Oligonucleotides, compositions and methods thereof

Abstract

The invention relates to oligonucleotides, compositions and methods thereof. The present disclosure relates to the recognition that immune responses mediated by CpG oligonucleotides may be stereochemically affected by modified inter-nucleotide linkages (e.g., phosphorothioates). In some embodiments, the present disclosure relates to chirally controlled CpG oligonucleotide compositions comprising a CpG oligonucleotide comprising a plurality of modified inter-nucleotide bonds, such as phosphorothioate bonds, such as phosphorothioate bonds, etc. Wherein the oligonucleotide comprises one or more CpG region motifs having a defined stereochemical pattern of chiral inter-nucleotide bonding. In some embodiments, a CpG oligonucleotide comprising one or more CpG region motifs is capable of agonizing an immune response. In some embodiments, CpG oligonucleotides comprising one or more CpG region motifs are antagonistic. The present invention also describes methods for making and using chirally controlled CpG oligonucleotide compositions. In some embodiments, immunomodulation is not required, and the present disclosure provides methods of identifying oligonucleotide compositions with reduced chiral control of immunomodulation.

Description

[0001] This application is a divisional application of Chinese patent application No. 201780049271.8 entitled “Oligonucleotides, Compositions and Methods Thereof”. The original application was PCT international application PCT / US2017 / 035837 filed on June 2, 2017, which entered the Chinese national phase on January 31, 2019.

[0002] Cross Reference to Related Applications

[0003] This patent application claims priority to U.S. Provisional Application No. 62 / 345,709, filed June 3, 2016, and U.S. Provisional Application No. 62 / 405,816, filed October 7, 2016, the entire contents of which are incorporated herein by reference. Background Technology

[0004] Oligonucleotides are valuable therapeutic, diagnostic, and analytical reagents with many important applications. Summary of the Invention

[0005] Among other things, this disclosure covers the understanding that oligonucleotides, including those comprising any of the various CpG region motifs, are useful and valuable as immunomodulators. This disclosure also covers, in particular, methods for identifying oligonucleotides and compositions thereof that have improved immunomodulatory activity, stability, efficacy, and / or effectiveness.

[0006] In some embodiments, this disclosure covers the understanding of structural elements of oligonucleotides, such as base sequences, chemical modifications (e.g., modifications to sugar, base, and / or nucleotide bonds and their patterns) and / or stereochemistry (e.g., the stereochemistry of the backbone chiral center (chiral nucleotide bonds) and / or its pattern), which can significantly influence the properties of oligonucleotides (e.g., activity, stability, etc.). In some embodiments, this disclosure demonstrates that oligonucleotide compositions comprising oligonucleotides having controlled structural elements (e.g., controlled chemical modifications and / or controlled backbone stereochemistry patterns) provide unexpected properties, including but not limited to those described herein. In some embodiments, this disclosure provides methods for modulating the properties (e.g., activity, stability, etc.) of oligonucleotides through chemical modifications (e.g., chemical modifications to base, sugar, and nucleotide bonds) and / or stereochemistry (e.g., the stereochemistry of chiral nucleotide bonds and their patterns). In some embodiments, this disclosure provides chiral-controlled oligonucleotide compositions that, when compared with reference oligonucleotide compositions, such as chiral-uncontrolled (stereorandom) oligonucleotide compositions, provide improved properties, such as enhanced TLR9 agonist activity, reduced TLR9 agonist activity, enhanced TLR9 antagonist activity, reduced TLR9 antagonist activity, etc.

[0007] In some embodiments, this disclosure encompasses the understanding that lipid conjugation, which incorporates a lipid moiety into oligonucleotides, is unexpectedly effective in improving oligonucleotide properties, such as their TLR9-related activity, delivery, and pharmacokinetic properties. For example, in some embodiments, this disclosure has surprisingly demonstrated that oligonucleotides containing a lipid moiety exhibit unexpectedly high hTLR9 antagonist activity compared to oligonucleotides without a lipid moiety. In some embodiments, oligonucleotides containing a lipid moiety have not only demonstrated improved hTLR9 antagonist activity but have also surprisingly improved other properties, such as activity against their complementary nucleic acid targets, improved delivery, and pharmacokinetic properties. In some embodiments, lipid conjugation is utilized in conjunction with other structural elements, such as base sequences, chemical modifications (e.g., sugar modifications, base modifications, internucleotide bonding modifications), and / or stereochemistry, to improve oligonucleotide properties, such as TLR9-related properties. In some embodiments, the provided oligonucleotides comprise a lipid moiety as well as a base sequence, a chemical modification pattern, a backbone bonding pattern, a backbone chiral center pattern, and / or a backbone phosphorus modification pattern as described herein, for example, those described for CpG oligonucleotides.

[0008] In some embodiments, this disclosure encompasses the understanding that immune responses mediated by CpG oligonucleotides (oligonucleotides comprising one or more CpG motif regions, wherein the bond between C and G is optionally modified) can be modulated by the stereochemistry of chiral nucleotide intermolecular bonds. According to some embodiments of this disclosure, when an oligonucleotide comprises a CpG region motif having one or more chiral centers (e.g., within or adjacent to a CpG region motif), different stereoforms of such oligonucleotides may possess different immunomodulatory activities, stability, biological activity, characterization, and / or other activities, one or more of which may affect their utility and / or effectiveness. In some embodiments, the chiral centers that may affect the characterization and / or activity of the oligonucleotide are found in modified nucleotide intermolecular bonds, for example, involving one or more phosphate thioester (PS) or other modified phosphodiester bonds. In some embodiments, this disclosure provides techniques for chiral-controlled oligonucleotide compositions comprising oligonucleotides, the oligonucleotides comprising one or more CpG region motifs having a designed stereochemistry of inter-chiral nucleotides bonded within and / or adjacent to the CpG region motif.

[0009] Among other things, this disclosure demonstrates that the provided chiral-controlled CpG oligonucleotide compositions can exhibit very different immunomodulatory activities compared to stereorandom compositions, which are uncontrolled mixtures of many stereoisomers, such as those previously reported stereorandom compositions comprising phosphate-thioester-bonded CpG oligonucleotides. This disclosure particularly relates to chiral-controlled oligonucleotide compositions comprising chiral pure CpG oligonucleotides, wherein the stereochemistry of the inter-chiral nucleotide bonds is controlled rather than random.

[0010] In some embodiments, the provided chiral-controlled oligonucleotide composition comprises one or more CpG region motifs, wherein the internucleotide bond between C and G is Rp. In some embodiments, the provided chiral-controlled oligonucleotide composition comprises one or more CpG region motifs, wherein the internucleotide bond between C and G is Rp, and the oligonucleotide further comprises one or more Sp nucleotide bonds. In some embodiments, the provided chiral-controlled oligonucleotide composition comprises one or more CpG region motifs, wherein the internucleotide bond between C and G is Rp, and the oligonucleotide further comprises Sp nucleotide bonds immediately adjacent to the 5' and 3' ends of the CpG (i.e., Sp nucleotide bond - C-Rp nucleotide bond - G-Sp nucleotide bond). In some embodiments, oligonucleotides containing such motifs are, for example, agonists of mouse TLR9, and provide increased agonist activity when compared to a reference oligonucleotide. In some embodiments, the provided chiral-controlled oligonucleotide compositions contain one or more CpG region motifs, wherein one or both of the nucleotide internucleotide bonds immediately adjacent to the 5' and 3' ends of the CpG are Rp. In some embodiments, such oligonucleotides provide reduced agonist activity or increased antagonist activity for, for example, mouse TLR9.

[0011] In some embodiments, the provided chiral-controlled oligonucleotide composition comprises one or more CpG region motifs, wherein the internucleotide bond between C and G is Rp. In some embodiments, the provided chiral-controlled oligonucleotide composition comprises one or more CpG region motifs, wherein the internucleotide bond between C and G is Rp, and the oligonucleotide further comprises one or more Sp internucleotide bonds. In some embodiments, the provided chiral-controlled oligonucleotide composition comprises one or more CpG region motifs, wherein the internucleotide bond between C and G is Rp, and the oligonucleotide further comprises an Rp internucleotide bond immediately adjacent to the 5' end of CpG (i.e., Rp internucleotide bond-C-Rp internucleotide bond-G). In some embodiments, the provided chiral-controlled oligonucleotide composition comprises one or more CpG region motifs, wherein the internucleotide bond between C and G is Rp, and the oligonucleotide further comprises an Rp internucleotide bond immediately adjacent to the 5' end of CpG (i.e., Rp internucleotide bond-C-Rp internucleotide bond-G). In some embodiments, the provided chiral-controlled oligonucleotide composition comprises one or more CpG region motifs, wherein the internucleotide bond between C and G is Rp, and the oligonucleotide further comprises an internucleotide bond of Sp immediately adjacent to the 3' end of the CpG (i.e., C-Rp internucleotide bond – G-Sp internucleotide bond). In some embodiments, the oligonucleotide comprising such motifs is, for example, an agonist of human TLR9 and provides increased agonist activity compared to a reference oligonucleotide. In some embodiments, the provided chiral-controlled oligonucleotide composition comprises one or more CpG region motifs, wherein the internucleotide bond of Rp immediately adjacent to the 3' end of the CpG. In some embodiments, such oligonucleotides provide reduced agonist activity for, for example, human TLR9, or provide increased antagonist activity.

[0012] In some embodiments, the oligonucleotides provided beyond the CpG region motif are predominantly Sp (e.g., more than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%) to provide enhanced agonist activity. In some embodiments, the oligonucleotides provided beyond the CpG region motif are predominantly Rp (e.g., more than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%) to reduce agonist activity and / or provide enhanced antagonist activity.

[0013] In some embodiments, this disclosure relates to compositions and methods relating to CpG oligonucleotides comprising chains containing one or more of any of the various CpG region motifs disclosed herein. In some embodiments, depending on the motif, various CpG region motifs, defined at least in part by the stereochemistry of modified internucleotide bonds (e.g., phosphate thioesters) within the CpG region, can activate or antagonize immunostimulatory effects. In some embodiments, the CpG region motif comprises at least one phosphate thioester in the Rp conformation and at least one phosphate thioester in the Sp conformation. In some embodiments, where immunomodulation is not required, this disclosure also provides oligonucleotides and compositions thereof, and methods for identifying oligonucleotides and compositions thereof that have reduced immunomodulation, such as those lacking CpG region motifs that activate or antagonize immune responses.

[0014] Among other things, this disclosure covers the following understanding: chemical modifications, such as cytosine methylation and / or sugar modifications (e.g., 5-methylcytosine, 2'-modification of sugars, etc.), which were widely recognized prior to this disclosure as effective for removing TLR9 agonist activity, may not eliminate or reduce TLR9 agonist activity in certain cases. In some embodiments, this disclosure provides chiral-controlled oligonucleotide compositions comprising a predetermined level of a specific type of oligonucleotide, wherein said oligonucleotide contains one or more CpG region motifs, wherein C is methylated. In some embodiments, this disclosure provides chiral-controlled oligonucleotide compositions comprising a predetermined level of a specific type of oligonucleotide, wherein said oligonucleotide contains one or more modified sugars. In some embodiments, this disclosure provides chiral-controlled oligonucleotide compositions comprising a predetermined level of a specific type of oligonucleotide, wherein said oligonucleotide contains one or more modified sugars and one or more CpG region motifs, wherein C is methylated. In some embodiments, the modified sugar contains 2'-modification. In some embodiments, this disclosure demonstrates that such oligonucleotides and chiral-controlled oligonucleotide compositions thereof provide unexpected TLR9 agonist activity. Among other things, this disclosure demonstrates that the TLR9 agonist and antagonist activities of oligonucleotides and their compositions can be effectively modulated by stereochemistry (including patterns thereof) of chiral nucleotide interbonding and / or chemical modification.

[0015] CpG oligonucleotide compositions comprising CpG oligonucleotides containing phosphate thioesters can be chiral (e.g., chiral or stereopure) or stereorandom (e.g., stereomixtures). In some embodiments, this disclosure relates to chiral CpG oligonucleotide compositions that are chiral because the compositions comprise predetermined levels of oligonucleotides of various oligonucleotide types, wherein the oligonucleotide type is defined by: 1) a base sequence; 2) a backbone (internucleotide) bonding pattern; 3) a backbone (internucleotide) chiral center pattern; and 4) a backbone (internucleotide) phosphorus modification pattern; wherein each oligonucleotide of each oligonucleotide type independently comprises at least one common CpG region motif. In some embodiments, in the provided methods and / or compositions, the CpG oligonucleotide comprises two or more CpG region motifs as described herein. In some embodiments, this disclosure relates to chiral controlled CpG oligonucleotide compositions that are chiral because the compositions comprise predetermined levels of oligonucleotides of various oligonucleotide types, wherein the oligonucleotide type is defined by: 1) a base sequence; 2) a backbone (internucleotide) bonding pattern; 3) a backbone (internucleotide) chiral center pattern; and 4) a backbone (internucleotide) phosphorus modification pattern; wherein each oligonucleotide of each oligonucleotide type independently comprises at least one common CpG region motif: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; wherein each (*R / S) is an independent chiral internucleotide bond, and N1 and N2 are any nucleosides. In some embodiments, this disclosure relates to a chiral-controlled CpG oligonucleotide composition comprising a plurality of oligonucleotides, each of which: (a) hybridizes to a specific target sequence; (b) has a base sequence including at least one C residue in a CpG region motif present in all of the plurality of oligonucleotides (“common C residue”), and is modified, a modified sugar motif, or both; and (c) comprises one or more chiral nucleotide inter-bondings such that each oligonucleotide is a specific stereoform, characterized by stereoisomorphism at each of the one or more chiral nucleotide inter-bondings, wherein stereoisomorphism identifies which stereoisomer is present at the specific chiral nucleotide inter-bonding site, wherein the composition is chiral-controlled because it contains predetermined levels of each stereoform.In some embodiments, the present invention relates to a chiral-controlled CpG oligonucleotide composition comprising a plurality of oligonucleotides, each of the oligonucleotides: (a) hybridizing to a specific target sequence; (b) having a base sequence including at least one C residue in a CpG region motif present in all of the plurality of oligonucleotides (“common C residue”); and having a 5-methyl, a modified sugar motif, or both; and (c) comprising one or more chiral nucleotide inter-bonds such that each oligonucleotide is a specific stereoform, characterized by stereoisomorphism at each of the one or more chiral nucleotide inter-bonds, wherein stereoisomorphism identifies which stereoisomer is present at the specific chiral nucleotide inter-bond, wherein the composition is chiral-controlled because it contains predetermined levels of each stereoform. In some embodiments, the provided chiral-controlled oligonucleotide composition provides modulated (e.g., enhanced or reduced) TLR9 agonist and / or antagonist activity compared to a reference composition. In some embodiments, this disclosure provides a method of modulating TLR9 agonist and / or antagonist activity comprising providing the provided chiral-controlled oligonucleotide composition. In some embodiments, in the provided methods and / or compositions, the CpG oligonucleotide comprises two or more CpG region motifs as described herein.

