preparation

[0044] MS medium: Weigh 4.74g MS medium, 30g sucrose, and 8g agar, add water to a final volume of 1L, adjust the pH to 5.8, and sterilize at 121℃ for 30min.

[0045] YEB medium: Weigh 5g beef extract, 5g peptone, 1g yeast extract, 5g sucrose, and 4g MgSO4·7H2O, add water to make up to 1L, adjust the pH to 7.4, and sterilize at 121℃ for 30min.

[0046] Carbenicillin stock solution (CB): To prepare a 100 mg / mL stock solution, weigh 5 g of carbenicillin powder, add sterile water to a final volume of 50 mL, filter through a 0.22 μm aqueous filter membrane for sterilization, dispense, and store at 4 °C.

[0047] Time: To prepare a 100 mg / mL stock solution, weigh 5 g of timeridine powder, add sterile water to a final volume of 50 mL, filter through a 0.22 μm organic filter membrane for sterilization, dispense, and store at 4 °C.

[0048] Acetyleugenol (AS) stock solution: To prepare a 100 mmol / L stock solution, weigh 0.981 g of AS powder, dissolve with DMSO, bring the volume to 50 mL with sterile water, filter through a 0.22 μm organic filter membrane for sterilization, dispense into individual containers, and store at 4 °C.

[0049] Co-culture medium: Weigh 4.74 g MS medium, 30 g sucrose, and 8 g agar, add water to a final volume of 1 L, adjust the pH to 5.8, and sterilize at 121 °C for 30 min. After sterilization, wait until the medium temperature is suitable, add 100 μmol / L LAS, mix well, and pour into plates.

[0050] Sterilized culture medium: Weigh 4.74g MS medium, 30g sucrose, and 8g agar, add water to a final volume of 1L, adjust the pH to 5.8, and sterilize at 121℃ for 30min. After sterilization, wait until the medium temperature is suitable, then add 200mg / L Time and 200mg / L CB, mix well, and pour into plates.

[0051] 5. Experimental Design.

[0052] Sterile snapdragon seedling stem segments were infected with Agrobacterium rhizogenes to induce hairy roots, and the induction conditions for anthocyanin-producing hairy roots were screened.

[0053] 6. Experimental methods and procedures.

[0054] 6.1 Activation of bacterial strains.

[0055] Agrobacterium rhizogenes strain stored in the laboratory at -80℃ was inoculated into YEB liquid medium in a clean bench and incubated in the dark at 28℃ with a shaking speed of 200 rpm for 16 hours. After 16 hours of incubation, 1 mL of the strain was inoculated into YEB liquid medium in the clean bench and incubated in the dark at 28℃ with a shaking speed of 200 rpm for 4–6 hours until the bacterial culture reached the logarithmic growth phase (OD). 600 =0.2~0.8), for use in infection.

[0056] 6.2 Infection

[0057] In a clean bench, sterile scissors were used to cut 0.5cm stem segments from the cultured sterile seedlings. Wounds were treated with an inoculation needle. Different explants were infected with activated Agrobacterium rhizogenes for 5 minutes, with constant shaking to ensure complete contact between the Agrobacterium and the stem segment wounds. Excess bacterial solution was absorbed with sterile filter paper, and then the explants were inoculated onto a co-culture medium and cultured in the dark at 25°C for 2 days.

[0058] 6.3 Sterilization culture

[0059] The co-cultured explants were transferred to sterile medium and cultured in the dark at 25°C for 10 days to develop roots. The induced hairy roots (2-3 cm long) were cut off with sterile scissors and inoculated into sterile medium. Every week, they were transferred to fresh sterile medium until they were completely sterile (1-2 months). Then, the hairy roots were transferred to MS liquid medium for proliferation culture.

[0060] 6.4 Screening and overexpression of anthocyanin-inducing factors

[0061] A vector (pCambia1301) was constructed using the MYBA1 gene as the overexpression gene. The constructed vector was then transformed into Agrobacterium rhizogenes and infected plant explants. The infection method was the same as that used for inducing hairy roots of aseptic snapdragon seedlings to obtain transgenic hairy roots that stably express the MYBA1 gene.

