Application of NtPPO gene in regulation and control of prodenia litura resistance of tobacco plant and tobacco plant

By constructing a recombinant vector of the NtPPO gene in tobacco plants and using CRISPR-Cas9 and RNAi technologies for gene editing, the problems of drug resistance and environmental pollution in the control of tobacco beet armyworm were solved. This achieved efficient regulation of tobacco plants' resistance to beet armyworm and has important potential for molecular breeding applications.

CN121046433APending Publication Date: 2025-12-02TOBACCO RESEARCH INSTITUTE OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES (QINGZHOU TOBACCO RESEARCH INSTITUTE OF CHINA NATIONAL TOBACCO COMPANY)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511242171.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-02
Publication Date
2025-12-02

AI Technical Summary

Technical Problem

Existing technologies for controlling tobacco beet armyworm have problems such as pesticide resistance, environmental pollution, and high costs. Furthermore, research on tobacco's own resistance mechanisms is weak, and there is a lack of targeted genes.

Method used

By identifying and constructing recombinant vectors for the NtPPO-4 and NtPPO-11 genes, gene editing was performed using CRISPR-Cas9 and RNAi technologies to achieve overexpression or knockout of tobacco plants, thereby enhancing or reducing their resistance to the beet armyworm.

Benefits of technology

It significantly enhances the resistance of tobacco plants to the beet armyworm and reduces the resistance of resistant plants, providing an efficient and environmentally friendly method for controlling the beet armyworm, and has important potential for molecular breeding applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121046433A_ABST
    Figure CN121046433A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of plant genes and breeding, in particular to application of an NtPPO gene in regulation and control of prodenia litura resistance of a tobacco plant and the tobacco plant. The gene is at least one of an NtPPO (N-Phosphate Polymerase)-4 gene and an NtPPO (N-Phosphate Polymerase)-11 gene. The base sequence of the NtPPO-4 gene is as shown in SEQ ID No. 1 (sequence identifier number 1); the base sequence of the NtPPO (N-type Phosphate Polymerase)-11 gene is as shown in SEQ ID No. 2. The regulation comprises that at least one of the NtPPO-4 gene and the NtPPO-11 gene is knocked out or reduced, so that the resistance of the tobacco plant to the prodenia litura is reduced. And through overexpression of at least one of the NtPPO-4 gene and the NtPPO-11 gene, the resistance of the tobacco plant to the prodenia litura is improved. The gene is subjected to single-gene or multi-gene overexpression in a tobacco plant, so that the resistance of the plant to prodenia litura can be greatly enhanced. The method has important significance and wide application prospect in the aspects of resistance mechanism research, molecular breeding and the like of prodenia litura.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant gene and breeding technology, specifically to the application of the NtPPO gene in regulating the resistance of tobacco plants to beet armyworm and the tobacco plant itself. Background Technology

[0002] Tobacco is susceptible to various pests during its growth, which can severely impact its yield and quality. Among these, the larvae of the tobacco beet armyworm (Spodoptera litura) feed on tobacco leaves, causing irregular damage or holes, and in severe cases, leaving only the veins. Currently, the control of the tobacco beet armyworm (Spodoptera litura) mainly relies on chemical pesticides, biological control, and agricultural measures, but all have significant limitations and are insufficient to meet the needs of sustainable agriculture.

[0003] The use of chemical pesticides has led to the development of resistance in many beet armyworms, such as a more than tenfold increase in resistance to cypermethrin. Furthermore, pesticide residues pollute soil and water sources, harming non-target organisms (such as bees and predatory insects). The use of chemical pesticides requires frequent application, approximately 3-5 times per season, increasing planting costs. In terms of products, pesticide residues in tobacco leaves may affect consumer health, which is inconsistent with the trend of green agriculture.

[0004] Biological control, such as using natural enemy insects (e.g., Trichogramma leptostroboides, Trichogramma pygmycin) or microbial agents (e.g., Bacillus thuringiensis Bt, nucleopolyhedrovirus NPV), is highly susceptible to environmental factors (temperature, humidity), with field efficacy of only 40%-60%. Furthermore, it takes 3-7 days to show effects, making it slow to respond to outbreaks of pests. The cost of breeding and releasing natural enemies is high, making it difficult to cover large planting areas.