[0016] A non-limiting example of a chiral-controlled CpG oligonucleotide composition is T*RC*RG*ST*RC*RG*ST*ST*ST*ST*SG*ST*RC*RG*ST*ST*ST*SG*ST*RC*RG*ST*ST (WV-1698). *R represents the thiophosphate ester in the Rp configuration; and *S represents the thiophosphate ester in the Sp configuration. The formulation of WV-1698 is stereopure or predominantly stereopure; most or all of the oligonucleotides not only have the same base sequence (the base sequence of each molecule or most molecules is TCGTCGTTTTGTCGTTTTGTCGTT) but also the same configurational pattern of the thiophosphate ester (each molecule or most molecules is *R*R*S* ... A non-limiting example of a CpG oligonucleotide composition that is a stereomixture of stereoisomers is T*C*G*T*C*G*T*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T (ODN-2006). *Indicates a non-stereocontrolled phosphate ester; for each stereoisomer in the composition, it may be Rp or Sp randomly. The stereorandom (uncontrolled chirality) ODN-2006 and the chiral-controlled WV-1698 oligonucleotide compositions share the same base sequence. However, they differ in stereochemistry: ODN-2006 is a random mixture of many stereoisomers (uncontrolled due to, for example, oligonucleotide synthesis without the use of techniques that effectively control the stereochemistry of the bonding between chiral nucleotides); WV-1698 contains predetermined levels of the stereoisomer T*RC*RG*ST*RC*RG*ST*ST*ST*ST*SG*ST*RC*RG*ST*ST*ST*ST*SG*ST*RC*RG*ST*ST. For example, a stereopure formulation (e.g., a chiral-controlled oligonucleotide composition) contains only oligonucleotides with the following stereochemistry (or mostly has only or has predetermined levels): *R*R*S*R*R*S*S*S*S*S*S*S*S*R*R*S*S*S*S*S*S*S*R*R*S*S. In contrast, a stereo mixture is a random combination of stereoisomers, which may include 2 23 (2 n Stereoisomers, for example:

[0017] *R*S*S*R*R*S*R*S*S*S*S*R*R*S*S*R*S*S*S*R*R*S*S

[0018] *R*R*S*R*R*S*S*R*R*S*S*R*R*S*S*S*S*S*S*R*R*S*S

[0019] *S*R*S*R*R*S*S*R*S*S*S*R*R*S*S*S*R*R*S*R*R*R*S

[0020] *R*R*S*R*R*S*S*S*S*R*S*R*R*S*S*S*S*S*S*R*R*S*S

[0021] *S*R*S*R*R*R*R*S*S*S*S*R*S*R*R*S*S*S*S*R*R*S*S

[0022] And millions of other stereoisomers. The number of stereoisomers in a stereo mixture is determined by the number of inter-chiral nucleotide bonds; when there are n inter-chiral nucleotide bonds, there can be 2... n Three stereoisomers. For ODN-2006 containing 23 thiophosphate esters, the stereorandom ODN-2006 oligonucleotide composition is 2 23 Or a stereochemical mixture of 8,388,608 different molecules. In contrast, a formulation of the stereochemically purified molecule WV-1698 (e.g., a chiral-controlled oligonucleotide composition) is a pure (or predominantly pure or at a predetermined level) formulation of a stereoisomer.

[0023] In some chiral-controlled oligonucleotide compositions, the inter-nucleotide bonds (including, but not limited to, thiophosphates) of each chiral modified nucleotide are chiral-controlled.

[0024] In some embodiments, in a chiral-controlled oligonucleotide composition, at least one chiral-modified internucleotide bond (including, but not limited to, thiophosphate) is chiral-controlled. In some embodiments, in a chiral-controlled oligonucleotide composition, at least one chiral-modified internucleotide bond (including, but not limited to, thiophosphate) is chiral-controlled, and at least one chiral-modified internucleotide bond (including, but not limited to, thiophosphate) is not chiral-controlled.

[0025] Non-limiting examples of chiral-controlled CpG oligonucleotide compositions are CpG oligonucleotides containing CpG region motifs:

[0026] C-(*X)-G-(*S)-N, where N is any nucleotide.

[0027] *S indicates a thiophosphate in the Sp conformation;

[0028] *X or (*X) indicates that in an oligonucleotide group or oligonucleotide composition, some individual oligonucleotides have a thiophosphate ester in the Rp conformation and some oligonucleotides have a thiophosphate ester in the Sp conformation at that position.

[0029] In some embodiments, the oligonucleotide composition is chiral even if one position (e.g., *X) is not chirally controlled, if any one or more other positions are chiral controlled. In some embodiments, in the chiral controlled oligonucleotide composition, C-(*X)-G-(*S)-N represents a CpG oligonucleotide containing the CpG region motif C-(*R)-G-(*S)-N, and a CpG oligonucleotide containing the CpG region motif C-(*S)-G-(*S)-N. In some embodiments, in the chiral controlled oligonucleotide composition, C-(*R / S)-G-(*S)-N represents a CpG oligonucleotide containing the CpG region motif C-(*R)-G-(*S)-N, or a CpG oligonucleotide containing the CpG region motif C-(*S)-G-(*S)-N.

[0030] In some embodiments, this disclosure provides sequences including N-(*X)-C-(*R / S)-G-(*R / S)-N, N-(*R / S)-C-(*X)-G-(*R / S)-N, N-(*R / S)-C-(*R / S)-G-(*X)-N, N-(*X)-C*R)-G-(*R)-N, and N-(*X)-C-(*R)-G-(*R)-N. R)-G-(*S)-N, N-(*X)-C-(*S)-G-(*R)-N, N-(*X)-C-(*S)-G-(*S)-N, N-(*R)-C -(*X)-G-(*R)-N, N-(*R)-C-(*X)-G-(*S)-N, N-(*S)-C-(*X)-G-(*R)-N, N-(*S) -C-(*X)-G-(*S)-N、N-(*R)-C-(*R)-G-(*X)-N、N-(*R)-C-(*S)-G-(*X)-N、N-( *S)-C-(*S)-G-(*X)-N, N-(*S)-C-(*R)-G-(*X)-N, N-(*X)-C-(*R)-G-(*X)-N, N Chiral controlled oligonucleotide compositions of CpG oligonucleotides of -(*X)-C-(*S)-G-(*X)-N, N-(*R)-C-(*X)-G-(*X)-N, N-(*S)-C-(*X)-G-(*X)-N, N-(*X)-C-(*X)-G-(*R)-N or N-(*X)-C-(*X)-G-(*S)-N.

[0031] Non-limiting examples of chiral-controlled CpG oligonucleotide compositions are CpG oligonucleotides containing CpG region motifs:

[0032] C-(*D)-G-(*R)-N, where N is any nucleotide.

[0033] *R indicates a thiophosphate in the Rp conformation;

[0034] *D indicates a dithiophosphate, in which two non-bridged phosphorus atoms in the phosphate diester have been replaced with sulfur.

[0035] Other CpG oligonucleotides include CpG region motifs containing the sequence N-(*D)-C-(*R / S)-G-(*R / S)-N, N-(*R / S)-C-(*D)-G-(*R / S)-N, N-(*R / S)-C-(*R / S)-G-(*D)-N, N-(*D)-C-(*R)-G-(*R)-N, N -(*D)-C-(*R)-G-(*S)-N、N-(*D)-C-(*S)-G-(*R)-N、N-(*D)-C-(*S)-G-(*S) -N, N-(*R)-C-(*D)-G-(*R)-N, N-(*R)-C-(*D)-G-(*S)-N, N-(*S)-C-(*D)-G- (*R)-N, N-(*S)-C-(*D)-G-(*S)-N, N-(*R)-C-(*R)-G-(*D)-N, N-(*R)-C-(*S )-G-(*D)-N, N-(*S)-C-(*S)-G-(*D)-N, N-(*S)-C-(*R)-G-(*D)-N, N-(*D)-C -(*R)-G-(*D)-N, N-(*D)-C-(*S)-G-(*D)-N, N-(*R)-C-(*D)-G-(*D)-N, N-(* S)-C-(*D)-G-(*D)-N, N-(*D)-C-(*D)-G-(*R)-N or N-(*D)-C-(*D)-G-(*S)-N.

[0036] As used herein, the terms N, *R, *S, *R / S, *X, and *D can be used to define the characteristics of any oligonucleotide or oligonucleotide composition.

[0037] In some embodiments, the chiral-controlled CpG oligonucleotide composition comprises a CpG oligonucleotide containing *X within a CpG region motif. In some embodiments, the chiral-controlled CpG oligonucleotide composition comprises a CpG oligonucleotide containing *X outside a CpG region motif. In some embodiments, the chiral-controlled CpG oligonucleotide composition comprises a CpG oligonucleotide containing *D within a CpG region motif. In some embodiments, the chiral-controlled CpG oligonucleotide composition comprises a CpG oligonucleotide containing *D outside a CpG region motif. In some embodiments, the chiral-controlled CpG oligonucleotide may contain *X (within or outside a CpG region motif) and *D (within or outside a CpG region motif). In some embodiments, the chiral-controlled CpG oligonucleotide may contain at least one *X (within or outside a CpG region motif) and at least one *D (within or outside a CpG region motif). In some embodiments, the chiral controlled CpG oligonucleotide comprises a CpG oligonucleotide containing at least one *R and / or at least one *S in a CpG region motif, and optionally, at least one *X (in or outside the CpG region motif) and at least one *D (in or outside the CpG region motif).

[0038] While researchers have previously reported CpG oligonucleotides that are stereomixtures, this disclosure relates to chiral-controlled CpG oligonucleotides. In some embodiments, chiral-controlled CpG oligonucleotides provide unique insights into CpG regional motifs, including elucidating various CpG regional motifs that are at least partially defined by the stereochemistry of thiophosphate variants capable of stimulating or antagonizing immune responses.

[0039] In some embodiments, this disclosure demonstrates in both mouse models and human PBMCs that stereorandom oligonucleotide compositions and corresponding chiral-controlled oligonucleotide compositions can exhibit very different activities against TLR9. In some embodiments, this disclosure demonstrates that for mouse TLR9, some stereopure CpG-oligonucleotides with a fully Sp backbone are potent agonists, their activity further modulated by the chirality of the PS bond in and adjacent to the CpG motif (CpG region). In some embodiments, human TLR9 (hTLR9) activity is affected very differently in several cases, where the agonist is preferably Sp chiral at the 3' of the CpG motif. In some embodiments, this disclosure demonstrates that 2'-modification on the ribosome completely eliminates agonist activity against mouse TLR9, but not against human TLR9, which is more relevant to drug development for human diseases. In some embodiments, this disclosure demonstrates that mouse and human TLR9 respond differently to stereopure CpG oligonucleotide compositions with 2'-modification and CpG methylation. In some embodiments, this disclosure surprisingly demonstrates that the chirality of thiophosphates is a key determinant of TLR9 activity.

[0040] Furthermore, although this disclosure shows that in at least some chiral controlled CpG oligonucleotide compositions, some CpG region motifs have greater immunomodulatory activity (e.g., greater agonist or antagonist activity), this disclosure covers any chiral controlled CpG oligonucleotide composition in which the CpG region motif comprises a stereodefined phosphate thioester or other chiral nucleotide bond, and wherein the CpG oligonucleotide demonstrates greater agonist or antagonist activity than a negative control (e.g., in the absence of an oligonucleotide composition).

[0041] Therefore, in some embodiments, this disclosure presents a surprising insight: the stereochemistry of chiral-modified internucleotide bonds, such as phosphate thioesters, in CpG region motifs can significantly influence the agonistic and / or antagonistic effects of CpG oligonucleotides. In some embodiments, various motifs, at least in part defined by the stereochemistry of phosphate thioesters, can agonize or antagonize immune responses.

[0042] In some embodiments, this disclosure relates in particular to compositions and methods comprising CpG oligonucleotides, the CpG oligonucleotides comprising one or more copies of a CpG region motif, wherein the motif comprises a stereodefined (Rp or Sp) phosphate thioester (or other chiral nucleotide bond).

[0043] In some embodiments, if immunomodulation is not required, this disclosure provides methods for identifying oligonucleotides with reduced immunomodulation (e.g., those lacking CpG region motifs that arouse or antagonize immune responses). In many cases, oligonucleotides intended for therapeutic use contain phosphate thioesters or other chiral nucleotide bonds that are not chirally controlled. In some embodiments of this disclosure, oligonucleotides intended for therapeutic use can therefore be screened for immunomodulation, and modified variants of these oligonucleotides (e.g., chiral controlled oligonucleotides) can be identified, as needed, having less or greater immunomodulation (arouse or antagonize), and / or greater stability, increased bioactivity, shorter length, or other improved characteristics. Those skilled in the art will understand that designs (e.g., chemical modifications and / or stereochemistry) identified through this disclosure for enhancing activity (e.g., TLR9 agonist or antagonist activity) can also be used to prepare oligonucleotide compositions with reduced such activity; when such activity is not required, designs for enhancing activity can be reduced or eliminated from the oligonucleotides.

[0044] In some embodiments, this disclosure provides a method for modulating an immune response, comprising providing a chiral-controlled oligonucleotide composition. In some embodiments, this disclosure provides a method for modulating TLR9 activity, comprising providing a chiral-controlled oligonucleotide composition. In some embodiments, this disclosure provides a method for treating a disease, comprising providing a chiral-controlled oligonucleotide composition. In some embodiments, this disclosure provides a method for treating cancer, comprising administering the provided chiral-controlled oligonucleotide composition to a subject. In some embodiments, this disclosure provides a method for treating cancer, comprising administering the provided chiral-controlled oligonucleotide composition and a cancer therapeutic agent to a subject. In some embodiments, the cancer therapeutic agent is a vaccine. In some embodiments, the cancer therapeutic agent is an antibody, such as anti-EGFR, anti-PD1, etc. In some embodiments, the cancer therapeutic agent is an immune checkpoint antibody. In some embodiments, the provided chiral-controlled oligonucleotide composition provides enhanced TLR9 agonist activity. In some embodiments, the provided chiral-controlled oligonucleotide composition provides enhanced TLR9 antagonist activity.

[0045] In some embodiments, this disclosure provides a method for determining TLR9 agonist and / or antagonist activity, comprising providing a chiral-controlled oligonucleotide composition. In some embodiments, this disclosure provides an assay system for obtaining TLR9 agonist and / or antagonist activity, comprising the provided chiral-controlled oligonucleotide composition. In some embodiments, the provided method and / or assay system are based on methods and / or assay systems widely known and used in the art, by replacing the stereorandom oligonucleotide composition in the method and / or assay system with the chiral-controlled oligonucleotide composition provided according to this disclosure.

[0046] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides comprising a chain containing about 14 to about 49 nucleotides, wherein the chain comprises at least one copy of the CpG regional motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2, wherein at least one (*R / S) is a modified internucleotide bond in the Rp conformation and at least one (*R / S) is a modified internucleotide bond in the Sp conformation, and N1 and N2 are each independently any nucleoside.

[0047] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides comprising a chain containing about 14 to about 49 nucleotides, wherein the chain comprises at least one copy of the CpG regional motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2, wherein at least one (*R / S) is a phosphate thioester in the Rp conformation and at least one (*R / S) is a phosphate thioester in the Sp conformation, and N1 and N2 are each independently any nucleoside.

[0048] In some embodiments, this disclosure relates to compositions comprising CpG oligonucleotides comprising a chain containing about 14 to about 49 nucleotides, wherein the chain comprises at least one copy of the CpG regional motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2, wherein at least one (*R / S) is a phosphate thioester in the Rp conformation and at least one (*R / S) is a phosphate thioester in the Sp conformation, and N1 and N2 are each independently any nucleoside.

[0049] In some embodiments, this disclosure relates to compositions comprising a plurality of oligonucleotides, each of which: (a) hybridizes to a specific target sequence; and (b) comprises a sequence including at least one CpG region motif (“common CpG region motif”) present in all of the plurality of oligonucleotides, the CpG region motif having the structure: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; wherein each (*R / S) is independently a chiral nucleotide bond, and N1 and N2 are each independently any nucleoside.

[0050] In some embodiments, this disclosure relates to compositions comprising a plurality of oligonucleotides, each of which: (a) consists of a specific base sequence; and (b) comprises a sequence including at least one CpG region motif (“common CpG region motif”) present in all of the plurality of oligonucleotides, the CpG region motif having the structure: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; wherein at least one (*R / S) is a phosphate thioester in the Rp conformation, and at least one (*R / S) is a phosphate thioester in the Sp conformation, and N1 and N2 are each independently any nucleoside.

[0051] In some embodiments, this disclosure relates to compositions comprising a plurality of oligonucleotides, each of which: (a) hybridizes to a specific target sequence; and (b) has a sequence comprising at least one CpG region motif (“common CpG region motif”) present in all of the plurality of oligonucleotides, the CpG region motif having the structure: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; wherein each (*R / S) is independently a chiral internucleotide bond, wherein the composition is chirally controlled because for each common CpG region motif it contains predetermined levels of each stereoisomer 1-8 ( S1-S8): S1: N1-(*R)-C-(*R)-G-(*R)-N2; S2: N1-(*R)-C-(*R)-G-(*S)-N2; S3: N1-(*R)-C-(*S)-G-(*R)-N2; S4: N1-(*R)-C-(*S)-G-(*S) -N2; S5:N1-(*S)-C-(*R)-G-(*R)-N2; S6:N1-(*S)-C-(*R)-G-(*S)-N2; S7:N1-(*S)-C-(*S)-G-(*R)-N2; S8:N1-(*S)-C-(*S)-G-(*S)-N2.

[0052] In some embodiments, this disclosure relates to oligonucleotide compositions that are chiral controlled because the compositions comprise predetermined levels of oligonucleotides of various oligonucleotide types, wherein the oligonucleotide type is defined by: 1) a base sequence; 2) a backbone bonding pattern; 3) a backbone chiral center pattern; and 4) a backbone phosphorus modification pattern; wherein each oligonucleotide of each oligonucleotide type independently comprises at least one common CpG region motif: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; wherein each (*R / S) is independently a chiral nucleotide bond, and N1 and N2 are each independently any nucleoside.

