Method for improving the root regeneration capacity of plants and use thereof

Abstract

The application discloses a method for improving the root regeneration ability of plants and application thereof, and belongs to the technical field of plant genetic engineering. Solyc06g059760 SEU1 Solyc06g059750 SEU2 It is first proved by the application that overexpression of the genes in tomatoes can significantly improve the root regeneration ability of the tomatoes. The finding provides a new research tool for revealing the molecular mechanism of plant root regeneration, and the technical idea can be popularized to various crops with regeneration difficulties, which is helpful for constructing an efficient genetic transformation system and promoting the process of crop genetic improvement.​​​

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to a method for improving the root regeneration capacity of plants and its application. Background Technology

[0002] Roots, as key organs for plants to absorb water and nutrients and sense environmental signals, directly determine the survival rate of seedlings, their growth and development, and their stress resistance, playing a vital role in plant growth, reproduction, and industrial applications. Root regeneration and bud regeneration are important topics in plant organ regeneration research, representing two distinct developmental processes with significant differences in origin, regulatory mechanisms, functions, and purposes. In plant in vitro culture, transgenic breeding, and industrialized seedling production, problems such as low root regeneration efficiency, long regeneration cycles, and strong genotype dependence are prevalent, becoming core bottlenecks restricting the large-scale application of plant molecular breeding technologies.

[0003] Current technologies for enhancing plant root regeneration largely rely on optimizing culture medium formulations (such as adjusting the ratio of auxin and cytokinin) or adding exogenous growth regulators. These methods suffer from drawbacks such as complex operation, high cost, unstable regeneration effects, and a tendency to cause seedling malformation, failing to overcome the fundamental limitations of root regeneration regulation at the molecular level. With the development of molecular biology techniques, regulating the expression of root development-related genes through genetic engineering has become a key direction for solving the root regeneration problem. Currently, it has been discovered that… WOX, PLT, ARF Gene families such as [names of genes involved in plant root regeneration, but specific to] SEU ( SEUSS The function and application of family genes in plant root regeneration have not been systematically reported. It is urgent to explore their potential value in root regeneration regulation and provide new molecular targets and technical pathways for improving plant root regeneration efficiency. Summary of the Invention

[0004] In view of the above-mentioned prior art, the purpose of this invention is to provide a method for improving the root regeneration ability of plants and its application. This invention has found that by overexpressing… SEU Family-specific genes can significantly enhance plant root regeneration efficiency, providing a new solution for the construction of efficient plant breeding and genetic transformation systems.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A first aspect of the present invention provides a method for improving the root regeneration capacity of plants, comprising the following steps:

[0007] plants SEU1 Genes and / or SEU2 Gene overexpression;

[0008] Or, increase the concentration in plants SEU1 Genes and / or SEU2 The content of gene-encoded proteins;

[0009] The SEU1 Genes are nucleic acid molecules as shown in i) or ii) below:

[0010] i) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.1;

[0011] ii) Nucleic acid molecules other than those in i) encoding the amino acid sequence shown in SEQ ID NO. 3;

[0012] The SEU2 Genes are nucleic acid molecules as shown in iii) or iv) below:

[0013] iii) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.2;

[0014] iv) DNA molecules other than iii) encoding the amino acid sequence shown in SEQ ID NO.4.

[0015] In the above method, SEU1 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.3; SEU2 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.4.

[0016] In the above method, the plant SEU1 Genes and / or SEU2 The substance overexpressed is any one of the following:

[0017] C1) contains EU1 Genes and / or SEU2 Gene expression cassettes;

[0018] C2) contains EU1 Genes and / or SEU2 Recombinant vectors of genes, or recombinant vectors containing the expression cassette described in C1);

[0019] C3) contains EU1 Genes and / or SEU2 Recombinant microorganisms containing genes, or recombinant microorganisms containing the expression cassette described in C1), or recombinant microorganisms containing the recombinant vector described in C2).