[0005] Using crop rotation, removing crop residues from the field, or employing pheromone traps and light traps can only reduce the initial insect population, but cannot completely control the damage. Furthermore, these methods require a large labor force, resulting in high labor costs, making them unsuitable for large-scale planting.

[0006] Currently, commercially available tobacco varieties exhibit weak resistance to the beet armyworm, necessitating exogenous control measures. Reported beet armyworm resistance genes (such as the Bt gene and protease inhibitor genes) are mostly derived from other crops (cotton, maize), and their suitability in tobacco has not been fully validated. The potential of tobacco's own polyphenol oxidase (NtPPO) genes remains unexplored, particularly lacking research on specific resistance mechanisms against the beet armyworm.

[0007] The information disclosed in this background section is only intended to enhance the understanding of the background technology of this application and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0008] Currently, the control of the beet armyworm relies on chemical pesticides, but pesticide resistance and environmental pollution are becoming increasingly serious problems. Although the Bt gene is widely used in crops, its adaptability and long-term effectiveness in tobacco remain unclear. Furthermore, research on the tobacco's own resistance mechanism against the beet armyworm is weak, especially lacking key genes specifically targeting it. This invention, by identifying the tobacco NtPPO gene and constructing a highly efficient expression vector, achieves, for the first time, endogenous gene-driven resistance to the beet armyworm in tobacco, filling a technological gap. The technical solution of this invention is as follows: On one hand, this invention provides the application of the NtPPO gene in regulating the resistance of tobacco plants to the beet armyworm, wherein the gene is at least one of the NtPPO-4 gene and the NtPPO-11 gene. The base sequence of the NtPPO-4 gene is shown in SEQ ID No. 1. The base sequence of the NtPPO-11 gene is shown in SEQ ID No. 2. The regulation includes reducing the resistance of tobacco plants to the beet armyworm by knocking out or reducing at least one of the NtPPO-4 gene and the NtPPO-11 gene, and increasing the resistance of tobacco plants to the beet armyworm by overexpressing at least one of the NtPPO-4 gene and the NtPPO-11 gene.

[0009] On the other hand, the expression levels of at least one of the NtPPO-4 and NtPPO-11 genes in tobacco plants were reduced or knocked out. Specific target gene sequences (sgRNAs) were designed targeting specific homologous regions of the NtPPO-4 and NtPPO-11 genes, as shown in SEQ ID No. 3.

[0010] On the other hand, the expression level of at least one of the NtPPO-4 and NtPPO-11 genes in tobacco plants can be reduced by CRISPR-Cas9 or RNAi gene silencing technology.

[0011] On one hand, the present invention provides a recombinant vector for overexpressing the NtPPO gene, the recombinant vector containing nucleotide sequences as shown in SEQ ID No. 1 and / or SEQ ID No. 2.

[0012] On the other hand, the recombinant expression vector is an NtPPO4-OX and / or an NtPPO11-OX recombinant expression vector. The base sequence of the primer NtPPO-4F for constructing NtPPO4-OX is shown in SEQ ID NO. 4, and the base sequence of the primer NtPPO-4R is shown in SEQ ID NO. 5.

[0013] On one hand, the present invention provides an expression vector comprising a polynucleotide targeting the target site shown in SEQ ID No. 3 in at least one of the NtPPO-4 and NtPPO-11 genes, or a polynucleotide encoding an sgRNA of the sequence shown in SEQ ID NO. 3.

[0014] On the other hand, the expression vector is a CRISPR gene editing vector.

[0015] On the one hand, the present invention provides a kit comprising the above-described expression vector.

[0016] On the other hand, the present invention provides a tobacco plant resistant to the beet armyworm, wherein the tobacco plant contains at least one of the NtPPO-4 gene and the NtPPO-11 gene overexpressed.

