Application of sg19 gene in regulating rice seed germination

Abstract

The present application relates to the technical field of gene editing, and particularly relates to application of SG19 gene in regulating seed germination of rice. The present application cuts the specific site of SG19 gene by designing specific guide RNA (gRNA) and guiding Cas9 protein, so as to realize gene knockout or mutation. The CRISPR / Cas9 technology can quickly and accurately edit genes, significantly shorten the breeding cycle, simplify the breeding operation process, and reduce the workload of field test and artificial selection. Through this technology, the key genes affecting the seed germination rate can be accurately regulated. The present application reduces the expression amount of SG19 gene by the CRISPR / Cas9 technology, reduces the synthesis of ABA, and then accelerates the seed germination rate of rice, and improves the germination rate of rice seeds, thereby providing a new strategy and method for rice breeding.

Description

Technical Field

[0001] This invention relates to the field of gene editing technology, and in particular to the application of the SG19 gene in regulating rice seed germination. Background Technology

[0002] Seed germination is a crucial step in the plant life cycle and is essential for agricultural production. Abscisic acid (ABA), a key plant hormone, plays a vital role in regulating dormancy and germination in rice seeds. The ABA content directly affects the seed germination rate.

[0003] Traditional breeding methods face some significant drawbacks in regulating rice seed germination rates, especially in improving seedling emergence speed. These drawbacks limit their application in modern agricultural production. The specific drawbacks are as follows:

[0004] 1. Long breeding cycle and complex operation: Traditional breeding methods rely on multi-generational hybridization and selection processes. This not only results in an excessively long breeding cycle, making it difficult to adapt to the rapid emergence requirements of agricultural production, but also involves numerous field trials and artificial selection, making the operation complex and labor-intensive, thus increasing the difficulty and cost of breeding. 2. Significant environmental impact: The results of traditional breeding methods are easily affected by environmental conditions, such as temperature and humidity. This leads to unstable breeding results and makes it difficult to guarantee rapid emergence under different environments, thus affecting the reliability and consistency of breeding. 3. Inaccurate gene regulation, especially in ABA regulation: Traditional breeding methods struggle to achieve precise targeted regulation of specific genes, particularly those regulating ABA synthesis and degradation. This limits the precise control of key traits affecting seed germination rate, thus impacting breeding efficiency and effectiveness. ABA, as a key plant hormone, plays a crucial role in regulating seed dormancy and germination, and its content directly affects the seed germination rate. With the development of molecular biology techniques, especially the emergence of CRISPR / Cas9 gene editing technology, new opportunities have been provided for rice breeding. This technology enables precise manipulation of specific genes by constructing gene expression vectors and transforming them into rice, thereby effectively regulating the germination rate of rice seeds.

[0005] Stress granules (SGs) are dynamic, membraneless organelles produced by organisms in response to stress. They are primarily formed by the assembly of interacting proteins and RNA through liquid-liquid phase separation (Cui et al., 2024). Under stress or drug effects, eukaryotes inhibit global translation initiation through phosphorylation of eukaryotic translation initiation factor 2α (eIF2α) or dissociation of the eukaryotic translation initiation complex eIF4F. In the cytoplasm, translationally repressed mRNA dissociates from ribosomes, is recruited by specific RNA-binding proteins, and continuously aggregates through complex protein-protein, RNA-RNA, and protein-RNA interactions, ultimately forming stress granules through liquid-liquid phase separation (Cui et al., 2024; Protter and Parker, 2016). After stress is relieved, stress granules dissociate to avoid persistent interference with intracellular biological processes. Recent studies have shown that the mRNA of the ABA synthesis gene NCED3 can be recruited to stress granules to maintain its stability; when the mRNA cannot enter the stress granules, its stability decreases, ultimately leading to a decrease in ABA content (Wang et al., 2024).