[0053] In some embodiments, this disclosure relates to compositions comprising a plurality of oligonucleotides, each of which: (a) hybridizes to a specific target sequence; (b) has a base sequence including at least one C residue in a CpG region motif present in all of the plurality of oligonucleotides (“common C residue”); and has a 5-methyl, a modified sugar motif, or both; and (c) comprises one or more chiral nucleotide inter-bonds such that each oligonucleotide is a specific stereoform, characterized by stereoisomorphism at each of the one or more chiral nucleotide inter-bonds, wherein stereoisomorphism identifies which stereoisomer is present at the specific chiral nucleotide inter-bond, wherein the composition is chirally controlled because it contains predetermined levels of each stereoform.

[0054] In some embodiments, this disclosure relates to oligonucleotide compositions that are chiral controlled because the compositions comprise predetermined levels of various oligonucleotide types, wherein the oligonucleotide type is defined by: 1) a base sequence; 2) a backbone bonding pattern; 3) a backbone chiral center pattern; and 4) a backbone phosphorus modification pattern; wherein the base sequence includes at least one C residue in a CpG region motif having a 5-methyl, modified sugar motif, or both; and the compositions have a reduced ability to activate TLR9-mediated and / or TLR9-related immune responses relative to chiral controlled compositions (because the compositions comprise random levels of various oligonucleotide types).

[0055] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides comprising a chain containing about 14 to about 49 nucleotides, wherein the chain comprises at least one copy of any CpG region motif disclosed herein.

[0056] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides comprising a chain containing about 14 to about 49 nucleotides, wherein the chain comprises at least one copy of any CpG region motif of any CpG oligonucleotide disclosed herein.

[0057] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides comprising a chain containing about 14 to about 49 nucleotides, wherein the chain comprises or consists of the sequence of any oligonucleotide disclosed herein.

[0058] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides comprising a chain containing 14 to 49 nucleotides, wherein the chain comprises at least one copy of any CpG region motif disclosed herein.

[0059] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising a chain containing 14 to 49 nucleotides, wherein the chain comprises at least one copy of any CpG region motif of any CpG oligonucleotide disclosed herein.

[0060] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising a strand containing at least one copy of the CpG region motif T-(*R)-C-(*R)-G-(*R)-T, wherein the CpG oligonucleotides are capable of stimulating an immune response in humans.

[0061] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a chain containing at least one copy of the CpG region motif T-(*R)-C-(*R)-G-(*R)-T-(*R)-Py, wherein the CpG oligonucleotides are capable of stimulating an immune response in humans.

[0062] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising a chain of at least two non-adjacent copies of a CpG region motif containing N1-(*R)-C-(*R)-G-(*R)-N2, wherein at least one phosphate thioester between the CpG region motifs is in the Sp conformation, and wherein the CpG oligonucleotide is capable of stimulating an immune response in humans.

[0063] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG region motif T-(*S)-C-(*S)-G-(*S)-T-(*S)-T, wherein the CpG oligonucleotides are capable of stimulating an immune response in humans.

[0064] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG region motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2, wherein the CpG oligonucleotides are capable of stimulating an immune response in humans.

[0065] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG region motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2, wherein at least one (*R / S) is (*R) and at least one (*R / S) is (*S), wherein the CpG oligonucleotide is capable of stimulating an immune response in humans.

[0066] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising a chain containing at least one copy of the CpG regional motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2, wherein at least one (*R / S) is (*R) and at least one (*R / S) is (*S), and wherein C is unmethylated, wherein the CpG oligonucleotide is capable of stimulating an immune response in humans.

[0067] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG region motif N1-(*R)-C-(*R)-G-(*S)-N2, wherein the CpG oligonucleotides are capable of stimulating an immune response in humans.

[0068] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG region motif N1-(*R)-C-(*S)-G-(*S)-N2, wherein the CpG oligonucleotides are capable of stimulating an immune response in humans.

[0069] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG region motif N1-(*R)-C-(*S)-G-(*R)-N2, wherein the CpG oligonucleotides are capable of stimulating an immune response in humans.

[0070] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG region motif N1-(*S)-C-(*R)-G-(*S)-N2, wherein the CpG oligonucleotides are capable of stimulating an immune response in humans.

[0071] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG region motif N1-(*S)-C-(*R)-G-(*R)-N2, wherein the CpG oligonucleotides are capable of stimulating an immune response in humans.

[0072] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a chain containing a CpG region motif N1-(*S)-C-(*S)-G-(*R)-N2, wherein the CpG oligonucleotides are capable of stimulating an immune response in humans.

[0073] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising a chain containing at least one copy of the CpG region motif Py-(*R / S)-C-(*R / S)-G-(*R / S)-Py, wherein at least one (*R / S) is (*R) and at least one (*R / S) is (*S), and wherein C is unmethylated, wherein the CpG oligonucleotide is capable of stimulating an immune response in humans.

[0074] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG region motif m5C-(*R)-m5C-(*R)-G-(*R)-N1, wherein all nucleosides are 2'-MOE, wherein the CpG oligonucleotides are capable of stimulating an immune response in humans.

[0075] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG region motif m5C-(*R)-m5C-(*R)-G-(*R)-Py, wherein all nucleosides are 2'-MOE, wherein the CpG oligonucleotides are capable of stimulating an immune response in humans.

[0076] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG regional motif N1-(*R)-m5C-(*R)-G-(*R)-N2, wherein N1 is methylated or unmethylated, and wherein all nucleosides are 2'-MOE, wherein the CpG oligonucleotides are capable of stimulating an immune response in humans.

[0077] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG regional motif N1-(*R)-m5C-(*R)-G-(*R)-Py, wherein N1 is methylated or unmethylated, and wherein all nucleosides are 2'-MOE, wherein the CpG oligonucleotides are capable of stimulating an immune response in humans.

[0078] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG region motif N1-(*R / S)-m5C-(*R / S)-G-(*R / S)-N2, wherein at least two of the (*R / S) are (*R), all nucleosides are 2'-MOE, and N1 and N2 are methylated or unmethylated, wherein the CpG oligonucleotides are capable of stimulating an immune response in humans.

[0079] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising a chain containing at least one copy of the CpG regional motif N1-(*R / S)-m5C-(*R / S)-G-(*R / S)-N2, wherein at least two of the (*R / S) are (*R), all nucleosides are 2'-MOE; and N1 and N2 are methylated or unmethylated, wherein the CpG oligonucleotides are capable of stimulating an immune response in humans.

[0080] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG regional motif N1-(*S)-[C]-(*R)-[G]-(*S)-N2, wherein N1 is 2'H, 2'-MOE, or 2'-OMe; [C] is C, m5C, 2'-MOE C, or 2'-MOE m5C; [G] is G, 2'-Ome G, or 2'-MOE G; and N2 is 2'H, 2'-MOE, or 2'-OMe, wherein the CpG oligonucleotide is capable of antagonizing an immune response in humans.

[0081] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG regional motif N1-(*S)-[C]-(*R)-[G]-(*S)-N2, wherein N1 is 2'H; [C] is C, m5C, 2'-MOE C, or 2'-MOE m5C; [G] is G, 2'-Ome G, or 2'-MOE G; and N2 is 2'H, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0082] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG regional motif N1-(*R)-[C]-(*R)-[G]-(*R)-Py, wherein N1 and Py are 2'H, 2'-MOE, or 2'OMe; [C] is C or 2'-MOE C; [G] is G or 2'-MOE G; and Py is 2'-H or 2'-MOE, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0083] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG regional motif N1-(*R)-[C]-(*R)-[G]-(*R)-N2, wherein N1 and N2 are 2'H, 2'-MOE, or 2'OMe; and [C] is 2'-MOE m5C; N2 is 2'-H or 2'-MOE, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0084] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a chain containing a CpG region motif Py-(*R)-C-(*R)-G-(*R)-Py, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0085] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a chain containing a CpG region motif Py-(*R)-C-(*R)-G-(*R)-Py, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0086] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a strand containing at least one copy of the CpG region motif Py-(*S)-C-(*R)-G-(*S)-Py.

[0087] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a chain containing a CpG region motif Py-(*S)-C-(*S)-G-(*S)-Py, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0088] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG region motif Py-(*R)-[C]-(*R)-[G]-(*R)-Py, wherein [C] is 2'-MOE C; and [G] is 2'-MOE G, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0089] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG regional motif Py-(*R)-[C]-(*R)-[G]-(*S)-Py, wherein [C] is 2'-MOE C; and [G] is 2'-MOE G, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0090] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG region motif Py-(*R)-[C]-(*R)-G-(*R)-Py, wherein [C] is C, 2'-OMe m5C, or 2'-MOE C, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0091] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG regional motif Py-(*R)-[C]-(*R)-[G]-(*R)-N1, wherein [C] is 2'-OMe m5C, and [G] is 2'-OMe G, and N1 is 2'-OMe, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0092] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG region motif Py-(*R)-[C]-(*R)-[G]-(*R)-Py, wherein [C] is 2'-OMe m5C and [G] is 2'-OMe G, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0093] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG region motif Py-(*R)-[C]-(*R)-[G]-(*R)-Py, wherein [C] is 2'-OMe C and [G] is 2'-OMe G, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0094] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG region motif Py-(*S)-[C]-(*R)-[G]-(*S)-Py, wherein [C] is 2'-MOE C and [G] is 2'-MOE G, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0095] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a chain containing the CpG region motif Py-(*R)-m5C-(*R)-G-(*R)-Py, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0096] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a chain containing the CpG region motif Py-(*R)-m5C-(*R)-G-(*R)-Py, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0097] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a chain containing the CpG region motif Py-(*S)-m5C-(*R)-G-(*S)-Py, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0098] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG region motif Py-(*S)-[C]-(*R)-[G]-(*S)-Py, wherein [C] is 2'-MOE m5C and [G] is 2'-MOE G, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0099] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG region motif Py-(*S)-[C]-(*R)-[G]-(*S)-Py, wherein [C] is 2'-OMe m5C and [G] is 2'-OMe G, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0100] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG region motif Py-(*S)-[C]-(*R)-[G]-(*S)-Py, wherein [C] is 2'-OMe C and [G] is 2'-OMe G, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0101] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a chain containing a CpG region motif Py-(*R)-[C]-(*R)-[G]-(*R)-Py, wherein both [C] and [G] are 2'-modified, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0102] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG regional motif N1-(*R)-[C]-(*R)-[G]-(*R)-N2, wherein both [C] and [G] are 2'-modified, wherein the CpG oligonucleotides are capable of antagonizing immune responses in humans.

[0103] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising a strand containing at least one copy of the CpG regional motif T-(*R)-C-(*R)-G-(*R)-T.

[0104] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG regional motif T-(*R)-C-(*R)-G-(*R)-T-(*R)-Py.

[0105] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising a chain of at least two non-adjacent copies of a CpG regional motif containing N1-(*R)-C-(*R)-G-(*R)-N2, wherein at least one phosphate thioester between the CpG regional motifs is in the Sp conformation.

[0106] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG regional motif T-(*S)-C-(*S)-G-(*S)-T-(*S)-T.

[0107] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG regional motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2.

[0108] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising a strand containing at least one copy of the CpG regional motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2, wherein at least one (*R / S) is (*R) and at least one (*R / S) is (*S).

[0109] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising a chain containing at least one copy of the CpG regional motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2, wherein at least one (*R / S) is (*R) and at least one (*R / S) is (*S), and wherein C is unmethylated.

[0110] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a strand containing the CpG regional motif N1-(*R)-C-(*R)-G-(*S)-N2.

[0111] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a strand containing at least one copy of the CpG regional motif N1-(*R)-C-(*S)-G-(*S)-N2.

[0112] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG regional motif N1-(*R)-C-(*S)-G-(*R)-N2.

[0113] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a strand containing at least one copy of the CpG regional motif N1-(*S)-C-(*R)-G-(*S)-N2.

[0114] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a strand containing at least one copy of the CpG regional motif N1-(*S)-C-(*R)-G-(*R)-N2.

[0115] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a strand containing at least one copy of the CpG regional motif N1-(*S)-C-(*S)-G-(*R)-N2.

[0116] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising a chain containing at least one copy of the CpG regional motif Py-(*R / S)-C-(*R / S)-G-(*R / S)-Py, wherein at least one (*R / S) is (*R) and at least one (*R / S) is (*S), and wherein C is unmethylated.

[0117] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG regional motif m5C-(*R)-m5C-(*R)-G-(*R)-N1, wherein all nucleosides are 2'-MOE.

[0118] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a chain containing at least one copy of the CpG regional motif m5C-(*R)-m5C-(*R)-G-(*R)-Py, wherein all nucleotides are 2'-MOE.

[0119] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG regional motif N1-(*R)-m5C-(*R)-G-(*R)-N2, wherein N1 is methylated or unmethylated, and all nucleosides are 2'-MOE.

[0120] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG regional motif N1-(*R)-m5C-(*R)-G-(*R)-Py, wherein N1 is methylated or unmethylated, and all nucleosides are 2'-MOE.

[0121] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising a chain containing at least one copy of the CpG regional motif N1-(*R / S)-m5C-(*R / S)-G-(*R / S)-N2, wherein at least two of the (*R / S) are (*R), all nucleosides are 2'-MOE, and N1 and N2 are methylated or unmethylated.

[0122] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising a chain containing at least one copy of the CpG regional motif N1-(*R / S)-m5C-(*R / S)-G-(*R / S)-N2, wherein at least two of (*R / S) are (*R), all nucleosides are 2'-MOE; and N1 and N2 are methylated or unmethylated.

[0123] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising a strand containing at least one copy of the CpG regional motif N1-(*S)-[C]-(*R)-[G]-(*S)-N2, wherein N1 is 2'H, 2'-MOE, or 2'-OMe; [C] is C, m5C, 2'-MOE C, or 2'-MOE m5C; [G] is G, 2'-Ome G, or 2'-MOE G; and N2 is 2'H, 2'-MOE, or 2'-OMe.

[0124] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG regional motif N1-(*S)-[C]-(*R)-[G]-(*S)-N2, wherein N1 is 2'H; [C] is C, m5C, 2'-MOE C, or 2'-MOE m5C; [G] is G, 2'-Ome G, or 2'-MOE G; and N2 is 2'H.

[0125] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG regional motif N1-(*R)-[C]-(*R)-[G]-(*R)-Py, wherein N1 and Py are 2'H, 2'-MOE, or 2'OMe; and [C] is C or 2'-MOE C; and [G] is G or 2'-MOEG; and Py is 2'-H or 2'-MOE.

[0126] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising a strand containing at least one copy of the CpG regional motif N1-(*R)-[C]-(*R)-[G]-(*R)-N2, wherein N1 and N2 are 2'H, 2'-MOE, or 2'OMe; and [C] is 2'-MOE m5C; and N2 is 2'-H or 2'-MOE.

[0127] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a strand containing the CpG region motif Py-(*R)-C-(*R)-G-(*R)-Py.

[0128] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a strand containing the CpG region motif Py-(*R)-C-(*R)-G-(*R)-Py.

[0129] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a strand containing at least one copy of the CpG region motif Py-(*S)-C-(*R)-G-(*S)-Py.

[0130] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a strand containing at least one copy of the CpG region motif Py-(*S)-C-(*S)-G-(*S)-Py.

[0131] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG regional motif Py-(*R)-[C]-(*R)-[G]-(*R)-Py, wherein [C] is 2'-MOE C; and [G] is 2'-MOE G.

[0132] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG regional motif Py-(*R)-[C]-(*R)-[G]-(*S)-Py, wherein [C] is 2'-MOE C; and [G] is 2'-MOE G.

[0133] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG regional motif Py-(*R)-[C]-(*R)-G-(*R)-Py, wherein [C] is C, 2'-OMe m5C, or 2'-MOE C.

[0134] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG regional motif Py-(*R)-[C]-(*R)-[G]-(*R)-N1, wherein [C] is 2'-OMe m5C, and [G] is 2'-OMe G, and N1 is 2'-OMe.

[0135] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG regional motif Py-(*R)-[C]-(*R)-[G]-(*R)-Py, wherein [C] is 2'-OMe m5C and [G] is 2'-OMe G.

[0136] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG regional motif Py-(*R)-[C]-(*R)-[G]-(*R)-Py, wherein [C] is 2'-OMe C and [G] is 2'-OMe G.

