QTL gene for regulating and controlling fusarium graminearum stem rot resistance of corn, KASP molecular marker and application

Abstract

The invention belongs to the technical field of molecular markers, and particularly relates to a QTL gene for regulating and controlling maize fusarium graminearum stem rot resistance, a KASP molecular marker and application of the QTL gene and the KASP molecular marker. A maize high-disease-resistance inbred line H1710 and a high-susceptibility inbred line Huangzao 4 are used for constructing an F2 group, and high-disease-resistance and high-susceptibility samples are selected from the F2 group for constructing a mixed pool for BSA-seq analysis; in combination with bioinformatics analysis, molecular markers and fine positioning, a stable QTL gene for controlling the resistance of the fusarium graminearum stem rot of the corn is positioned from the sixth chromosome bin6.01 of the corn. On the basis, the invention provides a corn genome region capable of improving the corn stem rot resistance and a corresponding DNA (Deoxyribose Nucleic Acid) fragment thereof. In addition, the invention also provides a nuclear KASP molecular marker linked with the QTL locus. After the molecular marker is screened and verified, the SNP molecular marker provided by the invention can be used for efficiently and quickly identifying the genotype of a to-be-detected corn material and screening a stem rot resistant material.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to a QTL gene, KASP molecular marker and its application for regulating resistance to Fusarium graminearum stalk rot in maize. Background Technology

[0002] Maize (Zea mays L.) plays a crucial role in the national economy and agricultural production. Maize stalk rot is a soil-borne disease common in maize-producing regions worldwide and a major disease in Chinese maize production, occurring in all planting areas of the country. Stalk rot is caused by various fungi and bacteria; more than 30 pathogenic fungi have been reported. In China, the main pathogens of stalk rot are *Pythium inflatum* and *Pythium graminicola*, belonging to the class Oomycetes; Fusarium species are typically *Fusarium verticillioides* and *Fusarium graminearum*.

[0003] Since various factors, such as pathogen type, environmental conditions, and plant growth status, influence the development of stalk rot symptoms, genetic resistance to stalk rot in maize can be divided into two categories: qualitative and quantitative traits. Currently, most identified stalk rot resistance loci show low effects, and relatively few maize stalk rot resistance genes have been cloned. Therefore, further in-depth exploration of maize stalk rot resistance QTLs and genes, and the development of linked KASP molecular markers for maize stalk rot resistance are needed to provide strong support for the aggregation of multiple resistance genes in molecular breeding for stalk rot resistance. Summary of the Invention

[0004] To address the problems existing in the prior art, this invention provides a QTL gene, a KASP molecular marker, and their application for regulating maize resistance to Fusarium graminearum stalk rot. It provides a KASP molecular marker linked to maize stalk rot resistance, which can strongly support the aggregation of multiple resistance genes in molecular breeding for stalk rot resistance.

[0005] The specific technical solution adopted in this invention is as follows:

[0006] A QTL gene that regulates resistance to Fusarium graminearum stalk rot in maize, wherein the QTL gene is a DNA fragment located on maize chromosome 6, referring to the Zm-B73-REFERENCE-NAM-5.0 genome, and the DNA fragment contains the nucleotide sequence of positions 6635940-7187832 on maize chromosome 6.

[0007] The KASP molecular markers of the QTL gene include molecular marker SNP2 and molecular marker SNP10. Molecular marker SNP2 is located at position 6640608 on maize chromosome 6 and its nucleotide is T or G; SNP10 is located at position 7185874 on maize chromosome 6 and its nucleotide is A or G.

[0008] The primer set for the KASP molecular marker, and the primer set for the SNP2 molecular marker, include:

[0009] F1: GAAGGTCGGAGTCAACGGATTGCACGCAGAGGCATCAGT;

[0010] F2: GAAGGTGACCAAGTTCATGCTCACCGCAGAGGCATCAGG;

[0011] R: GTGTCGAACACGTCGTTGATA;

[0012] The primer set for the molecular marker SNP10 includes:

[0013] F1: GAAGGTCGGAGTCAACGGATTGTCGCGTACAGGGGCAC;

[0014] F2: GAAGGTGACCAAGTTCATGCTGTCGCGTACAGGGGCAT;

[0015] R:GTCGGCGGCCATGAAC.