[0006] Current research on stress granules mainly focuses on their assembly process, with relatively little research on the dissociation process, and even less research on stress granules in plants. There are currently no reports on the regulation of rice seed germination rate by the SG19 gene. Summary of the Invention

[0007] The purpose of this invention is to provide the application of the SG19 gene in regulating rice seed germination, so as to solve the problems existing in the prior art.

[0008] To achieve the above objectives, the present invention provides the following solution:

[0009] This invention provides the application of the SG19 gene in regulating the germination rate and / or germination speed of rice seeds. By knocking out the SG19 gene in rice, the germination rate and / or germination speed of rice seeds can be improved. The nucleotide sequence of the SG19 gene is shown in SEQ ID NO.4.

[0010] This invention provides the application of biomaterials with the SG19 gene knocked out in regulating the germination rate and / or germination speed of rice seeds, wherein the nucleotide sequence of the SG19 gene is shown in SEQ ID NO.4.

[0011] Preferably, the biomaterial includes a recombinant vector.

[0012] Preferably, the scaffold carrier of the recombinant vector is BGK030.

[0013] The present invention provides a method for improving the germination rate and / or germination speed of rice seeds, including the step of knocking out the SG19 gene in rice; the nucleotide sequence of the SG19 gene is shown in SEQ ID NO.4.

[0014] This invention provides the application of the SG19 gene in the cultivation of rice with high germination rate and / or fast germination speed. By knocking out the SG19 gene in rice, the germination rate and / or germination speed of rice seeds can be improved. The nucleotide sequence of the SG19 gene is shown in SEQ ID NO.4.

[0015] This invention provides the application of biological materials with the SG19 gene knocked out in the cultivation of rice with high germination rate and / or fast germination speed, wherein the nucleotide sequence of the SG19 gene is shown in SEQ ID NO.4.

[0016] This invention provides a method for cultivating rice with high germination rate and / or fast germination speed, including the step of knocking out the SG19 gene in rice; the nucleotide sequence of the SG19 gene is shown in SEQ ID NO.4.

[0017] This invention provides the application of sgRNA with SG19 gene knockout in improving rice seed germination rate and / or germination speed, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NO.1; and the nucleotide sequence of the SG19 gene is shown in SEQ ID NO.4.

[0018] This invention provides the application of sgRNA with SG19 gene knockout in the cultivation of rice with high germination rate and / or fast germination speed, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NO.1; and the nucleotide sequence of the SG19 gene is shown in SEQ ID NO.4.

[0019] The present invention discloses the following technical effects:

[0020] This invention designs specific guide RNA (gRNA) to direct the Cas9 protein to a specific site in the SG19 gene for cleavage, thereby achieving gene knockout or mutation. CRISPR / Cas9 technology enables rapid and precise gene editing, significantly shortening the breeding cycle, simplifying breeding procedures, and reducing the workload of field trials and artificial selection. This technology allows for precise regulation of key genes affecting seed germination rates. This invention reduces the expression level of the SG19 gene and decreases ABA synthesis through CRISPR / Cas9 technology, thereby accelerating the germination rate of rice seeds and increasing the overall germination rate, providing a new strategy and method for rice breeding. This molecular biology-based approach not only improves rice seed germination efficiency and provides an effective technical means for molecular breeding of rice, but also holds promise for playing a significant role in improving rice yield and adaptability.

[0021] The results of specific embodiments of this invention show that when the SG19 gene is mutated and transformed into ZH11 rice, the resulting transgenic plants may no longer recruit the mRNA of the abscisic acid biosynthesis gene into stress granules, leading to a decrease in ABA content. Since ABA plays an inhibitory role in seed dormancy and germination, its reduced content promotes seed germination, thereby accelerating seedling emergence. This discovery provides a new molecular mechanism for regulating rice seed germination and also offers an effective technical means to achieve rapid seedling emergence in agricultural production. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 A map of the CRISPR / Cas9 gene editing vector BGK030;

[0024] Figure 2 A diagram illustrating the identification of mutation sites in the 100-square mutant;

[0025] Figure 3 A germination rate statistics chart;

[0026] Figure 4 This is a germination phenotype diagram. Detailed Implementation

[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0029] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0030] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0031] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0032] Example 1

[0033] 1. Material Procurement

[0034] sgRNA target of SG19 gene: CCTTGGTCGACCAGATTCTAATG (SEQ ID NO.1).

