Use of trichoderma chitinase ech2 and mutants thereof for inhibiting plant pathogenic fungi

Abstract

The present application relates to the field of agricultural biotechnology, and in particular to the application of Trichoderma chitinase ech2 and its mutants for inhibiting plant pathogenic fungi. The present application determines that the protein with the amino acid sequence shown in SEQ ID NO: 2 is a chitinase, and the chitinase ech2 exhibits excellent temperature adaptability and pH stability. Experiments show that the activity of the enzyme is significantly improved in the range of 20-35 DEG C, and reaches the peak activity at 35 DEG C; the enzyme maintains high activity in a wide range of pH 4-9, and the optimum pH is 5.5. The storage stability is good, the application range is wide, and the growth of plant pathogenic fungi Botrytis cinerea and Fusarium oxysporum is inhibited. The optimum temperature of the improved chitinase mutant ech2-1 is 45 DEG C, which is increased by 10 DEG C compared with the original ech2; the ech2-1 is stable at 4 DEG C-40 DEG C, and is suitable for development as an agricultural chitinase.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of agricultural biotechnology, and in particular to the application of Trichoderma chitinase ech2 and its mutants for inhibiting plant pathogenic fungi. BACKGROUND

[0002] Fungal diseases are an important factor affecting crop yield and quality. Chitin, as a structural polysaccharide of fungal cell walls, is an ideal antifungal target. Chitinase (EC 3.2.1.14) can specifically hydrolyze the β-1,4 glycosidic bond in chitin. Chitinase is a large family, and according to its amino acid sequence and catalytic mechanism, it is mainly divided into two families: GH18 family and GH19 family. In addition, the type and functional diversity of chitinase, endochitinase randomly cuts the glycosidic bond inside the chitin chain, which is the most critical step to destroy the structural integrity of the fungal cell wall. Only this type of enzyme can effectively and directly inhibit fungal growth. Whether a chitinase can effectively inhibit fungi depends on the strength of enzyme activity, substrate accessibility, synergy, and other related factors. Therefore, it is very important to mine high-activity, antifungal chitinases for agricultural applications. Chitinase specifically catalyzes the hydrolysis of N-acetyl-β-D-glucosamine glycosidic bonds in chitin to produce N-acetyl-β-D-glucosamine. Cellulase specifically acts on polymers composed of glucose units through β-1,4-glycosidic bonds to produce glucose.

[0003] Microbial-derived chitinases (such as Trichoderma Trichoderma , Bacillus Bacillus , etc.) have been shown to have antagonistic effects on a variety of plant pathogenic fungi, and have broad application potential in the fields of agriculture, biological control, and medicine. Trichoderma harzianum, as an important biocontrol fungus, can secrete multiple chitinases and has a significant inhibitory effect on plant pathogenic fungi. SUMMARY

[0004] The purpose of the present application is to provide the application of Trichoderma chitinase ech2 for inhibiting the plant pathogenic fungus Botrytis cinerea.

[0005] According to the technical solution of the present application, the Trichoderma harzianum chitinase gene ech2 has the nucleotide sequence shown in SEQ ID NO: 1.

[0006] SEQ ID NO: 1:

[0007]

[0008] The Trichoderma harzianum chitinase has an amino acid sequence as shown in SEQ ID NO: 2.

[0009] SEQ ID NO: 2:

[0010] MSGDGYRSVAYFVNWAIYARKHRPQDLPVDKLTHILYAFANVRQDSGEVHMTDGWADTDIHWEGDSWNDTGNNMYGCLKQLNLLKKRNRNLKVLLSIGGWTYSGNFKGPASTQQGRETFAKSSLELLKNLGFDGLDIDWEYPQNADEARNFVELLATVRRELDAYSATLPTYSHFELTVACPAGATHFQKLDVPGMDQYLDFWNLMAYDYAGSWDQTSGHQANLHPSSDNPTSTPFSTDAAIDFYTRSGVAPSKIVLGMPIYGRAFENTDGPGRPYNGIGEGSWENGIFDYKVLPHPGSQEIWDRATGASYSYNPQTRKLVSYDTPHASRAKAGYIKEWGLGGGMWWESSGDKEGPDSLIGIVVNEFGGPGALQRKDNCIDYPQSKYDNLKNGFPNN.

[0011] According to the technical scheme of the present application, the mutant of the Trichoderma harzianum chitinase gene ech2 has a nucleotide sequence as shown in SEQ ID NO: 3. ech2-1

[0012] SEQ ID NO: 3:

[0013] ​

[0014] The Trichoderma harzianum chitinase mutant ech2-1 has the amino acid sequence shown in SEQ ID NO: 4.