[0017] On the other hand, this invention provides a method for cultivating tobacco plants resistant to the beet armyworm, comprising the following steps: Transforming the constructed overexpression vector into Agrobacterium using electroporation. Treating conventionally cultivated tobacco seeds with a 10% sodium hypochlorite solution for 10 min, then rinsing with sterile water, and sowing on 1 / 2 MS medium. After the seeds germinate and reach the 4-leaf stage, performing tobacco transgenic infection. Selecting healthy tobacco seedlings, cutting leaves into 1cm × 1cm pieces, infecting them with Agrobacterium infection solution for 15 min, then blotting off excess bacterial solution with sterile filter paper, spreading them evenly on tobacco differentiation medium, and co-culturing in the dark at 28℃ for 2-3 days. After the co-culturing stage, transferring the tobacco leaves to differentiation medium for further culture. When new buds begin to sprout on the leaf surface, transferring these new buds to a selection and rooting medium for further selection culture. After observing adventitious root formation and growth to approximately 1cm in length, subjecting the seedlings to a two-day hardening-off treatment; subsequently, transplanting them into nutrient soil for continued cultivation.

[0018] The beneficial effects achieved by this invention are as follows: This invention utilizes overexpression of the polyphenol oxidase gene family NtPPO-4 and / or NtPPO-11 in tobacco plants to significantly enhance resistance to the beet armyworm. Compared to the control group, the overexpressed tobacco plants showed double the resistance to the beet armyworm. Simultaneously, targeting the NtPPO-4 and / or NtPPO-11 genes to reduce or knock out single or multiple gene expression in tobacco plants significantly reduced the resistance of knockout plants to the beet armyworm. This research has significant implications and broad application prospects in the study of beet armyworm resistance mechanisms and molecular breeding. Attached Figure Description

[0019] The above and other objects, features and advantages of the present invention will become more apparent from the following description of embodiments of the invention with reference to the accompanying drawings, in which: Figure 1 This diagram illustrates the induced upregulation of the PPO gene in tobacco leaves after insect feeding treatment in an embodiment of the present invention (Note: 0h is the control before insect inoculation, 5h is 5 h after insect inoculation, and 9h is 9 h after insect inoculation). Figure 2 A schematic diagram of the overexpression vector constructed according to an embodiment of the present invention; Figure 3 A schematic diagram of the gene knockout vector constructed according to an embodiment of the present invention; Figure 4 This is a diagram illustrating the mutation site analysis of multi-gene knockout lines in an embodiment of the present invention. Figure 5 This is a statistical analysis chart of the weight of Spodoptera litura larvae after inoculating the multi-gene knockout mutant strains of the present invention with Spodoptera litura larvae. Figure 6 This is a diagram illustrating the leaf surface defects of the multi-gene knockout mutant strain after insect feeding, as described in an embodiment of the present invention. Figure 7 This is a statistical analysis chart of insect weight after inoculating the overexpression strain of the present invention with Spodoptera litura larvae; Figure 8 This is a diagram illustrating the leaf surface defects of the overexpression strains in this invention after insect feeding; Figure 9 This is a graph showing the PPO activity analysis in multi-gene knockout mutant lines and embodiments of the present invention; Figure 10 This is a graph showing the PPO activity analysis in the overexpression lines of this invention. Detailed Implementation

[0020] Hereinafter, embodiments of the present invention will be described with reference to the accompanying drawings. However, it should be understood that these descriptions are exemplary only and are not intended to limit the scope of the invention. In the following detailed description, numerous specific details are set forth to provide a thorough understanding of the embodiments of the invention for ease of explanation. However, it will be apparent that one or more embodiments may be practiced without these specific details. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concept of the invention.

[0021] The present invention will be further explained in conjunction with specific embodiments below. Unless otherwise stated, all reagents used in the following embodiments are commercially available reagents.

[0022] Example 1: Analysis of Insect-Induced Expression Patterns of the NtPPO Gene To understand the expression of the PPO gene in tobacco leaves after insect inoculation, tobacco plants were inoculated with beet armyworm larvae that had been starved for 1 hour. Then, tobacco leaves were selected before feeding, 5 hours after feeding, and 9 hours after feeding for quantitative PCR analysis.

[0023] Figure 1 This is an example of the expression analysis of the PPO gene before and after insect feeding in this invention.

[0024] like Figure 1 As shown, the expression levels of homologous genes NtPPO-4 and NtPPO-11 in tobacco leaves significantly increased over time after insect inoculation treatment, especially NtPPO-4. Therefore, we conducted further analysis on the resistance of NtPPO-4 and NtPPO-11 genes to the beet armyworm.