[0020] In some preferred embodiments of the present invention, the plant SEU1 Genes and / or SEU2 The methods for gene overexpression are as follows:

[0021] Constructing SEU1 Genes and / or SEU2 Gene recombination vectors;

[0022] The recombinant vector is introduced into plant cells, tissues, or organs to obtain... SEU1 Genes and / or SEU2 Plant transformants with overexpressed genes;

[0023] The plant transformants were cultured into regenerated plants to enhance root regeneration capacity.

[0024] Existing plant expression vectors can be used to construct structures containing... SEU1 Genes and / or SEU2 Recombinant vectors for genes. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors that can be used for plant micro-bombardment.

[0025] use SEU1 Genes and / or SEU2 When constructing a recombinant vector for gene expression, any type of enhancing promoter, constitutive promoter, or root tissue-specific promoter can be added before its transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the ubiquitin promoter of maize. These can be used alone or in combination with other plant promoters. In addition, when constructing a plant expression vector using the gene of the present invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used.

[0026] Preferably, the overexpression vector is introduced into plant cells, tissues or organs using Agrobacterium-mediated transformation, gene gun method or protoplast transformation method.

[0027] In a preferred embodiment of the present invention, an Agrobacterium-mediated method is used to [dispose of / contain / contain / etc.] Agrobacterium-mediated [method / etc.] EU1 Genes and / or SEU2 Recombinant microorganisms are co-cultured with plant explants such as cotyledons, hypocotyls, or leaves, and positive transformed tissues are obtained through resistance selection.

[0028] Preferably, the culture conditions for plant transformants are as follows: callus is induced on MS medium containing 30-50 mg / L kanamycin. After the callus differentiates into shoots, it is transferred to rooting medium containing 0.1-0.5 mg / L naphthaleneacetic acid and cultured at 23-25℃ under 16h light / 8h dark conditions to promote root regeneration.

[0029] In the above method, the plant is a plant of the Solanaceae family, a plant of the Brassicaceae family, or a plant of the Poaceae family; preferably a plant of the Solanaceae family, including but not limited to: tomato, eggplant, pepper, etc.

[0030] This invention first discovered that: by overexpressing in plants SEU1 Gene, SEU2 One or two of the genes can increase the root regeneration rate, shorten the root regeneration cycle, or increase the number of regenerated roots in plants.

[0031] A second aspect of the invention provides the application of a method for improving plant root regeneration capacity in plant tissue culture and / or the construction of plant genetic transformation systems.

[0032] The method for improving plant root regeneration based on the present invention can be widely applied to seedling propagation and tissue culture where root regeneration is difficult, and can be efficiently applied to the root regeneration stage in industrialized propagation of plant seedlings and transgenic breeding, significantly improving the efficiency of plant genetic transformation and seedling production.

[0033] The beneficial effects of this invention are:

[0034] (1) This invention is the first to confirm that the SEU gene family SEU1 , SEU2 Genes have the function of regulating plant root regeneration. Overexpression of these genes can significantly improve the plant root regeneration rate, providing a novel molecular target for the regulation of plant root regeneration and filling a gap in the field. SEU The application of genes in the field of plant root regeneration is currently lacking.

[0035] (2) This invention directly regulates through genetic engineering. SEU1 or SEU2 Gene expression does not rely on the optimization of exogenous hormone combinations, avoiding problems such as unstable regeneration effect and seedling deformity in traditional methods. It is also simple to operate, low in cost, and can be stably applied to plants of different families, genera and genotypes. It has wide applicability and provides technical support for the seedling propagation of a variety of plants with difficult regeneration.

[0036] (3) The overexpression vector and genetically engineered bacteria constructed based on the present invention can be efficiently applied to the root regeneration stage in the industrialized propagation of plant seedlings and transgenic breeding, significantly improving the efficiency of plant genetic transformation and seedling production. It has important practical application value for promoting the development of plant improvement technology in the agricultural field, ensuring crop production and ecological vegetation restoration. Attached Figure Description

[0037] Figure 1: SEU1 , SEU2 Schematic diagram of gene overexpression vector construction; where A represents... SEU1 Gene overexpression vector structure, B is... SEU2 Gene overexpression vector structure.

