Application of SNP molecular markers in evaluating the success rate of first calving in dairy cows

Abstract

The application discloses application of a SNP molecular marker in evaluation of postpartum first mating success rate of a dairy cow and belongs to the technical field of biological breeding of animal husbandry. The SNP molecular marker is a base A at the 162nd position of a sequence shown in SEQ ID NO:1 or a base C at the 162nd position of a sequence shown in SEQ ID NO:2 and is located on a VKORC1L1 gene. The dairy cow with a genotype CC of the SNP molecular marker performs better in the postpartum first mating success rate. The postpartum first mating success rate of the dairy cow can be accurately evaluated by detecting the SNP molecular marker, and this has important significance for improving the reproduction efficiency of the dairy cow, shortening the interval between calving, reducing the feeding cost and promoting the efficient and sustainable development of the dairy industry.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of biological breeding of livestock, and particularly relates to application of a SNP molecular marker in evaluating postpartum first mating success rate of a dairy cow. BACKGROUND

[0002] Reproductive performance of a dairy cow is a key trait affecting production efficiency of a ranch and sustainable development of a dairy industry, and the level of the reproductive performance is directly related to a calving interval, a lactation cycle and a final milk production capacity. However, the reproductive trait generally has problems of low heritability (h2≈0.05-0.15) and great difficulty in improvement. Meanwhile, there is significant genetic antagonism effect (a correlation coefficient is about-0.3) between the reproductive trait and a milk production trait, so that genetic improvement of the reproductive trait is very slow under a traditional breeding method. In actual production, insufficient reproductive performance will lead to prolonged empty period and increased calving interval, which not only reduces the utilization period and the final milk production of the dairy cow, but also significantly increases feeding and elimination costs, and has an adverse effect on economic efficiency of the ranch.

[0003] With development of molecular breeding technology, correlation analysis and selection breeding are carried out by using a whole genome single nucleotide polymorphism (SNP) marker, which has become an important means for genetic improvement of the reproductive trait. Through genotyping, a key molecular marker related to reproductive efficiency can be screened, and then early and accurate selection is carried out, so that breeding efficiency and economic efficiency are improved. However, in existing research, a functional molecular marker affecting the postpartum first mating success rate of the dairy cow is not clear, and there is still a lack of a stable genetic marker which can be directly applied to molecular breeding. SUMMARY

[0004] The application aims to provide application of the SNP molecular marker in evaluating the postpartum first mating success rate of the dairy cow, and to provide technical support for the trait of the first mating success rate of the dairy cow.

[0005] The technical scheme of the application is specifically as follows.

[0006] In a first aspect, the application provides application of a SNP molecular marker in evaluating the postpartum first mating success rate of a dairy cow, the SNP molecular marker is located on a VKORC1L1 gene, is chr25:g 27901895A>C, that is, a 162th base A of a sequence shown in SEQ ID NO:1 or a 162th base C of a sequence shown in SEQ ID NO:2, a reference sequence of the VKORC1L1 gene is NCBI GeneID: 506318, and the postpartum first mating success rate of the dairy cow with a genotype CC of the SNP molecular marker is higher than that of an individual with a genotype AA.

[0007] Optionally or preferably, the dairy cow is a Holstein cow.

[0008] In a second aspect, the present application provides application of a reagent for detecting a SNP molecular marker in evaluating the success rate of the first postpartum mating of a dairy cow, wherein the SNP molecular marker is located on a VKORC1L1 gene, is chr25:g 27901895A>C, i.e., a base A at position 162 of the sequence shown in SEQ ID NO: 1 or a base C at position 162 of the sequence shown in SEQ ID NO: 2, the reference sequence of the VKORC1L1 gene is NCBI Gene ID: 506318, and the success rate of the first postpartum mating of a dairy cow with a genotype CC of the SNP molecular marker is higher than that of a dairy cow with a genotype AA.

[0009] Optionally or preferably, the reagent comprises a primer pair, and the nucleotide sequences of the primer pair are shown in SEQ ID NO: 3-4.

[0010] Compared with the prior art, the present application has the following beneficial effects:

[0011] The SNP molecular marker closely related to the success rate of the first postpartum mating identified by the present application is chr25:g 27901895A>C. Research shows that the dominant genotype of chr25:g 27901895A>C is CC, and individuals carrying the above dominant genotype perform better in the success rate of the first mating. By detecting the above SNP molecular marker, the success rate of the first postpartum mating of a dairy cow can be accurately evaluated, which is of great significance to improving the reproductive efficiency of dairy cows, shortening the interval between calving, reducing the cost of feeding, and promoting the efficient and sustainable development of the dairy industry. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 It is a Manhattan plot of the GWAS result of the success rate of the first postpartum mating of a Holstein cow in Example 1.