[0025] Example 2: Construction of gene overexpression vector The NtPPO gene, cloned from common cultivated tobacco, contains two homologous genes, NtPPO-4 (SEQ ID NO. 1) and NtPPO-11 (SEQ ID NO. 2). Based on the homology of these two NtPPO genes, the NtPPO-4 gene was selected to construct an overexpression vector, which was then used for tobacco transgenic analysis and identification for gene function analysis.

[0026] The NtPPO-4 gene (SEQ ID NO. 1) was inserted into a plant binary expression vector using homologous recombination to construct the NtPPO4-OX recombinant expression vector (e.g., ...). Figure 2 ).

[0027] The specific process is as follows: ① The NtPPO-4 gene was amplified using specific primers NtPPO-4F: ATGGCTTCTTCTTCTACTCTTCC (SEQ ID NO. 4); NtPPO-4R: TTAATAACAATCCTTAAGTTC (SEQ ID NO. 5). The PCR products were then recovered using purification kits. The expression vector was digested with BamH1 enzymes and purified using a gel extraction kit to obtain a linearized expression vector. A certain amount of the target gene PCR product and the linearized vector were mixed and incubated at 37℃ for recombination. ② Add 10 μL of reaction solution to 50 μL of DH5α competent cells, mix gently, and incubate on ice for 30 minutes. Heat shock at 42°C for 45 seconds, then quickly cool on ice for 2 minutes. Add 600 μL of SOD liquid medium and incubate at 37°C for 1 hour. Centrifuge at 4500 rpm for 2 minutes, collect the cells, spread evenly on LB solid medium, and incubate at 37°C. ③ Multiple clones from the transformation plate were selected to identify positive clones using colony PCR. Then, individual clones were selected and cultured in LB broth for plasmid extraction. The accuracy of the vector was further verified using plasmid PCR and sequencing.

[0028] Example 3 Construction of multi-gene editing vector Based on the homologous region of the NtPPO-4 genome sequence cloned in Example 2, a gene-editing-specific target sequence was designed, and a gRNA (guide RNA) sequence SEQ ID NO. 3 was synthesized. TACAAGTACCATCTATGAAA Figure 3 This is a schematic diagram of the gene knockout vector constructed according to an embodiment of the present invention.

[0029] A target site, SEQ ID NO. 3, was designed for the NtPPO-4 gene. The gRNA sequence fragment was then recombined into this CRISPR / Cas9 gene-editing vector containing an resistance tag. Figure 3 As shown.

[0030] Using this CRISPR / Cas9 gene editing vector system, the bases in the target sequence are edited to cause mutations in the coding sequences of the NtPPO-4 and NtPPO-11 genes, so that they cannot be expressed normally or the products expressed are not the original amino acid products, thereby achieving the purpose of knocking out these genes.

[0031] Example 4 Genetic transformation of tobacco Using electroporation, the plant overexpression vector and gene editing vector constructed in Examples 2 and 3 above were transformed into Agrobacterium EHA105, respectively.

[0032] Seeds of conventionally cultivated tobacco were treated with a 10% sodium hypochlorite solution for 10 minutes, then rinsed several times with sterile water and sown on 1 / 2 MS medium. After germination and reaching the 4-leaf stage, transgenic tobacco infection was performed using the leaf disc transformation method. Healthy tobacco seedlings were selected, and leaves were cut into approximately 1cm × 1cm pieces. These pieces were then immersed in Agrobacterium infection solution for 15 minutes. Excess bacterial solution was then blotted off with sterile filter paper, and the leaves were laid flat on tobacco differentiation medium and incubated in the dark at 28°C for 2–3 days.

[0033] After the co-culture phase, the tobacco leaves were transferred to a differentiation medium containing antibiotics for further culture. When new shoots began to emerge from the leaf surface, these new shoots were transferred to a selection and rooting medium for further selection. After adventitious roots were observed to form and grow to approximately 1 cm in length, a two-day hardening-off treatment was performed. They were then transplanted into nutrient soil for continued cultivation.