[0015] SEQ ID NO: 4:

[0016] MSGDGYRSVAYFVNWAIYARKHRPQDLPVDKLTHILYAFANVRQDSGEVHLTDGWADTDIHWEGDSWNDTGNNMYGCLKQLNLLKKRNRNLKVLLSIGGWTYSGNFKGPASTQQGRETFAKSSLELLKNLGFDGLDIDWEYPQNADEARNFVELLATVRRELDAYSATLPTPSHFELTVACPAGATHFQKLDVPGMDQYLDFWNLMAYDYAGSWDQTSGHQANLHPSSDNPTSTPFSTDAAIDFYTRSGVAPSKIVLGMPIYGRAFENTDGPGRPYNGIGEGSWENGIWDYKVLPHPGSQEYWDRATGASYSYDPQTRKLVSYDTPHAARAKAGYIKEWGLGGGMWWESSGDKEGPDSLIGIVVNEFGGPGALQRKDNCIDYPQSKYDNLKAGFPNN.

[0017] The present application has positive and beneficial effects:

[0018] The present application determines that the protein with the amino acid sequence shown in SEQ ID NO: 2 is chitinase, and the chitinase ech2 exhibits excellent temperature adaptability and pH stability. Experiments show that the activity of the enzyme is significantly improved in the range of 20-35℃, and the peak activity is reached at 35℃; the enzyme maintains high activity in a wide range of pH 4-9, and the optimum pH is 5.5. The storage stability is good, the application range is wide, and the growth of the plant pathogenic fungi Botrytis cinerea and Fusarium oxysporum is inhibited. The optimum temperature of the improved chitinase mutant ech2-1 is 45℃, which is increased by 10℃ than the original ech2; ech2-1 is stable at 4℃-40℃, and is suitable for development as an agricultural chitinase. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 For the present application ech2 Gene cloning electrophoresis result map, wherein M1: DNA standard molecular weight DL5000; 2: PCR product;

[0020] Figure 2SDS-PAGE detection results of expressed chitinase, M: color pre-stained protein marker, 1-2: chitinase ech2;

[0021] Figure 3 Temperature curve of chitinase enzyme activity;

[0022] Figure 4 Temperature stability curve of chitinase;

[0023] Figure 5 pH curve of chitinase enzyme activity;

[0024] Figure 6 pH stability curve of chitinase;

[0025] Figure 7 Inhibition of chitinase on plant pathogenic fungus Botrytis cinerea, wherein, A: the effect of chitinase ech2 on detached cucumber leaves, 1: Botrytis cinerea; 2: Botrytis cinerea + chitinase, B: the effect of chitinase ech2 on liquid fermentation of Botrytis cinerea, 3: Botrytis cinerea; 4: Botrytis cinerea + chitinase;

[0026] Figure 8 Inhibition of chitinase on plant pathogenic fungus Fusarium oxysporum, wherein, A: the effect of chitinase ech2 on liquid fermentation of Fusarium oxysporum, B: microscope photos of chitinase ech2 on Fusarium oxysporum;

[0027] Figure 9 Enzyme activity comparison of chitinase mutants;

[0028] Figure 10 Optimum temperature of chitinase mutant ech2-1;

[0029] Figure 11 Temperature stability of chitinase mutant ech2-1.

[0030] Figure 12 Comparison of fungistatic effect of chitinase mutant ech2-1 and ech2. DETAILED DESCRIPTION

[0031] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments of the present application.

[0032] Example 1: Cloning and sequence determination of chitinase ech2 gene

[0033] Total RNA of Trichoderma harzianum LTR-2 was extracted, and chitinase ech2The primer pairs for the nucleotide sequence are:

[0034] SEQ ID No:5:5'- agcaaatgggtcgcggatcc ATGTCGGGAGACGGCTATCGTTCA-3', SEQ IDNo:6: tggtggtggtggtgctcgag TTAGTTGTTTGGGAATCCATTCTT, respectively, introduce portions of homologous recombination with the vector (indicated by underline).

[0035] After PCR, the sample was subjected to 1% agarose gel electrophoresis. Figure 1 Chitinase was used to recover the target DNA fragment using a DNA gel extraction kit. ech2 Gene. Using restriction endonuclease B amHI and X ohI The vector pET28a(+) was double-digested, and the purified product was recovered and homologous recombination was performed to obtain the recombinant plasmid pET28a-ech2. Sequencing confirmed that the cloned gene sequence was correct.