[0062] The nucleotide sequence of the MYBA1 gene is shown in SEQ ID NO.1: atggacatagttccattgggagtgagaaagggtgcttggactgaggaagaagactgtcttctcaagaagtgcattgagaagcatggagaggggaagtggcaccaagttccttacagggcaggattgaatagatgcaggaaaagttgtaggctgagatggttgaattatctgaggccaaatataaagagaggaaattttgctgtggatgaagttgatctcattatcaggcttcataagctgctaggcaatagatggtcgttaattgcgggtagacttccaggaagaacatcgaacgacgtgaaaaattactggaatacccatctgaaagagaaatcaacggaccaaagtggagaggtacagaaatctaaaacgaccctgaatacgactgaaaggaccacaatcatacggcctcaaccacgaaccttctccaaaaatcgacatgttttgatgggtagtaatgtcattgcagataatattcaaacaagagatccaaatctctccaacccatcccaaacacaaccaccgggggatgatgatggaacattgtggtgggatgacatgttgttcgattatgaaattagcagaggtatgatgacgtggaccaatgacggatcaaatgaggaggccatgatggtggataacggtgaagaagcaaaatcaggtacacaaggagctggtggggatcgttacagttgtgttcaagaagatcagagtgattggagtaacatttttatggacaatgtggacctttgggatattttaggtgatgaacaagcagtactgtaa。

[0063] Results of the experiment.

[0064] 7.1 Induction of hairy roots from aseptic seedlings of Antirrhinum majus.

[0065] Table 1 Induction results

[0066] Explants (individuals) Number of rooted explants (individuals) Induction rate (%) GUS positivity rate in hairy roots (%) 22 8 36.36363636 100

[0067] Table 1 shows that *Agrobacterium rhizogenes* MSU440 has a strong ability to infect the stem segments of sterile *Snapdragon* seedlings, with high OD values ​​in the bacterial solution. 600 The inoculum was 0.6 μL for 5 min, co-cultured for 2 days to remove bacteria, and hairy roots could be induced after 10 days. The induction time was short and the induction efficiency was high, which can produce anthocyanin hairy roots in a short time and achieve a large-scale proliferation of experimental materials.

[0068] 7.2 Screening and overexpression of anthocyanin-inducing factors.

[0069] A vector (based on pCambia1301 as the basic plasmid) was constructed using the MYBA1 gene as the target gene. This vector was then transformed into Agrobacterium rhizogenes MSU440 and used to infect plant explants, thereby inducing anthocyanin production in the hairy roots of snapdragon stem segments. This method yields hairy roots quickly; after 2 days of co-culturing to remove bacteria, red hairy roots producing anthocyanins can be obtained after 10 days, demonstrating high induction efficiency (hairy roots can be obtained from 100 explants).

[0070] Example 2

[0071] 1.1 Materials and Reagents

[0072] Plant cell cultures were prepared using MS medium supplemented with sucrose and different concentrations of inositol. The preparation process of these plant cell cultures was as follows:

[0073] Tobacco-derived BY-2 cells and hairy roots from Example 1 were inoculated into the culture medium and cultured under the following conditions: 110 rpm, 28°C, 60% humidity, and in the dark for 24 h. The inoculation amounts of BY-2 cells and hairy roots were 1 g / 100 mL and 1 g / 100 mL, respectively. The basal medium of the culture medium was MS medium, which also contained only the following components: 30 g / L sucrose and 0.2 mg / L 2,4-D.

[0074] 1.2 Main Instruments

[0075] Sterilizer, shaker, and clean bench.

[0076] 1.3 Culture medium and culture conditions

[0077] Culture medium: MS medium was supplemented with 30 g / L sucrose and different concentrations (0, 100, 160, 180, 200, 250, 300, 350, 400, 450, 500, 550, 600 mg / L) of inositol. The pH was adjusted to 5.8 ± 0.1 with 1 mol / L potassium hydroxide. After sterilization, the medium was aliquoted for use. Culture conditions: 27℃, 60% relative humidity, 110 rpm, incubation in the dark.