[0013] Figure 2 It is a QQ-plot graph of the GWAS result of the success rate of the first postpartum mating of a Holstein cow in Example 1.

[0014] Figure 3 It is a locuszoom analysis result of the candidate region in Example 1.

[0015] Figure 4 It is an electrophoresis result of primer amplification verification of six individuals randomly selected in Example 2, and the target band is the dot amplification band.

[0016] Figure 5 It is a sanger sequencing graph of the chr25:g 27901895A>C site in six individuals in Example 2. DETAILED DESCRIPTION

[0017] To enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below with reference to embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of the present application, and not all embodiments. Based on the embodiments of the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort should fall within the scope of protection of the present application. Unless otherwise specified, the instruments and reagents used in the embodiments are all from commercial channels.

[0018] Example 1: Screening and identification of SNP molecular markers related to the success rate of first marriage after childbirth

[0019] 1. DNA sample collection and gene data analysis

[0020] Blood samples were collected from 1,800 Holstein cows in 5 large-scale farms. The location of the farms and the number of samples collected from each farm are shown in Table 1.

[0021] Table 1. Collection locations and number of samples from Holstein cows

[0022]

[0023] 2. The collected blood samples were sent to Shanghai Newgene Technology Co., Ltd. for GGP Bovine 100K SNP chip detection. The valid data obtained after deleting SNP sites with no detection results were used for subsequent whole-genome SNP genotype quality control analysis.

[0024] 3. SNP genotyping quality control: During the SNP genotyping quality control process, individuals or loci that meet the following criteria are deleted: loci with a genotyping deletion count >10%, loci with a minimum allele frequency below 0.01, and loci with a Hardy-Weinberg test p-value <0.000001. Data will be deleted if any of the above three conditions are met.

[0025] 4. Genotype filling: Based on the resequencing data of 1,800 Holstein cattle collected in the previous period, the Hidden Markov Model (HMM) algorithm was used, and the BEAGLE software was used to fill the 100K chip data sequentially according to chromosomes to the whole genome sequence data level.

[0026] 5. Genome-wide association analysis: A GWAS analysis was performed to examine the relationship between genome-wide SNP genotypes and litter phenotypic traits. The GWAS analysis model was as follows: ;in y It is a vector of phenotypic traits; b This is a fixed-effects vector, including influencing factors such as year of birth, season of birth, year of calving, season of calving, inseminator, and parity. XThis is the design matrix corresponding to these fixed effects, used to vectorize the fixed effects. b With phenotypic vectors y Related; S a For each individual, there is an additive genotype encoding vector for the SNP, where genotypes AA, Aa, and aa are encoded as 0, 1, and 2, respectively. β a This represents the fixed additive genetic effect at this SNP locus; 'a' represents an additive polygenic effect. Z a It is its corresponding design matrix; pe For permanent environmental effects, Z pe It is its corresponding design matrix; e It is a random residual vector, which usually follows a normal distribution.

[0027] 6. Identification of Significant SNPs: The Bonferroni correction was used to adjust the significance level (P-value) of the GWAS analysis results of the success rate of first mating after calving in Holstein cattle. The Bonferroni correction method was used to control for multiple tests and correct the GWAS results, with the significance threshold set at 8 × 10⁻⁶. -8 Key SNPs significantly associated with the genetic effect of first mating success rate after calving in Holstein cattle were identified using GWAS results. Manhattan plots and QQ plots were then constructed using the CMplot package in R software. SNPs above the threshold line on the Manhattan plot were identified as SNPs significantly associated with the first mating success rate after calving in Holstein cattle.

[0028] Two SNP loci closely associated with the success rate of first mating after birth were identified, one of which is located at chr25:g27901895A>C (VKORC1L1 gene). The results showed that the dominant genotype of this SNP is CC, and individuals carrying this dominant genotype have a better success rate in first mating.

[0029] Table 2. Genotypes of SNP loci associated with postpartum first-time marriage success rate

[0030]

[0031] As shown in Table 2, when the SNP locus genotype is GG, the success rate of the first mating after calving is high, and it can be used as a molecular marker for screening superior individuals for reproduction.