[0035] Gene editing was performed targeting the sgRNA site of the SG19 gene. The CRISPR / Cas9 gene editing vector, BGK030, was purchased from Hangzhou Baige Biotechnology Co., Ltd., and its map is shown below. Figure 1 As shown in the figure. Meanwhile, BGK030 is disclosed in the literature "Research on Improving Grain Yield in Guizhou Using CRISPR / Cas9 Gene Editing Technology," with the applicant committing to distribute it for 20 years from the application date. In this embodiment, the corresponding mutant seeds were purchased from Baige Company; specific information is shown in Table 1.

[0036] Table 1. Detailed information on mutant seeds

[0037]

[0038] The sequence of the SG19 gene (LOC_Os07g41180) is shown in SEQ ID NO.3, as follows:

[0039] CCTTGGTCGACCAGATTCTAATG

[0040] The CDS sequence of the SG19 gene is shown in SEQ ID NO.4, as follows:

[0041]

[0042] 2. Planting and Identification

[0043] The SG19-Ba1 material was planted. Before planting, the seeds were soaked in a 1 / 1000 hydrogen peroxide solution for 2-3 days to disinfect and promote germination. Then, the seeds were sown on seeding boards and cultured in a 1 / 4 concentration Yoshida rice nutrient solution for 14 days. After culture, samples were taken from the plants, and DNA was extracted using the CTAB method for identification and analysis. The results are as follows. Figure 2 As shown. The identification results show that the gene mutations in some plants are as follows:

[0044] An insertion of a T base after the 141st base of the CDS sequence of the SG19 gene causes the protein it encodes to terminate at 52 amino acids, resulting in a loss of gene function. The plants exhibiting this condition are numbered as varieties 19-1, 19-8, and 19-13.

[0045] An insertion of the base GG after the 141st base of the CDS sequence of the SG19 gene causes the protein it encodes to terminate at 56 amino acids, resulting in a loss of gene function. The plants exhibiting this condition are numbered as varieties 19-5, 19-7, and 19-15.

[0046] 3. Planting and Seed Collection

[0047] The identified plants were planted at the Damao base in Hainan Province. After the plants matured, varieties numbered 19-13 (sg19-13) and 19-15 (sg19-15) were selected as representatives of SG19-Ba1. They were sown in Shunyi, Beijing in May 2024 and harvested in October for subsequent experiments.

[0048] 4. Effects of SG19 gene mutation on rice seed germination

[0049] To further investigate the effect of SG19 gene mutation on rice seed germination, germination rate experiments were conducted using three rice varieties harvested in Beijing: ZH11, sg19-13, and sg19-15. Three control groups were set up for each rice variety, with 50 seeds in each control group. The seeds were placed in disposable petri dishes lined with two sheets of filter paper, and 5 mL of sterile water was added. The dishes were stored at 28℃ in the dark, and the germination rate was recorded every 12 hours. The results are shown below. Figure 3 and Figure 4 As shown.

[0050] A comparative analysis of the germination rates of three rice varieties revealed that SG19-15 had the fastest germination rate, reaching 48% after 24 hours and 100% after 36 hours. SG19-13 was the second fastest, with a germination rate of 14% after 24 hours, rapidly rising to 94% after 36 hours, and approaching 100% after 48 hours. ZH11 had the slowest germination rate, reaching only 62% after 36 hours and approaching 92% after 48 hours. Furthermore, within the 72-hour experimental period, SG19-15 maintained a stable germination rate of 100% after 36 hours, SG19-13 maintained a stable germination rate of approximately 100% after 48 hours, and ZH11 maintained a stable germination rate of approximately 97% after 60 hours. This study compared the germination rates of rice seeds from three varieties: ZH11, SG19-13, and SG19-15, revealing significant differences among the varieties. SG19-15 exhibited the fastest germination rate and the highest germination characteristics, demonstrating the best germination performance. These results provide important reference for rice variety selection and cultivation, helping to optimize rice planting strategies and improve germination rate and growth efficiency.