[0016] The application of primer sets in detecting resistance to Fusarium graminearum stalk rot in maize, and the method of application are as follows:

[0017] S1. Extracting genomic DNA from maize;

[0018] S2. For the genomic DNA extracted in step S1, use primer sets with molecular marker SNP2 or molecular marker SNP10 to detect the polymorphism of SNP molecular markers, and determine the stalk rot resistance of the maize to be tested based on the detection results.

[0019] A maize breeding method, based on the application of primer sets in detecting maize resistance to Fusarium graminearum stalk rot, selects maize samples with resistance to Fusarium graminearum stalk rot for subsequent breeding.

[0020] The beneficial effects of this invention are:

[0021] This invention utilizes a highly resistant maize inbred line H1710 and a highly susceptible inbred line Huangzaosi to construct an F2 population. Highly resistant and highly susceptible samples were selected from this population and subjected to BSA-seq analysis. Combined with bioinformatics analysis, molecular markers, and fine mapping, a stable QTL gene controlling resistance to Maize Fusarium graminearum stalk rot was located at bin6.01 on maize chromosome 6. Based on this, this invention provides a maize genomic region and its corresponding DNA fragment that can enhance resistance to Maize stalk rot. Furthermore, this invention also provides a nuclear KASP molecular marker linked to the aforementioned QTL site. Screening and verification of the molecular markers confirmed that the SNP molecular markers provided by this invention can efficiently and rapidly identify the genotype of maize materials and screen for stalk rot-resistant materials. Attached Figure Description

[0022] Figure 1 This is a flowchart illustrating the molecular marker development process in an embodiment of the present invention;

[0023] Figure 2 This is the genotyping result of the marker SNP2 in the sample in this embodiment of the invention;

[0024] Figure 3 This is the genotyping result of the marker SNP10 in the sample in this embodiment of the invention;

[0025] Figure 4 These are field photos showing the artificial inoculation identification of the highly disease-resistant inbred line H1710 and the highly disease-susceptible parental inbred line Huangzaosi in this embodiment of the invention.

[0026] Figure 5 These are field photos of samples artificially inoculated for identification in embodiments of the present invention. Detailed Implementation

[0027] The present invention will be further described below with reference to the accompanying drawings and specific embodiments:

[0028] Specific implementation examples Figure 1As shown, this invention utilizes a highly resistant maize inbred line H1710 and a highly susceptible inbred line Huangzaosi as parents to obtain the first-generation hybrid F1. The F1 hybrids are then self-crossed to construct the F2 population. Through precise phenotypic identification of maize stalk rot in the field, extreme phenotypes of highly resistant and highly susceptible individuals are selected. Equal amounts of DNA from the highly resistant and highly susceptible individuals are mixed to construct a pool for BSA-seq analysis. Combined with bioinformatics analysis, molecular markers, and fine mapping, a stable QTL locus controlling resistance to Maize Fusarium graminearum stalk rot was located in the bin6.01 region of maize chromosome 6. Subsequently, a KASP molecular marker was developed to further narrow down the resistance region. Based on this, this invention provides a maize genome region and its corresponding DNA fragment that can improve maize stalk rot resistance. Furthermore, this invention also provides a nuclear KASP molecular marker linked to the aforementioned QTL gene locus. Screening and verification of the molecular markers confirmed that the SNP molecular markers provided by this invention can efficiently and rapidly identify the genotype of maize materials to be tested and screen for stalk rot resistant materials.

[0029] Specifically, the present invention provides the following technical solutions:

[0030] This invention provides a QTL gene that regulates resistance to maize stalk rot. The QTL gene is a DNA fragment located on maize chromosome 6. Referring to the Zm-B73-REFERENCE-NAM-5.0 genome, the DNA fragment contains the nucleotide sequence of positions 6635940-7187832 on maize chromosome 6.

[0031] In some embodiments of the present invention, the QTL gene regulating maize stalk rot resistance is located between 6635940 and 7187832, with a physical distance of 551.89 kb; the developed linkage molecular markers are SNP2 located at position 6640608 on maize chromosome 6, with nucleotides T or G; and SNP10 located at position 7185874 on maize chromosome 6, with nucleotides A or G.

[0032] In some embodiments of the present invention, the primers in the molecular marker SNP2 and molecular marker SNP10 primer sets are respectively connected to FAM and VIC fluorescent linker sequences.

[0033] In this invention, the stem rot disease is preferably Fusarium graminearum stem rot.