[0038] Figure 2: Wild-type plants and SEU1 , SEU2Comparison of root regeneration phenotypes in plants overexpressing the gene; where A represents the root regeneration phenotype after 10 days of culture, and from left to right, wild-type (WT). SEU1 Overexpression lines ( SlSEU1-OE-1 ), SEU1 Overexpression lines ( SlSEU1-OE-3 ), SEU2 Overexpression lines ( SlSEU2-OE-7 ), SEU2 Overexpression lines ( SlSEU2-OE-10 B represents the root regeneration rate statistics; the error bar represents the standard deviation, and ** indicates a significant difference (P<0.01). Detailed Implementation

[0039] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0040] As mentioned earlier, plant root regeneration and shoot regeneration are two distinct developmental processes. Existing technologies for enhancing plant root regeneration capacity mostly rely on optimizing culture medium formulations (such as adjusting the ratio of auxin and cytokinin) or adding exogenous growth regulators. Such methods have drawbacks such as complex operation, high cost, unstable regeneration effect, and easy to cause seedling malformation.

[0041] In view of this, the present invention is the first to discover that: through overexpression SEU1 or SEU2 Genes were used to obtain transgenic plants. SEU Transgenic plants with overexpressed genes can significantly improve root regeneration efficiency without the addition of exogenous hormones, solving the problems of unstable root regeneration effect and seedling malformation that exist in traditional hormone regulation methods. They have broad application prospects, hence this invention.

[0042] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0043] The experimental materials used in the embodiments of this invention, unless otherwise specified, are all conventional experimental materials in the art and can be purchased through commercial channels. Where specific experimental conditions and methods are not specified in the embodiments of this invention, conventional conditions are generally followed, such as those described in J. Sambrook et al., eds., *Molecular Cloning: A Laboratory Manual* (3rd Edition), Science Press, 2002; and D.L. Spector et al., eds., *Cellular Laboratory Experiments*, Science Press, 2001; or the conditions recommended by the manufacturer. Wherein:

[0044] Tomato variety AC, also known as tomato variety Ailsa CraigAlso known as wild-type tomato, it comes from the Tomato Genetic Resource Center of the United States (TGRC, http: / / tgrc.ucdavis.edu / ), with the number LA2838A.

[0045] MS co-culture medium: 100 mL MS solid medium, 175 µL 1 g / L zeatin (ZT), and 100 µL 1 g / L auxin (IAA).

[0046] MS screening medium: 100 mL MS solid medium, 175 µL 1 g / L zeatin (ZT), 100 µL 1 g / L auxin (IAA), 150 µL 75 g / L kanamycin (Kan), and 100 µL 200 g / L termethin (Tim).

[0047] Rooting medium: 100 mL MS solid medium, 100 µL of 50 g / L kanamycin (Kan), and 100 µL of 200 g / L termetine (Tim).

[0048] Example 1: SEU1 , SEU2 Construction of gene overexpression vectors

[0049] 1. Total RNA extraction and cDNA synthesis from tomatoes: Total RNA was extracted from leaves of wild-type tomato seedlings (variety Ailsa Craig) using the Trizol method, and cDNA was synthesized using a reverse transcription kit (TaKaRa PrimeScript RT Reagent Kit) as a template for amplification.