[0137] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG regional motif Py-(*S)-[C]-(*R)-[G]-(*S)-Py, wherein [C] is 2'-MOE C and [G] is 2'-MOE G.

[0138] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG region motif Py-(*R)-m5C-(*R)-G-(*R)-Py.

[0139] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG region motif Py-(*R)-m5C-(*R)-G-(*R)-Py.

[0140] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG regional motif Py-(*S)-m5C-(*R)-G-(*S)-Py.

[0141] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG regional motif Py-(*S)-[C]-(*R)-[G]-(*S)-Py, wherein [C] is 2'-MOE m5C and [G] is 2'-MOE G.

[0142] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG regional motif Py-(*S)-[C]-(*R)-[G]-(*S)-Py, wherein [C] is 2'-OMe m5C and [G] is 2'-OMe G.

[0143] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG regional motif Py-(*S)-[C]-(*R)-[G]-(*S)-Py, wherein [C] is 2'-OMe C and [G] is 2'-OMe G.

[0144] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of the CpG regional motif Py-(*R)-[C]-(*R)-[G]-(*R)-Py, wherein [C] and [G] are both 2'-modified.

[0145] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides, the CpG oligonucleotides comprising at least one copy of a CpG regional motif N1-(*R)-[C]-(*R)-[G]-(*R)-N2, wherein [C] and [G] are both 2'-modified.

[0146] In some embodiments of the methods and compositions disclosed herein, the CpG oligonucleotide comprises two or more CpG region motifs as described herein.

[0147] In some embodiments, this disclosure relates to compositions of any of the foregoing embodiments, wherein at least one nucleotide bond is a dithiophosphate.

[0148] In some embodiments, this disclosure relates to compositions of any of the foregoing embodiments, wherein at least one internucleotide bond is selected from: dithiophosphates, aminophosphates, boron phosphonates, amide linkers, or compounds of formula (I): Where R 3 Selected from OH, SH, NH2, BH3, CH3, C 1-6 Alkyl, C 6-10 Aryl, C 1-6 Alkoxy and C 6-10 aryloxy group, where C 1-6 Alkyl and C 6-10 The aryl group is unsubstituted or optionally independently substituted by one to three groups, said groups being independently selected from halogens, hydroxyl groups, and NH2 and their suitable salts; and R 4 Selected from O, S, NH or CH2.

[0149] In some embodiments, this disclosure relates to compositions of any of the foregoing embodiments, wherein at least one nucleotide bond is selected from:

[0150]

[0151]

[0152]

[0153] In some embodiments, this disclosure relates to a method for stimulating an immune response in human cells, the method comprising the step of contacting human cells with a CpG oligonucleotide composition of any of the foregoing embodiments, wherein the CpG oligonucleotide is capable of stimulating a TLR9-mediated or TLR9-related immune response.

[0154] In some embodiments, this disclosure relates to a method for antagonizing an immune response in human cells, the method comprising the step of contacting human cells with a CpG oligonucleotide composition of any of the foregoing embodiments, wherein the CpG oligonucleotide is capable of antagonizing a TLR9-mediated or TLR9-related immune response.

[0155] In some embodiments, this disclosure relates to a method for modulating an immune response in a subject, the method comprising the step of administering a composition of any of the foregoing embodiments, wherein the CpG oligonucleotide is capable of modulating a TLR9-mediated or TLR9-related immune response.

[0156] In some embodiments, this disclosure relates to a method for stimulating an immune response in a person in need, the method comprising the step of contacting the person with an immune-effective amount of any of the preceding embodiments of a CpG oligonucleotide composition.

[0157] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the person suffers from a disease.

[0158] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the person suffers from a disease suitable for treatment with an excited immune response.

[0159] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the person suffers from a disease selected from infectious diseases, genetic diseases, and cancer.

[0160] In some embodiments, this disclosure relates to a method for increasing an immune response in a subject to an immune-active component, comprising administering an immune-effective amount of (a) any of the compositions in the foregoing embodiments and (b) the immune-active component.

[0161] In some embodiments, this disclosure relates to compositions of any of the foregoing embodiments, wherein the immunologically active component is selected from: immunogens, antigens, toxins, viruses, bacteria, fungi, infectious agents, cancer antigens, pathogens and their components.

[0162] In some embodiments, this disclosure relates to a method for identifying a second oligonucleotide composition that, compared to a first oligonucleotide composition, provides reduced immunostimulation in a subject, the method comprising the steps of: (a) measuring immunostimulation mediated by the first oligonucleotide composition, wherein the first oligonucleotide composition comprises an oligonucleotide having a common base sequence comprising at least one CpG region; (b) measuring immunostimulation mediated by a second oligonucleotide composition, wherein the second oligonucleotide composition has the same common base sequence as the first oligonucleotide composition, and wherein the CpG region of the oligonucleotide of the second composition differs from the corresponding region of the oligonucleotide of the first oligonucleotide composition in terms of the pattern of its chiral center; and (c) optionally repeating step (b), each time using a different second oligonucleotide composition, and selecting a second oligonucleotide composition that mediates less immunostimulation than the first oligonucleotide composition. In some embodiments of the methods and compositions of this disclosure, the CpG oligonucleotide comprises two or more CpG region motifs as described herein.

[0163] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the first oligonucleotide is immunostimulatory in human cells.

[0164] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide comprises at least one thiophosphate in the Sp conformation and at least one thiophosphate in the Rp conformation of a CpG region motif.

[0165] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide does not contain the agonistic CpG region motif described herein.

[0166] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide does not contain the antagonistic CpG region motif described herein.

[0167] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide does not contain the agonist or antagonist CpG region motif described herein.

[0168] In some embodiments, this disclosure relates to a method for improving the characteristics of a CpG oligonucleotide composition comprising at least two CpG oligonucleotides, wherein the method comprises the steps of: reducing the amount of at least one of the at least two CpG oligonucleotides in the composition, wherein each of the at least two CpG oligonucleotides is stereochemically defined by a CpG region motif, and wherein at least one of the at least two CpG oligonucleotides is determined to have poorer characteristics relative to the CpG oligonucleotide composition.

[0169] In some embodiments, this disclosure relates to a method for improving the characteristics of a stereorandom CpG oligonucleotide composition, wherein the method includes the steps of: reducing the amount of at least one of at least two CpG oligonucleotides in the composition, wherein each of the at least two CpG oligonucleotides is stereochemically defined by a CpG region motif, and wherein at least one of the at least two CpG oligonucleotides is determined to have inferior characteristics relative to the CpG oligonucleotide composition, wherein the characteristics are increased activity, improved efficacy, reduced toxicity, increased stability, increased delivery, or increased biological half-life.

[0170] In some embodiments, this disclosure relates to a method for designing a second oligonucleotide that mediates reduced immune stimulation in human cells relative to immune stimulation mediated by a first oligonucleotide, the method comprising the steps of: (a) measuring immune stimulation mediated by the first oligonucleotide, wherein the first oligonucleotide has a defined base sequence comprising at least one CpG region; (b) measuring immune stimulation mediated by one or more second oligonucleotides, wherein the second oligonucleotide has the same base sequence as the first oligonucleotide and further comprises one or more thiophosphates in a CpG region motif, wherein the stereochemistry of the thiophosphates in the CpG region motif of the second oligonucleotide differs from the stereochemistry of any thiophosphates in the CpG region motif of the first oligonucleotide, wherein steps (a) and (b) may be performed in any order; and (c) selecting a second oligonucleotide that mediates less immune stimulation than the first oligonucleotide.

[0171] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the first oligonucleotide is immunostimulatory in human cells.

[0172] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide comprises at least one thiophosphate in the Sp conformation and at least one thiophosphate in the Rp conformation of a CpG region motif.

[0173] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide does not contain the agonistic CpG region motif described herein.

[0174] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide does not contain the antagonistic CpG region motif described herein.

[0175] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide does not contain the agonist or antagonist CpG region motif described herein.

[0176] In some embodiments, this disclosure relates to a method for reducing immune stimulation mediated by a first oligonucleotide in human cells, the method comprising the steps of: (a) providing a first oligonucleotide having a defined base sequence comprising at least one CpG region; and measuring immune stimulation mediated by the first oligonucleotide in human cells; (b) providing one or more second oligonucleotides having the same base sequence as the first oligonucleotide and further comprising one or more thiophosphates in a CpG region, wherein the stereochemistry of the thiophosphates in the CpG region of the second oligonucleotide differs from the stereochemistry of any thiophosphates in the CpG region of the first oligonucleotide; and measuring immune stimulation of the second oligonucleotide in human cells, wherein steps (a) and (b) may be performed in any order; (c) selecting a second oligonucleotide that mediates less immune stimulation than the first oligonucleotide; and (d) contacting cells with the second oligonucleotide.

[0177] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the first oligonucleotide is immunostimulatory in human cells.

[0178] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide comprises at least one thiophosphate in the Sp conformation and at least one thiophosphate in the Rp conformation of a CpG region motif.

[0179] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide does not contain the agonistic CpG region motif described herein.

[0180] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide does not contain the antagonistic CpG region motif described herein.

[0181] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide does not contain the agonist or antagonist CpG region motif described herein.

[0182] In some embodiments, this disclosure relates to compositions comprising oligonucleotides, wherein the oligonucleotides mediate less immune stimulation than a reference oligonucleotide, wherein a second oligonucleotide is selected using a method comprising the following steps: (a) providing a reference oligonucleotide having a defined base sequence comprising at least one CpG region; and measuring immune stimulation mediated by the reference oligonucleotide in human cells; (b) providing one or more second oligonucleotides having the same base sequence as the reference oligonucleotide and further comprising one or more thiophosphates in a CpG region, wherein the stereochemistry of the thiophosphates in the CpG region of the second oligonucleotide differs from the stereochemistry of any thiophosphates in the CpG region of the reference oligonucleotide; and measuring immune stimulation of the second oligonucleotide in human cells, wherein steps (a) and (b) may be performed in any order; and (c) selecting a second oligonucleotide that mediates less immune stimulation than the reference oligonucleotide.

[0183] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the reference oligonucleotide is immunostimulatory in human cells.

[0184] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide comprises at least one thiophosphate in the Sp conformation and at least one thiophosphate in the Rp conformation of a CpG region motif.

[0185] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide does not contain the agonistic CpG region motif described herein.

[0186] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide does not contain the antagonistic CpG region motif described herein.

[0187] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide does not contain the agonist or antagonist CpG region motif described herein.

[0188] In some embodiments, this disclosure relates to a method of administering a therapeutic oligonucleotide to a patient, wherein the therapeutic oligonucleotide mediates less immune stimulation than a first oligonucleotide, wherein the therapeutic oligonucleotide is selected using a method comprising the following steps: (a) providing a first oligonucleotide having a defined base sequence comprising at least one CpG region; and measuring immune stimulation mediated by the first oligonucleotide in human cells; (b) providing one or more second oligonucleotides having the same base sequence as the first oligonucleotide and further comprising one or more thiophosphates in a CpG region, wherein the stereochemistry of the thiophosphates in the CpG region of the second oligonucleotide differs from the stereochemistry of any thiophosphates in the CpG region of the first oligonucleotide; and measuring immune stimulation of the second oligonucleotide in human cells, wherein steps (a) and (b) may be performed in any order; and (c) selecting the second oligonucleotide that mediates less immune stimulation than the first oligonucleotide as the therapeutic oligonucleotide.

[0189] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the first oligonucleotide is immunostimulatory in human cells.

[0190] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide comprises at least one thiophosphate in the Sp conformation and at least one thiophosphate in the Rp conformation of a CpG region motif.

[0191] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide does not contain the agonistic CpG region motif described herein.

[0192] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide does not contain the antagonistic CpG region motif described herein.

[0193] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the second oligonucleotide does not contain the agonist or antagonist CpG region motif described herein.

[0194] In some embodiments, this disclosure relates to a method of administering a composition comprising a first plurality of oligonucleotides, each oligonucleotide: (a) hybridizing with a specific target sequence; and (b) having a base sequence comprising at least one CpG region motif (“common CpG region motif”) present in all of the plurality of oligonucleotides, the CpG region motif having the structure: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; wherein each (*R / S) is independently a chiral internucleotide bond, wherein the composition is chiral controlled because for each common CpG region motif it contains predetermined levels of each stereoisomer 1-8 (S1-S8): S1: N1-(*R)-C-(*R)-G-(*R)-N 2; S2: N1-(*R)-C-(*R)-G-(*S)-N2; S3: N1-(*R)-C-(*S)-G-(*R)-N2; S4: N1-(*R)-C-(*S)-G-(*S)-N2; S5: N1-(*S)-C-(*R)-G-(*R)-N2; S6: N1-(*S)-C-(*R)-G-(*S)-N2; S7: N1-(*S)-C-(*S)-G-(*R)-N2; S8: N1-(*S)-C-(*S)-G-(*S)-N2; wherein the composition is characterized by reduced immune stimulation relative to a reference composition, which differs from the composition in that it is stereorandom with respect to the internucleotide bonding of at least one CpG region motif.

[0195] In some embodiments, this disclosure relates to, in some embodiments, an improvement in the method of applying an oligonucleotide composition comprising a plurality of oligonucleotides having a common base sequence, comprising: applying a composition comprising a first plurality of oligonucleotides, each of the oligonucleotides: (a) hybridizes to a specific target sequence; and (b) has a base sequence comprising at least one CpG region motif (“common CpG region motif”) present in all of the plurality of oligonucleotides, the CpG region motif having the structure: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; wherein each (*R / S) is independently a chiral internucleotide bond, wherein the composition is chirally controlled because for each common CpG region motif it contains predetermined levels of each stereoisomer 1-8 (S1-S8): S1: N1-(*R)-C-(*R)-G-(*R)-N2; S2: N1-(*R)-C-(*R)-G-(*S)-N2; S3: N1-(*R)-C-(*S)- G-(*R)-N2; S4: N1-(*R)-C-(*S)-G-(*S)-N2; S5: N1-(*S)-C-(*R)-G-(*R)-N2; S6: N1-(*S S7: N1-(*S)-C-(*S)-G-(*S)-N2; S8: N1-(*S)-C-(*S)-G-(*S)-N2; wherein the composition is characterized by reduced immune stimulation relative to a reference composition, which differs from the composition in that it is stereorandom with respect to the internucleotide bonding of at least one CpG region motif.

[0196] In some embodiments, this disclosure relates to a method of administering a chiral-controlled oligonucleotide composition, said oligonucleotide composition being chiral-controlled because the composition comprises predetermined levels of oligonucleotides of various oligonucleotide types, wherein the oligonucleotide type is defined by: 1) a base sequence; 2) a backbone bonding pattern; 3) a backbone chiral center pattern; and 4) a backbone phosphorus modification pattern; wherein each oligonucleotide of each oligonucleotide type independently comprises at least one copy of a CpG region motif: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; wherein each (*R / S) is independently a chiral internucleotide bond; the oligonucleotides of each oligonucleotide have a common base sequence; and the chiral-controlled oligonucleotide composition exhibits reduced immunostimulation relative to a reference oligonucleotide composition, which is a stereorandom oligonucleotide composition comprising oligonucleotides having the same common base sequence, or a chiral-controlled oligonucleotide composition comprising oligonucleotides having the same common base sequence but different oligonucleotide types.

[0197] In some embodiments, in a method of applying an oligonucleotide composition comprising a plurality of oligonucleotides having a common base sequence, this disclosure relates to an improvement including: applying a chiral-controlled oligonucleotide composition, said oligonucleotide composition being chiral-controlled because said composition comprises predetermined levels of oligonucleotides of various oligonucleotide types, wherein the oligonucleotide type is defined by: 1) a base sequence; 2) a backbone bonding pattern; 3) a backbone chiral center pattern; and 4) a backbone phosphorus modification pattern; wherein each oligonucleotide of each oligonucleotide type independently comprises at least one CpG region motif. Copy: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; wherein each (*R / S) is independently a chiral nucleotide bond; the oligonucleotides of each oligonucleotide type have a common base sequence; and the chiral controlled oligonucleotide composition exhibits reduced immune stimulation relative to a reference oligonucleotide composition, which is a stereorandom oligonucleotide composition containing oligonucleotides having the same common base sequence, or a chiral controlled oligonucleotide composition containing oligonucleotides having the same common base sequence but different oligonucleotide types.

[0198] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the reference oligonucleotide composition is a chiral-controlled oligonucleotide composition having the same common base sequence but different main-chain chiral center patterns.