[0078] 1.4 Experimental Methods

[0079] 1.4.1 Inoculation of plant cell cultures

[0080] Plant cell cultures with consistent growth status were selected, and the same amount of biomass was inoculated into culture media with different inositol contents. The cultures were incubated at 27°C, 110 rpm, and 60% relative humidity in the dark.

[0081] 1.4.2 Biomass Detection

[0082] Plant cell cultures cultured for the same period (30 days) were placed on filter paper to absorb excess culture medium, weighed, and their biomass growth rate was calculated.

[0083] 1.4.3 Anthocyanin content detection

[0084] National Standard (NY / T 2640-2014) HPLC Detection Method.

[0085] See results Figure 1 And Table 2.

[0086] Table 2 Biomass and anthocyanin content of plant cell cultures cultured in media with different inositol concentrations after 30 days.

[0087] Inositol content (mg / L) Biomass (g / L) Biomass error value Anthocyanin content (g / L) Anthocyanin content error value 0 3.33 0.43 0.44572 0.03761 100 3.42 0.398 0.4769 0.01729 160 3.14 0.38 0.426485 0.02976 180 3.21 0.41 0.4771799 0.08348 200 4.87 0.33 0.4042324 0.04238 250 2.92 0.25 0.4209201 0.05625 300 7.98 0.51 0.92561278 0.06143 350 6.11 0.49 0.76909 0.05952 400 4.89 0.32 0.45255 0.05967 450 4.77 0.52 0.47132 0.04154 500 3.75 0.37 0.40348 0.0457 550 3.72 0.34 0.44935 0.05817 600 3.69 0.38 0.45298 0.03126

[0088] Depend on Figure 1 As shown in Table 2, the culture medium provided by the present invention can increase the biomass of the culture, thereby increasing its storage capacity for secondary metabolites (such as anthocyanins), and achieving the purpose of increasing the accumulation of secondary metabolites.

[0089] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A culture medium for increasing the accumulation of plant secondary metabolites, characterized in that, The medium includes a basal culture medium, sucrose, and inositol; the concentration of sucrose in the culture medium is 5–60 g / L; the concentration of inositol in the culture medium is 100–600 mg / L; the pH value of the culture medium is 5.7–5.9; the basal culture medium includes MS liquid medium.

2. The culture medium according to claim 1, characterized in that, The concentration of sucrose in the culture medium is 25–35 g / L; the concentration of inositol in the culture medium is 200–500 mg / L.

3. The use of the culture medium according to claim 1 or 2 in increasing the accumulation of secondary metabolites and / or biomass of transgenic engineering materials, wherein the transgenic engineering materials include transgenic plant cell cultures that produce secondary metabolites.

4. The application according to claim 3, characterized in that, The plants include tobacco, Arabidopsis thaliana, petunia, ginseng, strawberry, snapdragon, cabbage, potato, carrot, corn, or rice; the secondary metabolites include anthocyanins.

5. The application according to claim 3, characterized in that, The transgenic plant cell culture includes plant suspension cells and hairy roots.

6. A method for increasing the accumulation of secondary metabolites and / or biomass of transgenic engineering materials, characterized in that, Includes the following steps: The transgenic engineered material is inoculated into the culture medium of claim 1 or 2 and cultured in the dark; the transgenic engineered material includes transgenic plant cell cultures that produce secondary metabolites.

7. The method according to claim 6, characterized in that, The dark culture temperature is 15–50°C, the relative humidity is 10%–90%, and the rotation speed is 10–300 rpm.

8. The method according to claim 7, characterized in that, The dark culture temperature is 25–30°C, the relative humidity is 50%–70%, and the rotation speed is 100–150 rpm.

9. The method according to claim 6, characterized in that, The transgenic plant cell culture includes plant suspension cells and hairy roots.

10. The method according to claim 9, characterized in that, The plant suspension cells were obtained from plant tissue culture; the hairy roots were obtained by Agrobacterium-mediated induction.

Images