[0034] The method for detecting maize resistance to Fusarium graminearum stalk rot using the above-mentioned SNP molecular markers includes the following steps:

[0035] S1. Extracting genomic DNA from maize;

[0036] S2. Perform polymorphism detection of the SNP molecular markers on the genomic DNA extracted in step S1, and determine the stalk rot resistance of the maize to be tested based on the detection results.

[0037] In some embodiments of the present invention, preferably, in step S2, the SNP molecular marker is detected using KASP (competitive allele-specific PCR) technology.

[0038] A maize breeding method includes the following steps: using the above-mentioned genotype detection method, selecting samples with resistance to Fusarium graminearum stalk rot for subsequent breeding.

[0039] According to some embodiments of the present invention, the following effects are achieved: The present invention utilizes specific SNP molecular markers linked to maize resistance to Fusarium stalk rot, including molecular markers SNP2 and SNP10, and combines them with KASP detection technology to rapidly, accurately, and efficiently identify maize stalk rot resistant materials and accelerate the breeding of new maize stalk rot resistant varieties.

[0040] This invention provides KASP molecular marker information related to maize stalk rot resistance, as shown in Table 1 below:

[0041]

[0042] like Figure 2 As shown, the results of the genotyping of the molecular marker SNP2 in donor and recipient samples are as follows: red represents the TT genotype (resistant), purple represents the GG genotype (susceptible), and green represents the heterozygous TG genotype.

[0043] like Figure 3 As shown, the results of SNP10 genotyping in donor and recipient samples are presented. Red indicates the GG genotype (susceptible), purple indicates the AA genotype (resistant), and green indicates the heterozygous GA genotype.

[0044] like Figure 4 The image shows the results of artificial inoculation identification of the highly resistant inbred line H1710 and the highly susceptible parental inbred line Huangzaosi in an embodiment of the present invention. The four images on the left are Huangzaosi (HS), which are highly susceptible inbred lines with an average disease severity of 8.9. The four images on the right are H1710 (HR), which are highly resistant inbred lines with an average disease severity of 1.6.

[0045] The Huangzao 4 (HS) sample showed that the corn stalks were withered and yellow, and the internal tissues were severely necrotic, even leading to complete necrosis of the stalks; the H1710 (HR) sample showed that the corn stalks remained green, the lesions were light, and the overall structure was basically intact, demonstrating better resistance.

[0046] Figure 5To select representative field samples for stem rot disease manifestations using KASP molecular markers, genotyping results are detailed below. Figure 2 The field phenotypes were basically consistent with the molecular marker typing results.

Claims

1. A QTL gene regulating resistance to Fusarium stalk rot in maize, characterized in that: The QTL gene is a DNA fragment located on chromosome 6 of maize. Referring to the Zm-B73-REFERENCE-NAM-5.0 genome, the DNA fragment contains the nucleotide sequence of positions 6635940-7187832 on chromosome 6 of maize.

2. The KASP molecular marker for the QTL gene as described in claim 1, characterized in that: The KASP molecular markers include molecular marker SNP2 and molecular marker SNP10. Molecular marker SNP2 is located at position 6640608 on maize chromosome 6 and its nucleotide is T or G; SNP10 is located at position 7185874 on maize chromosome 6 and its nucleotide is A or G.

3. The primer set of the KASP molecular marker as described in claim 2, characterized in that: The primer set for the molecular marker SNP2 includes: F1: GAAGGTCGGAGTCAACGGATTGCACGCAGAGGCATCAGT; F2: GAAGGTGACCAAGTTCATGCTCACCGCAGAGGCATCAGG; R: GTGTCGAACACGTCGTTGATA; The primer set for the molecular marker SNP10 includes: F1: GAAGGTCGGAGTCAACGGATTGTCGCGTACAGGGGCAC; F2: GAAGGTGACCAAGTTCATGCTGTCGCGTACAGGGGCAT; R:GTCGGCGGCCATGAAC.

4. The application of the primer set as described in claim 3 in detecting resistance to Maize Fusarium stalk rot, characterized in that: The application method is as follows: S1. Extracting genomic DNA from maize; S2. For the genomic DNA extracted in step S1, use primer sets with molecular marker SNP2 or molecular marker SNP10 to detect the polymorphism of SNP molecular markers, and determine the stalk rot resistance of the maize to be tested based on the detection results.

5. A maize breeding method, based on the application described in claim 4, characterized in that: Select maize samples with resistance to Fusarium graminearum stalk rot for subsequent breeding.

Images