[0199] In some embodiments, this disclosure relates to a method of any of the foregoing embodiments, wherein the reference oligonucleotide composition is a chiral-controlled oligonucleotide composition having the same common base sequence but different main-chain chiral center patterns.

[0200] In some embodiments, this disclosure relates to a method of applying a chiral-controlled oligonucleotide composition, wherein the composition comprises a plurality of oligonucleotides, each of the oligonucleotides: (a) hybridizes to a specific target sequence; (b) has a base sequence comprising at least one C residue in a CpG present in all of the plurality of oligonucleotides (“common C residue”), and has a 5-methyl group, a 2'-OMe group in its sugar moiety, or both; and (c) comprises one or more chiral nucleotide inter-bondings such that each oligonucleotide is a specific stereoform, characterized by stereoisomorphism at each of the one or more chiral nucleotide inter-bondings [stereoisomorphism = which stereoisomer is present at a specific chiral bond], wherein the composition is chiral-controlled because it contains a predetermined level of each stereoform, and the composition is substantially free of such stereoforms that individually and in the absence of other stereoforms activate TLR9.

[0201] In some embodiments, this disclosure relates to a method comprising applying a chiral-controlled oligonucleotide composition, wherein the composition comprises a plurality of oligonucleotides, each of the oligonucleotides: (a) hybridizes to a specific target sequence; (b) has a base sequence comprising at least one C residue in a CpG present in all of the plurality of oligonucleotides (“common C residue”); and has a 5-methyl group, a 2'-OMe group in its sugar moiety, or both; and (c) comprises one or more chiral nucleotide bonds; this disclosure relates to improvements comprising applying a composition comprising a plurality of oligonucleotides, each of the oligonucleotides: (a) hybridizes to the same target sequence; (b) has a base sequence comprising at least one C residue in a CpG present in all of the plurality of oligonucleotides (“common C residue”); and has a 5-methyl group, a 2'-OMe group in its sugar moiety, or both; and (c) comprises one or more chiral nucleotide bonds; The composition comprises a base sequence of the same common C residue in a CpG region motif having a 5-methyl group, a 2'-OMe group in its sugar motif, or both; and (c) comprises one or more chiral nucleotide inter-bondings such that each oligonucleotide is a specific stereoform, characterized by stereoisomorphism at each of the one or more chiral nucleotide inter-bondings [stereoisomorphism = which stereoisomer is present at a specific chiral bond], wherein the composition is chiral controlled because it contains a predetermined level of each stereoform, and the composition is substantially free of such stereoforms that individually and in the absence of other stereoforms activate TLR9.

[0202] In some embodiments, this disclosure relates to a method of administering a composition that is chiral-controlled because the composition comprises predetermined levels of oligonucleotides of various oligonucleotide types, wherein the oligonucleotide type is defined by: 1) a base sequence; 2) a backbone bonding pattern; 3) a backbone chiral center pattern; and 4) a backbone phosphorus modification pattern; wherein the base sequence comprises at least one C residue in a CpG region motif having a 5-methyl group, a 2'-OMe group in its sugar motif, or both; and the composition is substantially free of oligonucleotides of different oligonucleotide types having the same sequence, wherein the oligonucleotides individually and in the absence of other stereotypes activate TLR9.

[0203] In some embodiments, in a method comprising applying an oligonucleotide composition with a common base sequence, wherein the common base sequence comprises at least one C residue in a CpG region motif having a 5-methyl group, a 2'-OMe group in its sugar motif, or both; this disclosure relates to improvements including the application of a composition that is chiral-controlled because the composition comprises oligonucleotides of various oligonucleotide types at predetermined levels, wherein the oligonucleotide type is defined by: 1) a base sequence; 2) a backbone bonding pattern; 3) a backbone chiral center pattern; and 4) a backbone phosphorus modification pattern; wherein the oligonucleotides of various oligonucleotide types have the same common sequence, the base sequence comprising at least one C residue in a CpG region motif having a 5-methyl group, a 2'-OMe group in its sugar motif, or both; and the composition substantially does not contain oligonucleotides of different oligonucleotide types having the same sequence, wherein the oligonucleotides individually and in the absence of other stereotypes activate TLR9.

[0204] In some embodiments, this disclosure relates to a method including the step of administering a composition of any of the foregoing embodiments to a subject.

[0205] In some embodiments, this disclosure relates to a method of stimulating an immune response in a subject, and this disclosure relates to an improvement including administering to a subject any of the compositions described in the foregoing embodiments.

[0206] In some embodiments, this disclosure relates to a method of stimulating an immune response in a human subject, and this disclosure relates to an improvement including administering to a subject any of the compositions described in the foregoing embodiments.

[0207] In some embodiments, this disclosure relates to compositions or methods of any of the foregoing embodiments, wherein the oligonucleotides are structurally identical.

[0208] In some embodiments, this disclosure relates to compositions or methods of any of the foregoing embodiments, wherein each (*R / S) is independently a thiophosphate bond.

[0209] In some embodiments, this disclosure relates to compositions or methods of any of the foregoing embodiments, wherein the oligonucleotide comprises Rp phosphate thioester bonds within a CpG region motif and Sp phosphate thioester bonds within a CpG region motif.

[0210] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the at least one CpG region motif comprises at least an Rp thiophosphate bond and at least one thiophosphate bond within the CpG region motif.

[0211] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the oligonucleotide comprises at least 5 nucleotides.

[0212] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the oligonucleotide comprises no more than 49 nucleotides.

[0213] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the oligonucleotide comprises five or more chiral nucleotides bonded together;

[0214] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the oligonucleotide comprises 10 or more chiral nucleotides bonded together.

[0215] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the oligonucleotide comprises 15 or more chiral nucleotides bonded together.

[0216] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein one or more nucleotides in the CpG region are RNA or DNA nucleotides.

[0217] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein at least one sugar is unmodified.

[0218] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein at least one sugar is modified.

[0219] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein at least one sugar is modified, wherein the modification is 2'-OMe, 2'-MOE, 2'-F, or 2'-OR, wherein R is an optionally substituted C 1-6 alkyl.

[0220] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the modification is 2'-OR, where R is an optionally substituted C. 1-6 alkyl.

[0221] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein at least five sugars are modified.

[0222] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein at least five sugars are modified, wherein the modification is 2'-OMe, 2'-MOE, 2'-F, or 2'-OR, wherein R is an optionally substituted C 1-6 alkyl.

[0223] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein at least ten sugars are modified.

[0224] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein at least ten sugars are modified, wherein the modification is 2'-OMe, 2'-MOE, 2'-F, or 2'-OR, wherein R is an optionally substituted C 1-6 alkyl.

[0225] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the chain further comprises a nucleotide substitute.

[0226] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the chain further comprises morpholine, PNA, LNA, BNA, TNA, GNA, ANA, FANA, CeNa, HNA, or UNA.

[0227] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein at least one nucleotide bond is modified.

[0228] In some embodiments, this disclosure relates to compositions or methods of any of the foregoing embodiments, wherein at least one nucleotide bond is selected from: (I), wherein R3 is selected from O", S", NH2, BH3, CH3, C 1-6 Alkyl, C6-10 Aryl, C 1-6 Alkoxy and C 6-10 aryloxy group, where C 1-6 Alkyl and C 6-10 The aryl group is unsubstituted or optionally substituted independently by one to three groups, which are independently selected from halogens, hydroxyl groups, and NH2; and R4 is selected from O, S, NH, or CH2.

[0229] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein at least one nucleotide bond is a dithiophosphate.

[0230] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the CpG oligonucleotide further comprises a second strand.

[0231] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the CpG oligonucleotide is capable of stimulating an immune response.

[0232] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the CpG oligonucleotide is capable of stimulating an immune response in human cells.

[0233] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein an immune response is activated in human cells or in a human.

[0234] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the CpG oligonucleotide further comprises a second strand.

[0235] In some embodiments, this disclosure relates to compositions or methods of any of the foregoing embodiments, wherein each oligonucleotide in the plurality / composition has the same base sequence.

[0236] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the composition is substantially free of at least stereoisomer S8 for at least one common CpG region motif, such that a predetermined level is considered substantially zero.

[0237] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the composition is substantially free of at least seven stereoisomers for at least one common CpG region motif, such that a predetermined level is considered substantially zero for the seven stereoisomers.

[0238] In some embodiments, this disclosure relates to compositions or methods of any of the foregoing embodiments, wherein each oligonucleotide in the composition comprises at least one achiral nucleotide bonded outside the CpG region motif.

[0239] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the composition is substantially racemic for at least one chiral nucleotide bond outside the CpG region motif.

[0240] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the “C” residue of the CpG region motif is methylated, and the composition is substantially free of at least stereoisomers.

[0241] In some embodiments, this disclosure relates to compositions or methods of any of the foregoing embodiments, wherein the compositions are capable of activating TLR9-related or TLR9-mediated immune responses, which are lower than those of stereorandom compositions of oligonucleotides having the same sequence.

[0242] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the C residue in the CpG region motif comprises a 2'-OMe group in its sugar motif.

[0243] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the C residue in the CpG region motif is a 5-methyl-2'-OMe C residue.

[0244] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein one or more nucleotides in the CpG region are RNA or DNA.

[0245] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein at least one sugar is unmodified.

[0246] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein at least one sugar is modified.

[0247] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein at least one sugar is modified, wherein the modification is 2'-OMe, 2'-MOE, 2'-F, or 2'-OR, wherein R is an optionally substituted C 1-6 alkyl.

[0248] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein at least five sugars are modified.

[0249] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein at least five sugars are modified, wherein the modification is 2'-OMe, 2'-MOE, 2'-F, or 2'-OR, wherein R is an optionally substituted C 1-6 alkyl.

[0250] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein at least ten sugars are modified.

[0251] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein at least ten sugars are modified, wherein the modification is 2'-OMe, 2'-MOE, 2'-F, or 2'-OR, wherein R is an optionally substituted C 1-6 alkyl.

[0252] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the chain comprises a nucleotide substitute.

[0253] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein the chain further comprises morpholine, PNA, LNA, BNA, TNA, GNA, ANA, FANA, CeNa, HNA, or UNA.

[0254] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein at least one nucleotide bond is modified.

[0255] In some embodiments, this disclosure relates to compositions or methods of any of the foregoing embodiments, wherein at least one nucleotide bond is selected from: (I), wherein R3 is selected from O", S", NH2, BH3, CH3, C 1-6 Alkyl, C 6-10 Aryl, C 1-6 Alkoxy and C 6-10 aryloxy group, where C 1-6 Alkyl and C 6-10 The aryl group is unsubstituted or optionally substituted independently by one to three groups, which are independently selected from halogens, hydroxyl groups, and NH2; and R4 is selected from O, S, NH, or CH2.

[0256] In some embodiments, this disclosure relates to compositions or methods of any of the foregoing embodiments, which further comprise immune-active components.

[0257] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, which further comprises an immunologically active component selected from: immunogens, antigens, toxins, viruses, bacteria, fungi, infectious agents, cancer antigens, pathogens, and components thereof.

[0258] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, which further comprises an immunologically active component, wherein the CpG oligonucleotide is conjugated to the immunologically active component.

[0259] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, which further comprises an immunologically active component selected from: immunogens, antigens, toxins, viruses, bacteria, fungi, infectious agents, cancer antigens, pathogens and their components, wherein the CpG oligonucleotide is conjugated to the immunologically active component.

[0260] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, which further includes additional adjuvants, stabilizers, preservatives, or antibiotics.

[0261] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein *R is a modified internucleotide bond in the Rp conformation, *S is a modified internucleotide bond in the Sp conformation, and *R / S is a modified internucleotide bond in the Rp or Sp conformation.

[0262] In some embodiments, this disclosure relates to a composition or method of any of the foregoing embodiments, wherein *R is a thiophosphate conformed to Rp, *S is a thiophosphate conformed to Sp, and *R / S is a thiophosphate conformed to Rp or Sp.

[0263] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides comprising a chain containing about 14 to about 49 nucleotides, wherein the chain comprises at least two copies of the CpG regional motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2, wherein at least one (*R / S) is a modified internucleotide bond in the Rp conformation and at least one (*R / S) is a modified internucleotide bond in the Sp conformation, and N1 and N2 are each independently any nucleoside.

[0264] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides comprising a chain containing about 14 to about 49 nucleotides, wherein the chain comprises at least two copies of the CpG regional motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2, wherein at least one (*R / S) is a phosphate thioester in the Rp conformation and at least one (*R / S) is a phosphate thioester in the Sp conformation, and N1 and N2 are each independently any nucleoside.

[0265] In some embodiments, this disclosure relates to compositions comprising CpG oligonucleotides comprising a chain containing about 14 to about 49 nucleotides, wherein the chain comprises at least two copies of the CpG regional motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2, wherein at least one (*R / S) is a phosphate thioester in the Rp conformation and at least one (*R / S) is a phosphate thioester in the Sp conformation, and N1 and N2 are each independently any nucleoside.

[0266] In some embodiments, this disclosure relates to a method or composition of any of the foregoing embodiments, wherein the CpG oligonucleotide comprises two or more copies of a CpG region motif.

[0267] In some embodiments, this disclosure relates to a method or composition of any of the foregoing embodiments, wherein the CpG oligonucleotide comprises two or more copies of the CpG region motif disclosed herein.

[0268] In some embodiments, this disclosure relates to a method or composition of any of the foregoing embodiments, wherein the CpG oligonucleotide comprises two or more CpG region motifs disclosed herein.

[0269] In some embodiments, this disclosure relates to a method or composition of any of the foregoing embodiments, wherein the CpG oligonucleotide comprises two or more CpG region motifs disclosed herein, wherein the motifs are distinct from one another.

[0270] In some embodiments, this disclosure relates to a method or composition of any of the foregoing embodiments, wherein the CpG oligonucleotide comprises two or more CpG region motifs disclosed herein, wherein the motifs are identical to each other.

[0271] In some embodiments, this disclosure relates to a method or composition of any of the foregoing embodiments, wherein the CpG oligonucleotide is an agonist.

[0272] In some embodiments, this disclosure relates to a method or composition of any of the foregoing embodiments, wherein the CpG oligonucleotide is agonistic in human cells.

[0273] In some embodiments, this disclosure relates to a method or composition of any of the foregoing embodiments, wherein the CpG oligonucleotide is agonistic, as measured by increased secretion of cytokines, interferon-α, interferon-γ, IL-4, IL-6, IL-8, IL-10, IL-12 and / or TNF-α, and / or increased NF-κβ activity.

[0274] In some embodiments, this disclosure relates to a method or composition of any of the foregoing embodiments, wherein the CpG oligonucleotide is antagonistic.

[0275] In some embodiments, this disclosure relates to a method or composition of any of the foregoing embodiments, wherein the CpG oligonucleotide is antagonistic in human cells.

[0276] In some embodiments, this disclosure relates to a method or composition of any of the foregoing embodiments, wherein the CpG oligonucleotide is antagonistic, as measured by reduced secretion of cytokines, interferon-α, interferon-γ, IL-4, IL-6, IL-8, IL-10, IL-12 and / or TNF-α, and / or increased NF-κβ activity. Attached Figure Description

[0277] Figure 1 The stereochemistry of the CpG oligonucleotide backbone was shown to affect mouse TLR9 activity in agonist and antagonist assays; data were derived from the SMAD7 series. CpG dinucleotides are... underlined .exist Figure 1 In various other graphs, the agonistic activity of CpG oligonucleotides was measured as an increase in NF-κβ activity. In various other graphs, the antagonistic activity of CpG oligonucleotides was measured as a decrease in NF-κβ activity (competing with TLR9 agonists, such as ODN2006 for human studies or ODN1826 for mouse studies).

[0278] Figure 2 Stereochemical regulation of mouse TLR9 activity by CpG and flanking bonds was demonstrated; data were obtained from the SMAD7 series.

[0279] Figure 3 The results showed that CpG methylation did not always significantly reduce mouse TLR9 activity, and the results also depended on the stereochemistry of internucleotide bonding; data were obtained from the SMAD7 series.

[0280] Figure 4The correlation between mouse TLR9 activity in vitro and in vivo is shown, with in vitro data presented; data are from the SMAD7 series.

[0281] Figure 5 The study showed that in an in vivo TNBS-induced IBD mouse model, oral administration of WV-499 at 250 mg / kg significantly reduced intestinal inflammation, as measured by inflammatory colitis scores, edema, and mucosal necrosis in colonic sections; the stereoisomeric isomer WV-966 had almost no effect.