[0050] 2. SEU target gene amplification: based on SEU1 (Solyc06g059760) SEU2 Design specific primers for the (Solyc06g059750) gene sequence. The primer sequences are as follows:

[0051] SEU1-F: TACAAAAAAGCAGGCTTCCTCGAGATGGTTCCAACAGGGCCTCCTAATTCACTTGGAGG; (SEQ ID NO.5)

[0052] SEU1-R: GTACAAGAAAGCTGGGTTGAATTCAGGAGATGTTTTCCAGTCAAACTGAAGGTTG. (SEQ ID NO.6)

[0053] SEU2-F: TACAAAAAAGCAGGCTTCCTCGAGATGGTTCCAACAGGACCTCCTAATCCAATTGGAGG; (SEQ ID NO.7)

[0054] SEU2-R: GTACAAGAAAGCTGGGTTGAATTCAGGAGAAGTTTTCCAGTCAAACTGCAGGTTGTTAA. (SEQ ID NO.8)

[0055] Using tomato cDNA as a template, PCR amplification was performed using high-fidelity DNA polymerase (KOD-Plus-Neo). The amplification conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 62℃ annealing for 30 s, 72℃ extension for 1.5 min, for 35 cycles; and 72℃ final extension for 10 min.

[0056] 3. Vector construction: The vector obtained from PCR amplification... SEU1 , SEU2 The gene fragment and the PK7FWG2 vector were double-digested with EcoRI and XhoI, respectively. The digestion products were recovered by agarose gel electrophoresis and then ligated with homologous recombinase at 50°C for 30 min to obtain the recombinant vector. SlSEU1-OE , SlSEU2-OE .

[0057] 4. Vector Validation: The recombinant vector was transformed into E. coli DH5α competent cells. Positive clones were obtained through resistance selection (LB medium containing 50 mg / L spectinomycin). Plasmids were extracted for PCR amplification and sequencing verification to ensure that the SEU gene sequence was correct and the insertion direction was correct. Figure 1 ).

[0058] Example 2: Contains SEU Preparation of recombinant Agrobacterium for overexpression vector

[0059] 1. Preparation of Agrobacterium competent cells: Agrobacterium LBA4404 strain was inoculated into LB liquid medium (containing 50 mg / L rifampin) and cultured at 28℃ with shaking at 200 rpm until OD... 600 =0.5-0.6, incubate on ice for 30 min, centrifuge at 4℃ and 5000 rpm for 5 min, discard the supernatant, resuspend the bacterial cells in pre-cooled 0.1 mol / L CaCl2 solution to prepare competent cells.

[0060] 2. Vector transformation: Take 10 μL of the recombinant vector constructed in Example 1 ( SlSEU1-OE or SlSEU2-OE)Add 50 μL of Agrobacterium competent cells, incubate on ice for 30 min, flash freeze in liquid nitrogen for 5 min, incubate in water at 37℃ for 5 min, add 800 μL of LB liquid medium, and culture at 28℃ with shaking at 150 rpm for 2 h. Take 200 μL of bacterial culture and spread it on LB solid medium containing 50 mg / L spectinomycin and 50 mg / L rifampin. Incubate at 28℃ for 2-3 days. Pick single colonies for PCR identification to obtain positive recombinant Agrobacterium.

[0061] Example 3: Agrobacterium-mediated tomato SEU Gene overexpression transformation

[0062] 1. Preparation of tomato explants: Wild-type tomato seeds were disinfected with 75% alcohol for 30 seconds, 2% sodium hypochlorite solution for 10 minutes, rinsed with sterile water 5-6 times, and sown on 1 / 2 MS medium. They were cultured at 25℃ under 16h light / 8h dark conditions for 7-10 days. Cotyledons or hypocotyls were then cut off as explants.

[0063] 2. Agrobacterium infection and co-culture: Positive recombinant Agrobacterium was inoculated into LB liquid medium (containing 50 mg / L kanamycin and 50 mg / L rifampin) and cultured at 28°C with shaking at 200 rpm until OD. 600 Centrifuge at 5000 rpm for 10 min at 0.6-0.8, then resuspend the cells in MS liquid medium to OD0.6. 600 =0.3-0.4; Immerse tomato explants in bacterial solution for 10-15 min, blot dry the surface bacterial solution with sterile filter paper, transfer to MS co-culture medium containing 2 mg / L 2,4-D, and co-culture at 23℃ in the dark for 2-3 days.