[0034] Example 5: Screening and Identification of Gene-Edited Lines Screening of positive transgenic seedlings Genomic DNA was extracted from T0 generation transgenic leaves using a kit. PCR was used to detect the presence of the Cas9 gene sequence in the genome and to determine if the knockout vector had been inserted into the transgenic plant's genome. The PCR products were then subjected to electrophoresis and sequencing for confirmation, yielding positive transgenic seedlings. The gene editing sites were then analyzed.

[0035] Editing mutation analysis of target sites Using genomic DNA from the leaves of positive transgenic seedlings as templates, the target gene sequences were amplified using the following primers: NtPPO-4-F (SEQ ID No. 6): CCACCAACTCATTTTTCTTTGC NtPPO-4-R (SEQ ID No.7): CACAATTACCCAAATCCGTAC NtPPO-11-F (SEQ ID No.8): CATCCCAGGTTCGGGAT NtPPO-11-R (SEQ ID No.9):CTTTTCTTCCTCCGCCG The editing activity of target sites was identified in the T1 generation plants. Gene editing events were detected at the target sites of both genes. The editing efficiency of each target site was determined based on the presence of editing events in the T1 generation (Table 1). Overall, the editing efficiency of the target sites was very high, with editing efficiencies of 60% and 66.7% in the two genes, respectively.

[0036] Table 1. Statistics on the editing of each target point in T1 generation plants

[0037] Figure 4 This is a diagram illustrating the mutation site analysis of multi-gene knockout strains in an embodiment of the present invention.

[0038] according to Figure 4 It can be seen that a single-base deletion mutation occurred in the coding sequences of both the NtPPO-4 and NtPPO-11 genes, and the two genes related to resistance to beet armyworm were effectively knocked out.

[0039] Example 6: Effect of NtPPO gene knockout plants on the body weight of the beet armyworm. Three transgenic tobacco plants and three control tobacco plants with similar growth were selected. The increase in body weight of the beet armyworm was used as the measurement index to examine the effects of overexpression lines, transgenic knockout tobacco, and control plants on the body weight of the beet armyworm. Beet armyworm larvae with similar body weights were selected and treated for each line. The larvae were inoculated onto tobacco leaves, with three larvae placed on each plant. The weight of the larvae was continuously measured, and the body weights of the beet armyworms on transgenic tobacco and control plants were compared and analyzed. The results are as follows: Figure 5 and Figure 7 As shown in the figure. Simultaneously, the extent of damage to the tobacco leaves after feeding insects was observed, and the results are as follows. Figure 6 and Figure 8 As shown.

[0040] Figure 5 This is a statistical analysis chart of the weight of insects after inoculating the multi-gene knockout mutant strain of the present invention with Spodoptera litura.

[0041] Figure 7 This is a statistical analysis chart of insect weight after inoculating the overexpression strain of the present invention with Spodoptera litura.

[0042] according to Figure 7 It can be seen that the insects fed with the overexpressing plants had reduced body weight, especially from the third day onwards. Therefore, the NtPPO-4 gene overexpression lines exhibit significant resistance to the beet armyworm.

[0043] according to Figure 5 It can be seen that the insects fed with the multi-gene mutant plants have a significantly increased weight, indicating that the NtPPO-4 gene has a significant resistance to the beet armyworm.

[0044] Figure 6 This image illustrates the leaf damage on tobacco leaves after feeding the beet armyworm with a multi-gene knockout mutant strain according to an embodiment of the present invention.

[0045] Figure 8 This is a diagram illustrating the leaf damage on tobacco leaves after feeding the overexpression strain to the beet armyworm, as shown in an embodiment of the present invention.

[0046] according to Figure 8 It can be seen that the tobacco leaf defects in the overexpressing plants were significantly less severe than those in the control plants. As shown in Figure 6, the tobacco leaf defects in the multi-gene mutant plants were significantly more severe than those in the control plants, indicating that mutations in these genes can reduce the plant's resistance to the beet armyworm, while overexpression of the NtPPO-4 gene can significantly enhance the plant's resistance to the beet armyworm.

[0047] Example 7: Detection of PPO activity in NtPPO gene knockout lines The PPO gene encodes a polyphenol oxidase protein, and the PPO activity of overexpressed and knockout lines was further examined.

[0048] Figure 9 This is a graph showing the detection and analysis of PPO activity in multi-gene knockout mutant lines according to an embodiment of the present invention.