[0282] Figure 6 It was shown that in some embodiments, 2'-modification of CpG eliminated TLR9 agonist activity against mouse TLR9; data were obtained from the SMAD7 series.

[0283] Figure 7 The effects of stereochemistry of CpG region motifs on human TLR9 activity were shown; data are from the ODN2006 series.

[0284] Figure 8 It was shown that some CpG oligonucleotides were not highly active in this experiment.

[0285] Figure 9 This study demonstrates certain activities of the SMAD7 series of oligonucleotides. WV-1384 is a mouse TLR9 agonist, but not a human TLR9 agonist. Data are from the SMAD7 series.

[0286] Figure 10 The stereochemistry of CpG region motifs was shown to affect the activity of mouse TLR9; data were obtained from the SOD1 series.

[0287] Figure 11 The results showed that CpG methylation can affect the activity of mouse TLR9; data were obtained from the SOD1 series.

[0288] Figure 12 The stereochemical effects of oligonucleotide backbone nucleotide-to-nucleotide bonding on mouse TLR9 activity were shown; data were obtained from the SOD1 series.

[0289] Figure 13 The results of assays for certain oligonucleotides in the SOD1 series are shown.

[0290] Figure 14 The study showed that sugar modification and / or methylation of C did not always significantly reduce or eliminate human TLR9 agonist activity; data were obtained from the SOD1 series.

[0291] Figure 15 This study showed that stereochemistry affects human TLR9 activity even in the presence of base and sugar modifications; data are from the SOD1 series.

[0292] Figure 16 The results showed that replacing CpG with ApG reduced human TLR9 activity in the parental sequence; data were obtained from the SOD1 series.

[0293] Figure 17 The correlation between reporter molecular assays and cytokine release from human PBMCs is shown; data are from the SOD1 series. In this figure, the agonistic activity of CpG oligonucleotides is measured by the secretion of inflammatory cytokines (IL-6 and MIP-1β).

[0294] Figure 18 Mouse and human TLR9 responses to various CpG oligonucleotides were demonstrated.

[0295] Figure 19 Various CpG oligonucleotides were shown to have no immunomodulatory activity in TLR9-deficient cells.

[0296] Figure 20 The agonist activity of WV-488 was shown to be isolated by antagonistic CpG oligonucleotides.

[0297] Figure 21 Mouse and human TLR9 responses to various CpG oligonucleotides were demonstrated.

[0298] Figure 22 The OND2006 series was shown to have activity against mouse TLR9.

[0299] Figure 23 Exemplary oligonucleotides containing lipid moieties are shown to effectively counteract (and antagonize) hTLR9 agonistic activity. As demonstrated, conjugates of lipids (e.g., stearic acid (WV-3545) or alginate (WV-3546)) and oligonucleotides (e.g., WV-3473 (WV-3545 and WV-3546)) exhibit significantly increased hTLR9 antagonistic activity. The concentration of the agonistic oligonucleotide ODN2006 was kept constant at 0.3 μM. Each oligonucleotide was tested at decreasing concentrations: 5, 2.5, 1.25, 0.6, 0.3, 0.15, and 0.075 μM (from left to right). Treatment was naked (without transfection reagents). Experiments were performed in triplicate, and average data are shown.

[0300] Figure 24Exemplary oligonucleotides containing lipid moieties are shown to effectively counteract (and antagonize) hTLR9 agonist activity. As demonstrated, conjugates of lipids (e.g., stearic acid (WV-3545) or alginate (WV-3546)) and oligonucleotides (e.g., WV-3473 (WV-3545 and WV-3546)) exhibit significantly increased hTLR9 antagonist activity. neg: negative control (buffer only). ODN2006c: agonist control, where the CpG sequence is replaced with GpC. PMO: Eteplirsen. The concentration of the agonist oligonucleotide ODN2006 was kept constant at 0.3 μM. Each oligonucleotide was tested at decreasing concentrations: 5, 2.5, 1.25, 0.6, 0.3, 0.15, and 0.075 μM (from left to right). Treatment was naked (without transfection reagent). The experiment was conducted in triplicate, and the average data is shown.

[0301] Figure 25 Several exemplary oligonucleotides provided were shown to have no hTLR9 agonist activity under the test conditions. Experiments were performed in triplicate, and average data are shown.

[0302] Figure 26 Lipid conjugation was shown to improve TLR9-related activity and other properties. Exemplary data on skipping exon 51 of human dystrophin containing lipid moieties are presented. Data for different doses from 0.3 μM to 30 μM are presented. Skip-read efficiency generally increases with increasing concentration. Higher efficiency was demonstrated by WV-3545 (WV-3473 conjugated with stearic acid via PO and C6 amino links) and WV-3546 (WV-3473 conjugated with alginate via PO and C6 amino links), both containing lipid moieties. Treatment was naked (without transfection reagents). Experiments were performed in triplicate, and average data are shown. Detailed Implementation Plan

[0303] Terms and Definitions

[0304] As used herein, unless otherwise indicated, the following definitions apply. For the purposes of this disclosure, chemical elements are identified according to the periodic table, CAS version, Handbook of Chemistry and Physics, 75th edition. Additionally, the general principles of organic chemistry are described in the following: "Organic Chemistry," Thomas Sorrell, University Science Books, Sausalito: 1999, and "March's Advanced Organic Chemistry," 5th edition, edited by Smith, MB, and March, J., John Wiley & Sons, New York: 2001, the entire contents of which are incorporated herein by reference.

[0305] Nucleic acids: As used herein, the term "nucleic acid" includes any dimer, trimer, tetramer, or polymer comprising nucleotides, modified nucleotides, and / or nucleotide analogs. As used herein, the term "polynucleotide" refers to nucleotides, modified nucleotides, and / or nucleotide analogs of any length, including polymeric forms of ribonucleotides (RNA) or deoxyribonucleotides (DNA). These terms refer to the primary structure of a molecule and therefore include double-stranded and single-stranded DNA, as well as double-stranded and single-stranded RNA. These terms include RNA or DNA analogs made from nucleotide analogs and modified polynucleotides as equivalents, such as, but not limited to, methylated, protected, and / or capped nucleotides or polynucleotides. This term encompasses polynucleotides or oligonucleotides (RNA) and polydeoxynucleotides or oligodeoxynucleotides (DNA); RNA or DNA derived from N-glycosides or C-glycosides of nucleotides and / or modified nucleotides; nucleic acids derived from sugars and / or modified sugars; and nucleic acids derived from phosphate bridges and / or modified phosphorus-atom bridges or internucleotide bonds. This term covers nucleic acids containing any combination of nucleotides, modified nucleotides, sugars, modified sugars, phosphate bridges, or modified phosphorus-atom bridges. Examples include, but are not limited to, nucleic acids containing a ribose moiety, nucleic acids containing a deoxyribose moiety, nucleic acids containing both ribose and deoxyribose moieties, and nucleic acids containing both ribose and modified ribose moieties. In some embodiments, the prefix "poly-" refers to nucleic acids containing 2 to about 10,000 nucleotide monomer units, and the prefix "oligo-" refers to nucleic acids containing 2 to about 200 nucleotide monomer units. In some embodiments, nucleic acids include, for example, deoxyribonucleotides or ribonucleotides and their polymers in at least partially single-stranded or double-stranded form. In some embodiments, nucleic acids include any nucleotide, modified nucleotides and / or nucleotide analogs, and polymers thereof. In some embodiments, polynucleotides include polymeric forms of nucleotides of any length, or ribonucleotides (RNA) or deoxyribonucleotides (DNA). These terms refer to the primary structure of a molecule and therefore include double-stranded and single-stranded DNA, as well as double-stranded and single-stranded RNA. These terms include RNA or DNA analogs made from nucleotide analogs and modified polynucleotides as equivalents, said modified polynucleotides being, for example, but not limited to, methylated, protected and / or capped nucleotides or polynucleotides. RNA and DNA analogs (e.g., nucleotide analogs) include, but are not limited to: morpholino, PNA, LNA, BNA, TNA, GNA, ANA, FANA, CeNa, HNA, and UNA. Modified nucleotides include nucleotides modified in phosphate, sugar, and / or base. Such modifications include sugar modifications at the 2' carbon, such as 2'-MOE, 2'-OMe, and 2'-F.In some embodiments, nucleic acids include polynucleotides or oligonucleotides (RNA) and polydeoxynucleotides or oligodeoxynucleotides (DNA); RNA or DNA derived from N-glycosides or C-glycosides of nucleotides and / or modified nucleotides; nucleic acids derived from sugars and / or modified sugars; and nucleic acids derived from phosphate bridges and / or modified phosphorus bridges or nucleotide bonds. The term covers any combination of nucleic acids containing nucleotides, modified nucleotides, sugars, modified sugars, phosphate bridges, or modified phosphorus bridges. Examples include, but are not limited to, nucleic acids containing ribose moieties, nucleic acids containing deoxyribose moieties, nucleic acids containing both ribose and deoxyribose moieties, and nucleic acids containing ribose and modified ribose moieties. In some embodiments, the nucleic acid is an oligonucleotide, antisense oligonucleotide, RNAi reagent, miRNA, splice-conversion oligonucleotide (SSO), immunomodulatory nucleic acid, aptamer, ribozyme, Piwi-interacting RNA (piRNA), small nucleolar RNA (snoRNA), mRNA, lncRNA, ncRNA, antigomir (e.g., an antagonist against miRNA, lncRNA, ncRNA, or other nucleic acids), plasmid, vector, or a portion thereof. In some embodiments, the nucleic acid is a chiral-controlled nucleic acid composition. In some embodiments, the nucleic acid is a chiral-controlled oligonucleotide composition or a chiral-controlled nucleic acid composition. In some embodiments, bases, nucleobases, nitrogenous bases, heterocyclic bases, etc., include portions of the nucleic acid (or modified variants thereof) involving hydrogen bonding, which binds one nucleic acid strand to another complementary strand in a sequence-specific manner. Naturally occurring bases [guanine (G), adenine (A), cytosine (C), thymine (T), and uracil (U)] are derivatives of purines (Pu) or pyrimidines (Py), although it should be understood that naturally occurring and non-naturally occurring base analogues are also included. In some embodiments, the nucleobase is a modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the modified nucleobase mimics the spatial arrangement, electronic properties, or some other physicochemical properties of nucleobases and retains the properties of hydrogen bonding, which binds one nucleic acid strand to another in a sequence-specific manner. In some embodiments, the modified nucleobase can pair with all five naturally occurring bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting unwinding behavior, recognition by intracellular enzymes, or activity of oligonucleotide duplexes. Various additional modifications to the bases are known in the art. In some cases, the nucleic acid sequence may be defined as a base sequence, generally presented in a 5' to 3' orientation. Although in the context of nucleic acids, bases are typically conjugated with sugars that, together with internucleotide bonds (e.g., phosphate esters or thiophosphate esters or other modified internucleotide bonds), form the backbone; however, as used herein, the term "base" does not include sugars or internucleotide bonds.In some embodiments, a nucleoside comprises a unit consisting of (a) a base covalently bound to (b) a sugar. The base and / or sugar may be modified or unmodified. In some embodiments, as referred to herein in the context of nucleic acids, the sugar comprises monosaccharides in closed and / or open forms. Naturally occurring sugars are pentose (five-carbon sugars), deoxyribose (which forms DNA), or ribose (which forms RNA), although it should be understood that naturally occurring and non-naturally occurring sugar analogs are also included. Sugars include, but are not limited to, ribose, deoxyribose, furanylpentose, pyranylpentose, and pyranohexose moieties. As used herein, the term also covers structural analogs used to replace conventional sugar molecules such as diols, whose polymers form nucleic acid analogs, the backbone of diol nucleic acids (“GNAs”). Deoxynucleosides contain deoxyribose. In some cases, a nucleic acid sequence may be defined as a sequence modified with both bases and sugars. In some embodiments, the sugar comprises modified or unmodified sugars. In some embodiments, as mentioned in the context of nucleic acids, modified sugars include modified sugars or portions that may functionally replace sugars in nucleic acids or modified nucleic acids. Modified sugars mimic the spatial arrangement, electronic properties, or some other physicochemical properties of sugars. As a non-limiting example, modified sugars may have a modification at the 2' carbon. Various modifications include 2'-MOE, 2'-OMe, and 2'-F. Various other modifications of sugars are known in the art. In some embodiments, nucleotides comprise monomeric units of polynucleotides consisting of: (a) a heterocyclic base, a sugar, and one or more phosphate groups or phosphorus-containing nucleotides bonded together; the nucleotide is a subunit of a polynucleotide, nucleic acid, or oligonucleotide. Each base, sugar, and phosphate ester or nucleoside linker may be independently modified or unmodified. Many nucleotide linkages are known in the art (e.g., although not limited to phosphate esters, thiophosphate esters, boron phosphate esters, etc.). Artificial nucleic acids include PNA (peptide nucleic acid), phosphotriesters, thiophosphates, H-phosphonates, aminophosphates, boron phosphates, methylphosphonates, phosphonoacetates, thiophosphonoacetates, and other variants of the phosphate backbone of natural nucleic acids, such as those described herein. In some embodiments, internucleotide bonding includes bonding between nucleoside units of oligonucleotides; in most cases, the bonding includes phosphorus or bonded phosphorus; in some embodiments, this bonding is referred to as "p". In some embodiments, internucleotide bonding is phosphodiester bonding, as found in naturally occurring DNA and RNA molecules. In some embodiments, the bonding is thiophosphate. In some embodiments, the backbone of an oligonucleotide or nucleic acid comprises alternating sugars and internucleotide bonding (e.g., phosphodiesters or thiophosphates). Unless specifically defined, this term covers nucleic acids containing known analogs of natural nucleotides that have similar binding properties to a reference nucleic acid and are metabolized in a manner similar to that of naturally occurring nucleotides.Unless otherwise stated, a particular nucleic acid sequence also implicitly encompasses variants of its conserved modifications (e.g., degenerate codon substitutions) and complementary sequences, as well as explicitly stated sequences. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is replaced by a mixture of bases and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). This also includes molecules with naturally occurring phosphodiester bonds as well as molecules with non-naturally occurring bonds, for example, for stabilization purposes. Nucleic acids can be in any physical form, such as linear, circular, nicked, or supercoiled. The term nucleic acid is used interchangeably with oligonucleotides, genes, cDNA, and mRNA encoded by genes. In various embodiments, one or more nucleotides are modified or substituted with one or more of the following: DNA, peptide nucleic acid (PNA), locked nucleic acid (LNA), morpholinonucleotide, threonine nucleic acid (TNA), glycol nucleic acid (GNA), arabinonucleotide (ANA), 2'-fluoroarabinonucleotide (FANA), cyclohexene nucleic acid (CeNA), dehydrated hexitol nucleic acid (HNA), restricted ethyl (cEt), tricyclic DNA (tc-DNA), isonucleotide (XNA), and / or unlocked nucleic acid (UNA). In various embodiments, the nucleic acid comprises a modified nucleoside intermolecular header.

[0306] Nucleotides: As used herein, the term "nucleotide" refers to a monomeric unit of a polynucleotide, which consists of a heterocyclic base, a sugar, and one or more phosphate groups or phosphorus-containing nucleotides linked together. Naturally occurring bases (guanine (G), adenine (A), cytosine (C), thymine (T), and uracil (U)) are derivatives of purines or pyrimidines, although it should be understood that naturally occurring and non-naturally occurring base analogues are also included. Naturally occurring sugars are pentose (five-carbon sugars) deoxyribose (which forms DNA) or ribose (which forms RNA), although it should be understood that naturally occurring and non-naturally occurring sugar analogues are also included. Nucleotides are linked together by internucleotide bonds to form nucleic acids or polynucleotides. Many internucleotide bonds are known in the art (e.g., although not limited to phosphate esters, thiophosphate esters, borane phosphate esters, etc.). Artificial nucleic acids include PNA (peptide nucleic acid), phosphate triesters, thiophosphates, H-phosphonates, aminophosphates, boron phosphates, methylphosphonates, phosphonoacetates, thiophosphonoacetates, and other variants of the phosphate backbone of natural nucleic acids, such as those described herein. As described herein, in some embodiments, the nucleotides are natural nucleotides; in some embodiments, the nucleotides are modified.

[0307] Nucleoside: As used herein, the term “nucleoside” refers to the portion in which a nucleobase or a modified nucleobase is covalently bonded to a sugar or a modified sugar.