[0036] Example 2: Expression of chitinase gene

[0037] The recombinant plasmid obtained in Example 1 was transformed into... E.coli Fast-T1 was screened by colony PCR and sequenced to obtain the clone strain 28a-ech2-Fast-T1. This was heat-shock transformed into the expression strain BL21(DE3) and cultured overnight at 37°C to obtain the recombinant expression strain Ech2-Bl21(DE3). The recombinant expression strain Ech2-Bl21(DE3) was inoculated into LB liquid medium (with 50 μg / mL kanamycin) and cultured overnight at 35°C and 200 rpm. A 1% inoculum was then added to 100 mL of LB medium (with 50 μg / mL kanamycin) and cultured at 35°C until OD (Organic Dry Index) was reached. 600 =Approximately 0.7, add IPTG inducer (final concentration 1 mM), and induce culture at 16 ℃ for 16 h. The induced expression of *E. coli* bacterial culture was centrifuged at 12000 rpm for 2 min, and the bacterial cells were collected. The cells were resuspended in citrate-sodium dihydrogen phosphate buffer, sonicated for approximately 30 min, and the supernatant was collected by centrifugation to obtain crude chitinase solution. The crude chitinase solution was purified using a His-tag column. The purified recombinant protein solution was subjected to SDS-PAGE, yielding a single protein band of approximately 43.7 kDa (e.g., ...). Figure 2 (As shown), the concentration is around 1 mg / mL.

[0038] Example 3: Determination of chitinase activity

[0039] Chitinase enzyme activity determination: 10 g / L colloidal chitin as substrate, chitinase enzyme activity of chitinase ech2 prepared in Example 2 was determined; 200 μL substrate (pH 6) was taken, 100 μl chitinase pure enzyme solution was added, and after 30 min reaction in 35°C water bath, 100 μL DNS reagent was added, and boiled in boiling water for 5 min; centrifuged at 12000 rpm for 10 min, and the supernatant was determined for absorbance at 540 nm with equal amount of citric acid-disodium hydrogen phosphate (100 mM, pH 6) as blank control; the definition of enzyme activity unit (U) is: the amount of enzyme that decomposes 1 umol N-acetyl-D-glucosamine per hour is one enzyme activity unit (U). It was determined that chitinase ech2 has endochitinase activity; the enzyme activity of purified ech2 is 61.3 U / mg.

[0040] Example 4: Enzymatic properties of chitinase

[0041] The enzymatic properties of chitinase of Example 2 were determined, including optimum temperature, optimum pH, temperature stability, pH stability, and enzyme activity determination with 1% colloidal chitin as substrate.

[0042] 4.1 Optimum temperature: the reaction system included 200 μL of 1% colloidal chitin and 100 μL chitinase pure enzyme solution; the pH value was 6 (citric acid-sodium dihydrogen phosphate, 100 mM); the reaction was carried out at 4°C, 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, 60°C, 70°C, and 80°C temperature gradient range for 0.5 h, with inactivated crude enzyme solution as blank; after the reaction was completed, the enzyme was inactivated by boiling in boiling water bath for 10 min, 750 μl DNS was added to the reaction system, and boiled in boiling water for 5 min, then the absorbance was determined at 540 nm to determine the enzyme activity of chitinase at different temperatures; according to the relative enzyme activity of the enzyme at different temperatures, a curve was drawn to determine the optimum reaction temperature of chitinase; for example, 540 Figure 3 The optimum reaction temperature of chitinase ech2 is 35°C.

[0043] 4.2 Optimum pH: the substrate was 1% colloidal chitin, and the enzyme activity was determined in buffer solution with pH value of 2-11; the reaction system was the same as that of the optimum reaction temperature test, and the reaction temperature was 35°C; according to the relative activity of the enzyme at different pH values, a curve was drawn, for example, Figure 4 The optimum reaction pH value of chitinase ech2 is 5.5.

[0044] ​4.3 Temperature stability study: Chitinase pure enzyme solution was incubated at different temperatures (4°C, 20°C, 30°C, 35°C, 40°C) for 0, 10, 20, 30, 40, 50, 60 min, respectively, and the residual enzyme activity was detected at 35°C for 30 min, and compared with the untreated enzyme activity to calculate the relative enzyme activity; the results are shown in Figure 5 ; the results show that chitinase ech2 has certain tolerance to temperature, and has good thermal stability at 4-30°C, and the remaining activity is maintained at more than 95% after 1 h of reaction.

[0045] 4.4 pH stability: Chitinase pure enzyme solution was placed in 100 mM buffer solution with different pH (2.0, 3.0, 4.0, 5.0, 6.0, 6.5, 7.0, 8.0, 9.0, 10.0, 11.0) at 30°C for 1 h, and then the residual enzyme activity was detected at the optimum reaction temperature (30°C), and the untreated enzyme activity was used as a blank control to calculate the relative enzyme activity, as shown in Figure 6 ; chitinase ech2 has high pH tolerance, and the enzyme activity is maintained at more than 50% after 1 h of incubation at pH 4.0-9.0.