[0049] Figure 10 This is a graph showing the detection and analysis of PPO activity in the overexpression lines of this invention.

[0050] according to Figure 9 It can be seen that, compared with the control plants, the PPO activity of NtPPO-4 gene knockout tobacco plants was significantly reduced. According to... Figure 10 It can be seen that the PPO activity of NtPPO-4 gene overexpression lines was significantly increased. This indicates that the tobacco PPO gene is involved in the tobacco plant's response to the beet armyworm.

[0051] The embodiments of the present invention described above do not constitute a limitation on the scope of protection of the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. The application of the NtPPO gene in regulating the resistance of tobacco plants to beet armyworm, characterized by: The gene is at least one of the NtPPO-4 gene and the NtPPO-11 gene; The base sequence of the NtPPO-4 gene is shown in SEQ ID No. 1; The base sequence of the NtPPO-11 gene is shown in SEQ ID No. 2; The regulation includes reducing the resistance of tobacco plants to the beet armyworm by knocking out or reducing at least one of the NtPPO-4 and NtPPO-11 genes. and Overexpression of at least one of the NtPPO-4 and NtPPO-11 genes increased the resistance of tobacco plants to the beet armyworm.

2. The application of the NtPPO gene according to claim 1 in regulating the resistance of tobacco plants to beet armyworm, characterized in that: Reduce or knock out the expression level of at least one of the NtPPO-4 and NtPPO-11 genes in tobacco plants; design specific target gene sequences (sgRNAs) targeting specific homologous regions of the NtPPO-4 and NtPPO-11 genes, as shown in SEQ ID No.

3.

3. The application of the NtPPO gene according to claim 2 in regulating the resistance of tobacco plants to beet armyworm, characterized in that: Reduce the expression level of at least one of the NtPPO-4 and NtPPO-11 genes in tobacco plants using CRISPR-Cas9 or RNAi gene silencing technology.

4. A recombinant vector overexpressing the NtPPO gene, characterized in that: The recombinant vector contains a base sequence as shown in SEQ ID No. 1 or SEQ ID: NO.

2.

5. The recombinant vector overexpressing the NtPPO gene according to claim 4, characterized in that: The recombinant expression vector is either NtPPO4-OX or NtPPO11-OX recombinant expression vector; The base sequence of primer NtPPO-4F for constructing NtPPO4-OX is shown in SEQ ID: NO. 4, and the base sequence of primer NtPPO-4R is shown in SEQ ID: NO.

5.

6. An expression vector, characterized in that: Including polynucleotides targeting the target site shown in SEQ ID No. 3 in at least one of the NtPPO-4 and NtPPO-11 genes, or polynucleotides encoding sgRNAs of the sequence shown in SEQ ID NO.

3.

7. The expression vector according to claim 6, characterized in that: The expression vector is a CRISPR gene editing vector.

8. A reagent kit, characterized in that: It includes the expression vector as described in claim 7.

9. A tobacco plant resistant to the beet armyworm, characterized by: The tobacco plant contains at least one of the NtPPO-4 and NtPPO-11 genes overexpressed.

10. The method for cultivating tobacco plants resistant to the beet armyworm according to claim 9, characterized in that, The procedure includes the following steps: The constructed overexpression vector was transformed into Agrobacterium using electroporation; seeds of conventionally cultivated tobacco were treated with a 10% sodium hypochlorite solution for 10 minutes, then rinsed with sterile water and sown on 1 / 2 MS medium; after germination and reaching the 4-leaf stage, tobacco transgenic infection was performed; healthy tobacco seedlings were selected, and leaves were cut into 1cm × 1cm pieces, infecting them with Agrobacterium infection solution for 15 minutes, then the excess bacterial solution was blotted off with sterile filter paper, and the leaves were laid flat on tobacco differentiation medium and co-cultured in the dark at 28℃ for 2-3 days; after the co-culture stage, the tobacco leaves were transferred to differentiation medium for further culture; when new buds began to sprout from the leaf surface, these new buds were transferred to a selection and rooting medium for further selection and culture; after adventitious roots were observed to form and grow to approximately 1cm in length, a two-day hardening-off treatment was performed; subsequently, they were transplanted into nutrient soil for continued cultivation.