[0308] Sugar: As used herein, the term "sugar" refers to carbohydrates, in some embodiments, monosaccharides in closed and / or open forms. Sugars include, but are not limited to, ribose, deoxyribose, furanopentose, pyranopentose, and pyranohexose moieties. As used herein, the term also encompasses structural analogs used to replace conventional sugar molecules such as diols, whose polymers form nucleic acid analogs, the backbone of diol nucleic acids ("GNAs").

[0309] Modified sugars: As used herein, the term "modified sugar" refers to a portion of the oligonucleotide that can replace the sugar portion in some embodiments. Modified sugars mimic the spatial arrangement, electronic properties, or some other physicochemical properties of sugars. In some embodiments, modified sugars include a modification at the 2' carbon. In some embodiments, modified sugars comprise 2'-F, 2'-OMe, or 2'-MOE.

[0310] Nucleobase: As used herein, the term "nucleobase" refers to a nucleic acid moiety involving hydrogen bonding, which binds one nucleic acid strand to another complementary strand in a sequence-specific manner. The most common naturally occurring nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, naturally occurring nucleobases are modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, naturally occurring nucleobases are methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a nucleobase is a "modified nucleobase," such as a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, modified nucleobases are methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the modified nucleotides mimic the spatial arrangement, electronic properties, or other physicochemical properties of nucleotides, and retain the hydrogen bonding properties that bind one nucleic acid strand to another in a sequence-specific manner. In some embodiments, the modified nucleotides can pair with all five naturally occurring bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting unwinding behavior, recognition by intracellular enzymes, or activity of oligonucleotide duplexes.

[0311] DNA and other terms: As used herein, the terms “DNA,” “DNA molecule,” etc., refer to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in their single-stranded or double-stranded helical form. This term refers only to the primary and secondary structures of the molecule and is not limited to any particular tertiary form. Therefore, this term encompasses double-stranded DNA, particularly found in linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes. When discussing the structure of a particular double-stranded DNA molecule, the sequence may be described according to the conventional practice of giving the sequence only along the 5' to 3' direction of the non-transcribed strand of DNA (i.e., the strand homologous to mRNA).

[0312] Chiral ligands: As used herein, the term “chiral ligand” or “chiral auxiliary” refers to a portion that is chiral and can be incorporated into a reaction so that the reaction can proceed with some stereoselectivity.

[0313] Condensation reagent: In condensation reactions, as used herein, the term "condensation reagent" refers to a reagent that activates a less reactive site and makes it more susceptible to attack by another reagent. In some embodiments, such another reagent is a nucleophile.

[0314] Blocking group: As used herein, the term "blocking group" refers to a group that masks the reactivity of a functional group. The functional group can subsequently be demasked by removing the blocking group. In some embodiments, the blocking group is a protecting group.

[0315] Part: As used herein, the term "part" refers to a specific segment or functional group of a molecule. A chemical part is often a recognized chemical entity that is embedded in or attached to a molecule.

[0316] Solid support: As used herein, the term "solid support" refers to any support that enables the synthesis of nucleic acids. In some embodiments, the term refers to a glass or polymer that is insoluble in the medium used in the reaction steps performed to synthesize nucleic acids and is derivatized to include reactive groups. In some embodiments, the solid support is highly cross-linked polystyrene (HCP) or controlled-pore glass (CPG). In some embodiments, the solid support is controlled-pore glass (CPG). In some embodiments, the solid support is a hybrid support of controlled-pore glass (CPG) and highly cross-linked polystyrene (HCP).

[0317] Coding Sequence: A DNA “coding sequence” or “coding region” is a double-stranded DNA sequence that, when placed under the control of appropriate expression control sequences, is transcribed and translated into a polypeptide in vivo. The boundaries of a coding sequence (“open reading frame” or “ORF”) are determined by a start codon at the 5’ (amino) end and a translation stop codon at the 3’ (carboxyl) end. Coding sequences can include, but are not limited to, prokaryotic sequences, cDNA derived from eukaryotic mRNA, genomic DNA sequences derived from eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. Polyadenylation signals and transcription termination sequences are typically located at the 3’ end of the coding sequence. The term “non-coding sequence” or “non-coding region” refers to regions of a polynucleotide sequence that have not been translated into amino acids (e.g., the 5’ and 3’ untranslated regions).

[0318] Reading frame: As used herein, the term "reading frame" refers to one of six possible reading frames in a double-stranded DNA molecule, three in each direction. The reading frame used determines which codon is used to encode an amino acid within the coding sequence of the DNA molecule.

[0319] Antisense: As used herein, for example, when referring to nucleic acids, the term "antisense" refers to a nucleic acid molecule containing a nucleotide sequence complementary to a "sense" nucleic acid encoding a protein, such as the coding strand of a double-stranded cDNA molecule, an mRNA sequence, or a gene. Thus, antisense nucleic acid molecules can bind to sense nucleic acid molecules via hydrogen bonds. In some embodiments, antisense oligonucleotides are capable of annealing to target mRNA in a sequence-specific manner and mediating mRNA degradation via an RNase H-dependent mechanism. In some embodiments, as a non-limiting example, antisense nucleic acids comprise the antisense strand of siRNA or other RNAi reagents capable of annealing to target mRNA in a sequence-specific manner and mediating mRNA degradation via a RISC (RNA repression silencing complex)-mediated mechanism. In some embodiments, the antisense strand of siRNA or other RNAi reagent anneals to the corresponding sense strand; in some embodiments, the antisense strand of siRNA or other RNAi reagent does not anneal to the corresponding sense strand.

[0320] Homology: As used herein, the terms “homology,” “identity,” or “similarity” refer to the sequence similarity between two nucleic acid molecules. Homology and identity can be determined by comparing positions in each sequence that are available for comparison. A molecule is identical at that position when equivalent positions in the compared sequences are occupied by the same bases; a molecule may be described as homologous (similar) at that position when equivalent sites are occupied by the same or similar nucleic acid residues (e.g., similar in spatial and / or electronic properties). Expressions of homology / similarity or identity as a percentage refer to the number of identical or similar nucleic acids at positions shared by the compared sequences. Sequences that are “irrelevant” or “non-homologous” have less than 40%, less than 35%, less than 30%, or less than 25% identity with the sequences described herein. The deletion or presence of additional residues (amino acids or nucleic acids) also reduces identity and homology / similarity when comparing two sequences. In some embodiments, the term “homology” describes a mathematically based sequence similarity comparison used to identify genes with similar functions or motifs. The nucleic acid sequences described herein can be used as “query sequences” to perform searches against public databases, for example, to identify other family members, related sequences, or homologs. In some embodiments, such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al., (1990) J.Mol.Biol.215:403-10. In some embodiments, BLAST nucleotide searches can be performed using the NBLAST program (score = 100, word length = 12) to obtain nucleotide sequences homologous to the nucleic acid molecules of this disclosure. In some embodiments, for obtaining vacancy alignments for comparative purposes, Gapped BLAST can be used as described in Altschul et al., (1997) Nucleic Acids Res.25(17):3389-3402. When using the BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and BLAST) can be used (see www.ncbi.nlm.nih.gov).

[0321] Identity: As used herein, “identity” means the percentage of identical nucleotide residues at corresponding positions in two or more sequences when sequences are aligned to maximize sequence matching (i.e., taking into account gaps and insertions). Identity can be readily calculated using known methods, including but not limited to those described below (Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM and Griffin, HG, ed., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., ed., Stockton Press, New York, 1991; and Carillo, H. and Lipman, D., SIAM J. Applied). Math., 48:1073 (1988). The method for determining identity is designed to give the maximum match between the sequences being tested. Furthermore, the method for determining identity is encoded in a publicly available computer program. Computer program methods for determining identity between two sequences include, but are not limited to, the GCG package (Devereux, J. et al., Nucleic Acids Research 12(1):387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, SF et al., J.Molec.Biol.215:403-410 (1990) and Altschul et al. Nuc.AcidsRes.25:3389-3402 (1997)). The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCBI NLM NIH). Bethesda, Md. 20894; Altschul, S. et al., J.Mol.Biol. 215:403-410 (1990). The well-known Smith-Waterman algorithm can also be used to determine identity.

[0322] Heterologous: A "heterologous" region of DNA sequence is a recognizable segment of DNA within a larger DNA sequence that is not found in nature to be associated with that larger sequence. Therefore, when a heterologous region encodes a mammalian gene, that gene is typically a DNA sequence that is not laterally linked to mammalian genomic DNA in the genome of the source organism. Another example of a heterologous coding sequence is a sequence in which the coding sequence itself is not found in nature (e.g., a cDNA sequence in which the genomic coding sequence contains introns or has a codon or motif different from that of an unmodified gene). Allelic variations or naturally occurring mutations do not produce heterologous DNA regions as defined herein.

[0323] Oligonucleotide: As used herein, the term “oligonucleotide” refers to a polymer or oligomer of nucleotide monomers containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or modified phosphorus bridges (also referred to herein as “internucleotide bonds”, as further defined herein).

[0324] Oligonucleotides can be single-stranded or double-stranded. As used herein, the term "oligonucleotide chain" encompasses single-stranded oligonucleotides. Single-stranded oligonucleotides may have double-stranded regions, and double-stranded oligonucleotides may have single-stranded regions. Exemplary oligonucleotides include, but are not limited to, structural genes, genes including control and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and double-stranded siRNAs and other RNA interference agents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribozymes, microRNAs, microRNA mimics, supermir, aptamers, antimir, antagomir, Ul adaptors, triplet-forming oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immunostimulatory oligonucleotides, and decoy oligonucleotides.

[0325] Double-stranded and single-stranded oligonucleotides that effectively induce RNA interference are also referred to herein as siRNA, RNAi reagents, or iRNA reagents. In some embodiments, these RNA interference-inducing oligonucleotides bind to a cytoplasmic polyprotein complex called an RNAi-induced silencing complex (RISC). In many embodiments, single-stranded and double-stranded RNAi reagents are long enough that they can be cleaved by endogenous molecules such as Dicer to produce smaller oligonucleotides that can enter the RISC mechanism and participate in RISC-mediated cleavage of target sequences such as target mRNA.

[0326] The oligonucleotides disclosed herein can have various lengths. In certain embodiments, the oligonucleotides can range in length from about 2 to about 200 nucleotides. In various related embodiments, single-stranded, double-stranded, and triple-stranded oligonucleotides can range in length from about 4 to about 10 nucleotides, from about 10 to about 50 nucleotides, from about 20 to about 50 nucleotides, from about 15 to about 30 nucleotides, and from about 20 to about 30 nucleotides. In some embodiments, the oligonucleotide is about 9 to about 39 nucleotides long. In some embodiments, the oligonucleotide is at least 4 nucleotides long. In some embodiments, the oligonucleotide is at least 5 nucleotides long. In some embodiments, the oligonucleotide is at least 6 nucleotides long. In some embodiments, the oligonucleotide is at least 7 nucleotides long. In some embodiments, the oligonucleotide is at least 8 nucleotides long. In some embodiments, the oligonucleotide is at least 9 nucleotides long. In some embodiments, the oligonucleotide is at least 10 nucleotides long. In some embodiments, the oligonucleotide is at least 11 nucleotides long. In some embodiments, the oligonucleotide is at least 12 nucleotides long. In some embodiments, the oligonucleotide is at least 15 nucleotides long. In some embodiments, the oligonucleotide is at least 20 nucleotides long. In some embodiments, the oligonucleotide is at least 25 nucleotides long. In some embodiments, the oligonucleotide is at least 30 nucleotides in length. In some embodiments, the oligonucleotide is a duplex of complementary strands at least 18 nucleotides in length. In some embodiments, the oligonucleotide is a duplex of complementary strands at least 21 nucleotides in length. In some embodiments, the sequence of the nucleic acid or oligonucleotide comprises or consists of a common base sequence that hybridizes to transcripts of: dystrophin, myostatin, huntingtin, myostatin receptor, ActRIIB, ActRIIA, DMPK, SMN2, myotonic dystrophy protein kinase (DMPK), proprotein convertase subtilisin / kexin type 9 (PCSK9), SMAD7, or KRT14 (keratin 14). In some embodiments, the sequence of a nucleic acid or oligonucleotide contains or is composed of a common base sequence that hybridizes with transcripts of genes including Huntington's disease, spinal muscular atrophy, type 1 spinal muscular atrophy, amyotrophic lateral sclerosis, Duchenne muscular dystrophy, myotonic dystrophy, type 1 myotonic dystrophy, liver genetic diseases, liver metabolic diseases, epidermolysis bullosa, skin genetic diseases, or irritable bowel syndrome or genetic diseases, or metabolic diseases.

[0327] Internucleotide bonding: As used herein, the phrases “internucleotide bonding,” “internucleotide bridge,” etc., generally refer to the bonding between nucleotide units of oligonucleotides, including but not limited to phosphorus-containing bonding, and are interchangeable with “sugar bonding” and “phosphoatom bridge” as used above and herein. In some embodiments, the internucleotide bonding is a phosphodiester bonding, as found in naturally occurring DNA and RNA molecules. In some embodiments, the modified internucleotide bonding is an internucleotide bonding that is not a phosphodiester. In some embodiments, the internucleotide bonding is a “modified internucleotide bonding” where the internucleotide bonding is not a phosphodiester. In some embodiments of modified internucleotide bonding, each oxygen atom of the phosphodiester bonding is optionally and independently replaced with an organic or inorganic portion. In some embodiments, such organic or inorganic portions are selected from, but not limited to, =S, =Se, =NR’, –SR’, –SeR’, –N(R’)2, B(R’)3, –S–, –Se–, and –N(R’)–, where each R’ is independently defined and described below. In some embodiments, the modified internucleotide bonds are phosphate triester bonds or phosphate thioester diester bonds. Alternatively, a modified thiophosphate triester may be used for bonding. Those skilled in the art will understand that, due to the presence of the acid or base portion in the bond, the nucleotide bond can exist as an anion or a cation at a given pH.

[0328] Unless otherwise stated, when used with oligonucleotide sequences, s, s1, s2, s3, s4, s5, s6, and s7 each independently represent the following modified nucleotide bonds as shown in the table below:

[0329] Exemplary modified nucleotide bonding.

[0330]

[0331]

[0332]

[0333] Formula I describes additional modified nucleotide inter-bonding.

[0334] As a non-limiting example, (Rp,Sp)–ATsCs1GA has an internucleotide bond between 1) phosphate thioesters and C. 2) Having a relationship between C and G The structure of the thiophosphate triester nucleotide bonds. Unless otherwise specified, the Rp / Sp designation preceding the oligonucleotide sequence describes the configuration of the chiral phosphorus atom in the sequential internucleotide bonds from the 5' to 3' of the oligonucleotide sequence. For example, in (Rp,Sp)–ATsCs1GA, the phosphorus in the “s” bond between T and C has the Rp configuration, and the phosphorus in the “s1” bond between C and G has the Sp configuration. In some embodiments, “all (Rp)” or “all (Sp)” is used to indicate that all chiral phosphorus atoms in the oligonucleotide have the same Rp or Sp configuration, respectively. For example, all-(Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsCsGsCsAsCsC indicates that all chiral phosphorus atoms in the oligonucleotide have the Rp configuration; all-(Sp)-GsCsCsTsCsAsGsTsCsTsGsCsTsCsGsCsAsCsC indicates that all chiral phosphorus atoms in the oligonucleotide have the Sp configuration. In some embodiments, in the modified internucleotide bond, the non-bridging oxygen in the phosphodiester is replaced with sulfur. In some embodiments, the modified internucleotide bond is a thiophosphate. In some embodiments, in the modified internucleotide bond, both non-bridging oxygen atoms in the phosphodiester are replaced with sulfur. In some embodiments, the modified internucleotide bond is a dithiophosphate. In some embodiments, in the modified internucleotide bond, the bridging oxygen in the phosphodiester is replaced with sulfur. In some embodiments, the modified internucleotide bond is a thiophosphate ether. In some embodiments, in the modified internucleotide bond, both bridging oxygen atoms in the phosphodiester are replaced with sulfur. In some embodiments, in the modified internucleotide bond, the non-bridging oxygen atoms in the phosphodiester are replaced with carbon atoms. In some embodiments, in the modified internucleotide bond, any one or more oxygen atoms are replaced with another atom that is not oxygen. In some embodiments, in the modified internucleotide bond, phosphorus is replaced with another atom that is not phosphorus. In some embodiments, in the modified internucleotide bond, any one or more oxygen atoms and phosphorus atoms are replaced with atoms that are not oxygen or phosphorus, respectively.