[0051] Both sg19-13 and sg19-15 are mutants of the SG19 gene. Compared with ZH11, the SG19 mutants showed higher germination rates and faster germination speeds, indicating that mutations in the SG19 gene have a positive effect on promoting rice seed germination rates. Experimental results showed that the germination rates and speeds of sg19-13 and sg19-15 were higher than those of ZH11. sg19-15 reached 100% germination rate after 36 hours, demonstrating the fastest germination speed; sg19-13 also had a relatively fast germination speed, reaching nearly 100% after 48 hours. The high germination rates and rapid germination speeds of sg19-13 and sg19-15 make them promising breeding materials for developing rice varieties with higher germination rates and faster germination speeds. Improving seed germination rate and shortening the growth cycle allows rice to better adapt to different growing environments and enhance its resilience to environmental changes, which is crucial for addressing climate change and increasing crop yield. In summary, mutations in the SG19 gene significantly promote rice seed germination rate, providing new germplasm resources for rice breeding and helping to optimize rice cultivation strategies, thereby improving germination rate and growth efficiency. Future research can further explore the performance of these mutants under different environmental conditions and their specific applications in breeding.

[0052] By comparing the germination rates of rice seeds with different genotypes, we can gain a deeper understanding of the impact of SG19 gene mutations on rice seed germination characteristics, thus providing valuable reference for rice breeding research. The experimental results will help reveal the mechanism of action of SG19 gene mutations in the rice seed germination process, laying the foundation for breeding better rice varieties.

[0053] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. SG19 The application of genes in regulating the germination rate of rice seeds is characterized by, By knocking out the rice SG19 Genes that can increase the germination speed of rice seeds; SG19 The nucleotide sequence of the gene is shown in SEQ ID NO.

4.

2. Knockout SG19 The application of gene-based biomaterials in regulating rice seed germination rate is characterized by, The SG19 The nucleotide sequence of the gene is shown in SEQ ID NO.4; by knocking out the gene described in rice SG19 Genes can be used to increase the germination speed of rice seeds.

3. The application according to claim 2, characterized in that, The biomaterials include recombinant vectors.

4. The application according to claim 3, characterized in that, The scaffold carrier of the recombinant vector is BGK030.

5. A method for improving the germination rate of rice seeds, characterized in that, Including knockout of rice SG19 The steps of gene generation; the described SG19 The nucleotide sequence of the gene is shown in SEQ ID NO.

4.

6. SG19 The application of genes in the cultivation of fast-germinating rice is characterized by, By knocking out the rice SG19 Genes that can increase the germination speed of rice seeds; SG19 The nucleotide sequence of the gene is shown in SEQ ID NO.

4.

7. Knockout SG19 The application of gene-based biomaterials in cultivating fast-germinating rice is characterized by, The SG19 The nucleotide sequence of the gene is shown in SEQ ID NO.

4.

8. A method for cultivating rice with rapid germination, characterized in that, Including knockout of rice SG19 The steps of gene generation; the described SG19 The nucleotide sequence of the gene is shown in SEQ ID NO.

4.

9. Knockout SG19 The application of sgRNA in improving rice seed germination speed is characterized by, The nucleotide sequence of the sgRNA is shown in SEQ ID NO.1; SG19 The nucleotide sequence of the gene is shown in SEQ ID NO.

4.

10. Knockout SG19 The application of sgRNA in the cultivation of fast-germinating rice is characterized by, The nucleotide sequence of the sgRNA is shown in SEQ ID NO.1; SG19 The nucleotide sequence of the gene is shown in SEQ ID NO.4.

Images