[0032] Example 2: Validation of the correlation between SNP molecular markers and the success rate of first marriage after delivery

[0033] Primers were designed targeting the reference sequence (NCBI Gene ID: 506318) of the SNP molecular marker containing chr25:g 27901895A>C. The primer sequences are shown below:

[0034] Upstream primer: ATCTGCCCTCACCACTCTGA, SEQ ID NO:3,

[0035] Downstream primer: TGTGCACTCCTTGACAGGAC, SEQ ID NO:4.

[0036] Blood samples were collected from six Holstein cows in the validation group. Total DNA was extracted and used as a template. PCR amplification was performed using SEQ ID NO:3-4 as primers and the extracted genomic DNA as a template. The total reaction volume was 25 μL: 1 μL template DNA, 2.5 μL 10×Buffer (containing 15 mmol / L MgCl2), 2 μL dNTPs (2.5 mmol / L), 0.5 μL each of forward and reverse primers (12.5 pmol / μL), 0.5 μL Taq DNA polymerase (2.5 U / μL), and ultrapure water to a final volume of 25 μL. The amplification program was: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 45 s, for a total of 35 cycles; final extension at 72℃ for 10 min. The agarose gel electrophoresis results of the DNA amplification products are shown below. Figure 4 After purification, the amplified products were genotyped using Sanger sequencing. The sequencing results are shown below. Figure 5 .

[0037] chr25:g27901895A>C gene sequence:

[0038] ATCTGCCCTCACCACTCTGAGTGCTGTGCTTCACAGCATGTATCACAAAGTAGAGTTACTTGGTTTGTTGTTTTTGTCTATCTGCATCCATTAGAATACAAGCATCAAGAGGCCAGTGGCTTTGTCCTGTGTAGCCTTGAATCTTCAATGTTGGACACAAA ACTGACTTATAATAAATATAAGAATGAAAATACAGTGGAGTAGGTTGGGGGGTGCCAGCTGCTGGACAGTTCAAAATTTGTGTATGACTTTACCATTGGCCCTCTGGATCTGTGGTTCTGCAACTTCAACCAGGAATGGATCATGTACTTTAGTACTGAGTTATTCAGTAGGCTCCCCATGTGAGTGGGGCCTCACAGTTCAAACCCATGTCCTTCAAGGATCAACTTAGATCGAACAGGAAAAAGCTACCATAGGCACCAAACATTAGCTTTGGTCACTTAGAGCACCCCTGTCCCAGTGTGCTCTCTTTAGGTATTGACTGCTTGACAGATGTGTGATGGCTGTGAGTTCTCATCTTGTTCTTTATCAGAAGAGATGGAAGCAAAGAGCTTGTAGGTCCTGTCAAGGAGTGCACA, SEQ ID NO:1, where base A at position 162 is an SNP site, and the nucleotide sequence when the base at this site is C is shown in SEQ ID NO:2.

[0039] Blood samples were collected from 1000 Holstein cows in the validation group and sent to Shanghai NewQC for GGP Bovine 100K SNP chip analysis. SNPs without test results were removed, and the resulting valid data were used for subsequent genome-wide SNP genotypic quality control analysis. The actual phenotype of the first mating success rate was recorded for the control group. The results are shown in Table 3 below, indicating that the SNP genotype distribution corresponds consistently with the first mating success rate.

[0040] Table 3. Correlation between SNP molecular markers and the success rate of first marriage after delivery

[0041]

[0042] This article uses specific examples to illustrate the inventive concept in detail. The description of the above embodiments is only for the purpose of helping to understand the core idea of ​​the present invention. It should be noted that any obvious modifications, equivalent substitutions or other improvements made by those skilled in the art without departing from the inventive concept should be included within the protection scope of the present invention.

Claims

1. The application of a reagent for detecting SNP molecular markers in assessing the success rate of first mating in dairy cows after calving, characterized in that, The SNP molecular marker is located on the VKORC1L1 gene and is the 162nd base A of the sequence shown in SEQ ID NO:1 or the 162nd base C of the sequence shown in SEQ ID NO:

2. Cows with the SNP molecular marker genotype CC have a higher first mating success rate after calving than individuals with the genotype AA. The cows are Holstein cows.

2. The application according to claim 1, characterized in that, The reagents include primer pairs, the nucleotide sequences of which are shown in SEQ ID NO:3~4.

Images