[0046] Example 5: Study on the antifungal activity of chitinase ech2

[0047] The antifungal activity of purified ech2 was measured by mycelial growth inhibition test; a puncher with a diameter of 5 mm was used to cut a bacterial cake from the edge of a well-grown Botrytis cinerea colony, and the bacterial cake was inoculated in the center of the left and right parts of a cucumber leaf, and 50 μL of chitinase liquid of Example 2 was dropped on the right half of the bacterial cake, and 100 mM citric acid-sodium dihydrogen phosphate buffer was used as a control (CK); after 3 days of culture, the mycelial growth inhibition rate (GI) was calculated according to the following formula: GI=(R-r) / R×100%, wherein R and r respectively refer to the average diameter of the fungal mycelium on the control plate and the experimental plate; as shown in Figure 7 , 0.05 mg / mL chitinase ech2 inhibited the growth of the plant pathogenic fungus Botrytis cinerea, and the inhibition rate was 100%. In addition, after 3 days of culture by adding 0.05 mg / mL chitinase liquid in liquid potato medium, Botrytis cinerea hardly grew, and the biomass of Fusarium oxysporum was significantly reduced (as shown in Figure 7 , B of Figure 8 , A), Figure 8 , B under a microscope, the mycelium added with chitinase liquid was broken and bent, showing obvious inhibition effect.

[0048] Example 6: Design of chitinase ech2 mutant with improved enzyme activity

[0049] In order to further improve the enzyme activity and temperature stability of the chitinase, the original chitinase sequence was taken as a target, mutation was carried out, a mutant gene was synthesized, and a chitinase mutant of Trichoderma harzianum ech2-1 The amino acid sequence of the chitinase mutant is shown as SEQ ID NO: 4, based on the parent, 6 sites were mutated, specifically as follows: M51L, Y172P, F289W, I302Y, N314D, and S329A. The synthesized gene was subjected to heterologous expression in E. coli, and the mutant protein was purified by affinity chromatography.

[0050] The enzyme activity determination method of the ech2 mutant: 10 g / L colloidal chitin was used as a substrate, 200 μL of the substrate (pH 6) was taken, 100 μL of the chitinase pure enzyme solution was added, and the reaction was carried out in a water bath at 45℃ for 30 min; the remaining steps were the same as the determination of the enzyme activity of the chitinase ech2. The enzyme activity of the purified ech2-1 was 134.9 U / mg, which was 2.2 times that of the control ( Figure 9 ); the determination method of the optimal temperature was the same as that of the ech2-1, the optimal temperature of the chitinase ech2-1 was increased to 45℃, which was 10℃ higher than that of the original ech2 ( Figure 10 ); temperature stability: the chitinase pure enzyme solution was incubated at different temperatures (4℃, 20℃, 30℃, 35℃, 40℃, 45℃) for 0, 10, 20, 30, 40, 50, and 60 min, respectively, the residual enzyme activity was detected after 30 min of reaction at 45℃, and compared with the untreated enzyme activity, the relative enzyme activity was calculated; the ech2-1 had good stability at 4℃-40℃ ( Figure 11 ), and was suitable for development as an agricultural chitinase.

[0051] Example 7: Study on the antifungal activity of the chitinase ech2 mutant with improved enzyme activity

[0052] The sterile puncher with a diameter of 5 mm was used to take the bacterial cake with a uniform thickness (about 2 mm) from the edge of the activated culture plate colony of Botrytis cinerea. The mother liquor (1 mg / mL) of the purified chitinase ech2 and its mutant ech2-1 was gradient diluted, and 100 μL of enzyme solution was used to treat the cucumber leaves, and the final enzyme addition amount of each leaf was 0, 2.5, 5, 10, 15, 25, 50 and 100 mg, respectively. The treatment method was as follows: the left side of the leaf was inoculated with ech2, the right side was inoculated with ech2-1, and the blank control without enzyme was set. Each concentration treatment was set with 3 repeated culture dishes. All the culture dishes were placed in a low temperature incubator with a constant temperature of 20°C~22°C and a relative humidity of 85%~90% for constant temperature culture for 4 days. Under the condition of the same protein addition amount (≤25 mg), the inhibition rate of the mutant ech2-1 was significantly higher than that of the wild type ech2. For example, when the addition amount was 15 mg, the inhibition rates of ech2 and ech2-1 were 75.3% and 96.0%, respectively Figure 12 ).

[0053] The above is only a preferred specific embodiment of the present application, but the protection scope of the present application is not limited thereto, any person skilled in the art can make equivalent replacement or change according to the technical scheme and the inventive concept of the present application within the technical range disclosed by the present application, which should be covered in the protection scope of the present application.

Claims

1. Use of a Trichoderma chitinase for inhibiting plant pathogenic fungi, characterized in that, The amino acid sequence of the Trichoderma chitinase is shown in SEQ ID NO: 2 or SEQ ID NO: 4, and the plant pathogenic fungus is Botrytis cinerea or Fusarium oxysporum.

2. A Trichoderma chitinase mutant characterized in that, The amino acid sequence of the Trichoderma chitinase mutant is shown in SEQ ID NO: 4.

Images