[0064] 3. Resistance selection and plant regeneration: Explants co-cultured were transferred to MS selection medium containing 50 mg / L kanamycin and 200 mg / L cephalosporin to induce callus formation. Once the callus differentiated into shoots (approximately 2-3 weeks), the shoots were excised and transferred to rooting medium containing 0.2 mg / L naphthaleneacetic acid. The plants were cultured at 25°C under 16 h light / 8 h dark conditions until the root system was fully developed, yielding the desired plant. SEU Tomato regenerated plants with overexpressed genes.

[0065] Example 4: Test of Tomato Root Regeneration Capacity

[0066] 1. Experimental materials:

[0067] Wild-type tomatoes (WT) and the tomato strain constructed in Example 3 were selected. SEU1Overexpression lines ( SEU1-OE-1 , SEU1-OE- 3 ), SEU2 Overexpression lines ( SEU2-OE-7 , SEU2-OE-10 Seedlings of uniform growth were selected from each strain, and their cotyledons were cut off as explants for testing.

[0068] 2. Root regeneration culture:

[0069] Explants were inoculated into MS medium without exogenous hormones and cultured in the dark. Root regeneration rate was calculated after 10 days of culture (root regeneration rate = number of explants with regenerated roots / total number of explants × 100%).

[0070] 3. Results Analysis:

[0071] like Figure 2 As shown, after 10 days of cultivation, the root regeneration rate of wild-type tomatoes was 70%; while SlSEU1-OE-1 , SlSEU1- OE-3 , SlSEU2-OE-7 , SlSEU2-OE-10 The root regeneration rates of the strains were 82.6%, 84.1%, 82.5%, and 83.7%, respectively. The results indicate that overexpression... SEU1 or SEU2 The gene can significantly improve the root regeneration efficiency of tomatoes, further verifying the application value of the SEU gene in enhancing the root regeneration ability of plants.

[0072] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A method for improving the root regeneration capacity of plants, characterized in that, Includes the following steps: plants SEU1 Genes and / or SEU2 Gene overexpression; Or, increase the concentration in plants SEU1 Genes and / or SEU2 The content of gene-encoded proteins; The SEU1 Genes are nucleic acid molecules as shown in i) or ii) below: i) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.1; ii) Nucleic acid molecules other than those in i) encoding the amino acid sequence shown in SEQ ID NO. 3; The SEU2 Genes are nucleic acid molecules as shown in iii) or iv) below: iii) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.2; iv) DNA molecules encoding the amino acid sequence shown in SEQ ID NO.4, except for iii); Specifically, improving the root regeneration capacity of plants means improving the root regeneration efficiency of plant explants under conditions without the addition of exogenous hormones. The plant in question is a tomato.

2. The method for improving plant root regeneration capacity according to claim 1, characterized in that, SEU1 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.3; SEU2 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.

4.

3. The method for improving plant root regeneration capacity according to claim 1, characterized in that, plants SEU1 Genes and / or SEU2 The substance overexpressed is any one of the following: C1) contains SEU1 Genes and / or SEU2 Gene expression cassettes; C2) contains SEU1 Genes and / or SEU2 Recombinant vectors of genes, or recombinant vectors containing the expression cassette described in C1); C3) contains SEU1 Genes and / or SEU2 Recombinant microorganisms containing genes, or recombinant microorganisms containing the expression cassette described in C1), or recombinant microorganisms containing the recombinant vector described in C2).

4. The method for improving plant root regeneration capacity according to claim 1 or 3, characterized in that, plants SEU1 Genes and / or SEU2 The methods for gene overexpression are as follows: Constructing SEU1 Genes and / or SEU2 Gene recombination vectors; The recombinant vector is introduced into plant cells, tissues, or organs to obtain... SEU1 Genes and / or SEU2 Plant transformants with overexpressed genes; The plant transformants were cultured into regenerated plants to enhance root regeneration capacity.

5. The method for improving plant root regeneration capacity according to claim 4, characterized in that, Overexpression vectors are introduced into plant cells, tissues, or organs using Agrobacterium-mediated transformation, gene gun method, or protoplast transformation method.

Images