[0335] Oligonucleotide type: As used herein, the phrase “oligonucleotide type” is used to define an oligonucleotide having a specific base sequence, a main chain bonding pattern (i.e., a pattern of internucleotide bonding types, such as phosphate esters, thiophosphate esters, etc.), a main chain chiral center pattern (i.e., a pattern of phosphorus stereochemistry (Rp / Sp) bonding), and a main chain phosphorus modification pattern (e.g., “-XLR” in Formula I). 1 (The pattern of the group). In some embodiments, oligonucleotides of a commonly specified "type" are structurally identical to each other.

[0336] Those skilled in the art will appreciate that the synthetic methods of this disclosure provide a degree of control during the synthesis of oligonucleotide chains so that each nucleotide unit of the oligonucleotide chain can be designed in advance to have a specific stereochemistry at the phosphorus-linked site and / or a specific modification at the phosphorus-linked site, and / or a specific base and / or a specific sugar. In some embodiments, the oligonucleotide chain is designed in advance to have a specific combination of stereocenters at the phosphorus-linked site. In some embodiments, the oligonucleotide chain is designed and / or determined to have a specific combination of modifications at the phosphorus-linked site. In some embodiments, the oligonucleotide chain is designed and / or selected to have a specific combination of bases. In some embodiments, the oligonucleotide chain is designed and / or selected to have a specific combination of one or more of the above structural features. This disclosure provides compositions comprising a variety of oligonucleotide molecules or compositions composed of a variety of oligonucleotide molecules (e.g., chiral-controlled oligonucleotide compositions). In some embodiments, all such molecules are of the same type. In some embodiments, the provided compositions comprise a variety of different types of oligonucleotides, typically in predetermined relative amounts.

[0337] Chiral control: As used herein, “chiral control” refers to the stereochemically specified ability to control the chiral internucleotide bonding (e.g., phosphorus bonding) in chiral internucleotide bonding within an oligonucleotide. In some embodiments, control is achieved by chiral elements not present in the sugar and base moieties of the oligonucleotide, for example, in some embodiments, by using one or more chiral auxiliaries during oligonucleotide preparation, as illustrated in this disclosure.

[0338] Chiral-controlled oligonucleotide compositions: As used herein, the terms "chiral-controlled oligonucleotide composition," "chiral-controlled nucleic acid composition," "chiral-controlled oligonucleotide composition," etc., refer to compositions comprising multiple oligonucleotides (or nucleic acids) that share 1) a common base sequence, 2) a common backbone bonding pattern, and 3) a common backbone phosphorus modification pattern, wherein the multiple oligonucleotides share the same stereochemistry at one or more chiral internucleotide bonds (chiral-controlled internucleotide bonds), and the levels of the multiple oligonucleotides in the composition are predetermined. In some embodiments, each chiral internucleotide bond is a chiral-controlled internucleotide bond, and the composition is a fully chiral-controlled oligonucleotide composition. In some embodiments, not all majority of chiral internucleotide bonds are chiral-controlled internucleotide bonds, and the composition is a partially chiral-controlled oligonucleotide composition. In some embodiments, the chiral-controlled oligonucleotide composition comprises predetermined levels of various oligonucleotide types or nucleic acid types. For example, in some embodiments, the chiral-controlled oligonucleotide composition comprises one oligonucleotide type. In some embodiments, the chiral-controlled oligonucleotide composition comprises more than one oligonucleotide type. In some embodiments, the chiral controlled oligonucleotide composition comprises multiple oligonucleotide types. In some embodiments, in the chiral controlled oligonucleotide composition, a conformation of each phosphate thioester or other nucleotide inter-bonding is defined (e.g., Rp or Sp). In some embodiments, in the chiral controlled oligonucleotide composition, at least one conformation of phosphate thioester or other nucleotide inter-bonding (Rp or Sp) is defined, but at least one conformation of phosphate thioester or other nucleotide inter-bonding is not defined. As a non-limiting example, in some embodiments, in the chiral controlled oligonucleotide composition, a conformation of phosphate thioester or other nucleotide inter-bonding (e.g., as Rp or Sp) may be defined at one or more sites; however, at one or more other sites, a conformation of phosphate thioester or other nucleotide inter-bonding is not defined (e.g., the composition comprises a mixture of molecules, some of which have an Rp conformation of phosphate thioester or other nucleotide inter-bonding at that site, and some of which have an Sp conformation).

[0339] Chiral pure: As used herein, the phrase “chiral pure” is used to describe a chiral-controlled oligonucleotide composition or multiple oligonucleotides in which all or most of the oligonucleotides exist in a single diastereomer relative to the bound phosphorus.

[0340] Chiral homogeneous: As used herein, the phrase "chiral homogeneous" describes an oligonucleotide molecule or type in which most of its nucleotide units have the same stereochemistry at the phosphorus bond. For example, an oligonucleotide whose nucleotide units all have Rp stereochemistry at the phosphorus bond is chiral homogeneous. Similarly, an oligonucleotide whose nucleotide units all have Sp stereochemistry at the phosphorus bond is chiral homogeneous.

[0341] Predetermined: Predetermined (or predetermined) means intentionally selected, for example, contrary to random occurrence or achieved without control. Those skilled in the art who read this specification will understand that this disclosure provides techniques that allow the selection of specific chemical and / or stereochemical features to be incorporated into oligonucleotide compositions, and also allow the controlled preparation of oligonucleotide compositions having such chemical and / or stereochemical features. As described herein, these provided compositions are “predetermined.” Compositions that may contain certain oligonucleotides are not “predetermined” compositions because they happen to be produced by methods that cannot be controlled to intentionally generate specific chemical and / or stereochemical features. In some embodiments, a predetermined composition is a composition that is intentionally reproducible (e.g., by repetition of a controlled process). In some embodiments, a predetermined level of multiple oligonucleotides in a composition means controlling the absolute and / or relative amounts (ratios, percentages, etc.) of multiple oligonucleotides in the composition.

[0342] Bonded phosphorus: As defined herein, the phrase “bonded phosphorus” is used to indicate that the specific phosphorus atom referred to is a phosphorus atom present in an internucleotide bond, the phosphorus atom corresponding to the phosphorus atom of a phosphodiester in an internucleotide bond, such as that found in naturally occurring DNA and RNA. In some embodiments, the bonded phosphorus atom is in a modified internucleotide bond, wherein each oxygen atom of the phosphodiester bond is optionally and independently replaced by an organic or inorganic portion. In some embodiments, the bonded phosphorus atom is P* of Formula I. In some embodiments, the bonded phosphorus atom is chiral. In some embodiments, the chiral bonded phosphorus atom is P* of Formula I.

[0343] P-modification: As used herein, the term "P-modification" refers to any modification at the site of the bonded phosphorus, other than stereochemical modification. In some embodiments, P-modification includes the addition, substitution, or removal of a side portion covalently attached to the bonded phosphorus. In some embodiments, "P-modification" is -XLR 1 X, L and R 1 Each is independent as defined and described herein and below.

[0344] Blockmer: As used herein, the term "blockmer" refers to an oligonucleotide chain characterized by the presence of at least two consecutive nucleotide units sharing a common structural feature at the phosphorus-phosphate bond between the nucleotides. A common structural feature means a common stereochemistry or a common modification at the phosphorus-phosphate bond. In some embodiments, the at least two consecutive nucleotide units sharing a common structural feature at the phosphorus-phosphate bond are referred to as a "block".

[0345] In some embodiments, a block polymer is a "stereoblock polymer," for example, at least two consecutive nucleotide units having the same stereochemistry at the phosphorus bond. Thus, at least two consecutive nucleotide units form a "stereoblock." For example, (Sp,Sp)-ATsCs1GA is a stereoblock polymer because at least two consecutive nucleotide units, Ts and Cs1, have the same stereochemistry at the phosphorus bond (both are Sp). In the same oligonucleotide (Sp,Sp)-ATsCs1GA, TsCs1 forms the block, and it is a stereoblock.

[0346] In some embodiments, a block polymer is a "P-modified block polymer," for example, at least two consecutive nucleotide units have the same modification at the phosphorus bond. Thus, at least two consecutive nucleotide units form a "P-modified block." For example, (Rp,Sp)-ATsCsGA is a P-modified block polymer because at least two consecutive nucleotide units, Ts and Cs, have the same P modification (i.e., both are phosphate thioester diesters). In the same oligonucleotide of (Rp,Sp)-ATsCsGA, TsCs forms a block, and it is a P-modified block.

[0347] In some embodiments, a block polymer is a “bonded block polymer,” for example, at least two consecutive nucleotide units having the same stereochemistry and the same modification at the phosphorus bond. At least two consecutive nucleotide units form a “bonded block.” For example, (Rp,Rp)-ATsCsGA is a bonded block polymer because at least two consecutive nucleotide units, Ts and Cs, have the same stereochemistry (both are Rp) and P modification (both are phosphate thioesters). In the same oligonucleotide of (Rp,Rp)-ATsCsGA, TsCs forms a block, and it is a bonded block.

[0348] In some embodiments, the block polymer comprises one or more blocks independently selected from stereoblocks, P-modified blocks, and bonded blocks. In some embodiments, the block polymer is a stereoblocker relative to one block, and / or a P-modified block polymer relative to another block, and / or a bonded block polymer relative to yet another block. For example, (Rp,Rp,Rp,Rp,Rp,Sp,Sp,Sp)–AAsTsCsGsAs1Ts1Cs1Gs1ATCG is a stereoblock polymer with respect to the stereoblock AsTsCsGsAs1 (all Rp at the phosphorus bond) or Ts1Cs1Gs1 (all Sp at the phosphorus bond), a P-modified block polymer with respect to the P-modified block AsTsCsGs (all s bonds) or As1Ts1Cs1Gs1 (all s1 bonds), or a bonded block polymer with respect to the bonded block AsTsCsGs (all Rp and all s bonds at the phosphorus bond) or Ts1Cs1Gs1 (all Sp and all s1 bonds at the phosphorus bond).

[0349] Altmer: As used herein, the term "alternating polymer" refers to an oligonucleotide chain characterized by the structural feature pattern of each individual nucleotide unit, wherein no two consecutive nucleotide units in the oligonucleotide chain share a specific structural feature at the phosphate bond between the nucleotides. In some embodiments, the alternating polymer is designed to contain repeating patterns. In some embodiments, the alternating polymer is designed to not contain repeating patterns.

[0350] In some embodiments, the alternating polymer is a “stereo-alternating polymer”, for example, no two consecutive nucleotide units have the same stereochemistry at the phosphorus bond. For example, Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC.

[0351] In some embodiments, the alternating polymer is a "P-modified alternating polymer," for example, no two consecutive nucleotide units have the same modification at the phosphate bond. For example, all(Sp)-CAs1GsT, where each phosphate bond has a different P modification than the others.

[0352] In some embodiments, the alternating polymer is a “bonded alternating polymer”, for example, no two consecutive nucleotide units have the same stereochemistry or the same modification at the bonded phosphorus. For example, Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp)-GsCs1CsTs1CsAs1GsTs1CsTs1GsCs1TsTs2CsGs3CsAs4CsC.

[0353] Sequence: As used herein, the term “sequence” refers to any arrangement of the molecular or atomic features of a particular molecule. In some embodiments, when referring to nucleic acids, “sequence” refers to any of the following: base sequence (including length), chemical modification patterns of sugar and base moieties, main chain bonding patterns (e.g., native phosphate ester bonding, thiophosphate ester bonding, thiophosphate triester bonding, and combinations thereof), main chain chiral center patterns (e.g., stereochemical (Rp / Sp) patterns of inter-chiral nucleotide bonding), and main chain phosphorus modification patterns (e.g., modification patterns on inter-nucleotide phosphorus atoms, such as those of formula...). I -S- and -LR 1 In some embodiments, when referring to nucleic acids or oligonucleotides, "sequence" means the sequence of bases or a base sequence. In some embodiments, when referring to peptides or proteins, sequence means the amino acid sequence.

[0354] Monomer: As used herein, the term "monomer" refers to an oligonucleotide chain that characterizes the structural feature pattern of each individual nucleotide unit such that all nucleotide units within the chain share at least one common structural feature at the phosphorus bond between nucleotides. A common structural feature means a common stereochemistry at the phosphorus bond or a common modification at the phosphorus bond.

[0355] In some embodiments, the monomer is a "stereomonomer," for example, all nucleotide units have the same stereochemistry at the phosphorus bond. For example, all(Sp)-CsAs1GsT, where all bonds have Sp phosphorus.

[0356] In some embodiments, the monomer is a "P-modified monomer," for example, all nucleotide units have the same modification at the phosphorus bond. For example, (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp Rp, Sp, Rp, Sp, Rp, Sp, Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC, where all internucleotide bonds are phosphate dithioesters.

[0357] In some embodiments, the monomer is a “bonded monomer”, for example, in which all nucleotide units have the same stereochemistry and the same modification at the sp-bonded phosphorus. For example, all(Sp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC, where all internucleotide bonds are phosphate dithioesters with sp-bonded phosphorus.

[0358] Gapmer: As used herein, the term "gapmer" refers to an oligonucleotide or oligonucleotide chain comprising two or more chemically distinct segments or regions. In some embodiments, the segments or regions are characterized by modifications to the internucleotide bonds of bases, sugars, and / or nucleotides, or by comprising one or more nucleotide analogs. In some embodiments, the segments or regions are characterized by at least one nucleotide phosphate bond in the oligonucleotide chain being a phosphodiester bond, such as those found in naturally occurring DNA or RNA. In some embodiments, more than one nucleotide phosphate bond in the oligonucleotide chain is a phosphodiester bond, such as those found in naturally occurring DNA or RNA. For example, all(Sp)-CAs1GsT, where the nucleotide bond between C and A is a phosphodiester bond.

[0359] Skipmer: As used herein, the term “skipmer” refers to a class of skipmers in which the phosphorus bonds between each other nucleotide in the oligonucleotide chain are phosphodiester bonds, such as those found in naturally occurring DNA or RNA, and the phosphorus bonds between each other nucleotide in the oligonucleotide chain are modified nucleotide bonds.

[0360] CpG: As used herein, the terms “CpG,” “CpG dinucleotide,” “CpG motif,” etc., refer to a dinucleotide comprising, in a 5’ to 3’ order, the following: cytidine (C); phosphate ester, thiophosphate ester, or other internucleotide bond (p); and guanosine (G). In various CpG oligonucleotides, (p) is a thiophosphate ester. In some embodiments, the C residue in CpG comprises a base and / or sugar modification, such as 5-methyl C, 2’-modified 5mC (e.g., 2’-OMe 5-methyl C; or 2’-MOE m5C, etc.). In some embodiments, immunomodulatory CpG oligonucleotides comprise a base and / or sugar modification, such as 5-methyl C, 2’-modified 5mC (e.g., 2’-OMe 5-methyl C; or 2’-MOE m5C, etc.).

[0361] CpG region motifs: As used herein, the term "CpG region motif" refers to a specific motif comprising a CpG dinucleotide, plus one or more sites side-attached (immediately adjacent to 5' and / or 3') to a CpG, wherein the motif is defined by the base sequence, the chemistry of the base, sugar, and nucleotide inter-bonding (e.g., chemical modifications of the base, sugar, and / or nucleotide inter-bonding, etc.), and the stereochemistry of the chiral nucleotide inter-bonding (e.g., if the thiophosphate at the particular site is of the Rp or Sp configuration). Various CpG region motifs are presented herein that can stimulate or antagonize immunostimulatory effects. In some embodiments, the C residue in the CpG comprises a base and / or sugar modification, such as 5-methyl C, 2'-modified 5mC (e.g., 2'-OMe 5-methyl C; or 2'-MOE m5C, etc.), etc. In some embodiments, the immunomodulatory CpG oligonucleotide contains base and / or sugar modifications, such as 5-methyl C, 2'-modified 5mC (e.g., 2'-OMe 5-methyl C; or 2'-MOE m5C, etc.).

[0362] CpG oligonucleotides: As used herein, the term "CpG oligonucleotide" refers to an oligonucleotide containing at least one CpG or CpG regional motif. In some embodiments, a CpG oligonucleotide contains at least two CpG dinucleotides or CpG regional motifs. Some CpG oligonucleotides are capable of activating an immune response in at least one assay; others are capable of antagonizing an immune response in at least one assay. Still others are neither. In some embodiments, a CpG oligonucleotide optionally contains sugar, base, and / or nucleotide inter-bonding, as well as modifications to secondary and tertiary structures. See, for example, Vollmer et al., 2009 Adv. Drug. Del. Rev. 61:195-204. An example of modified nucleotide inter-bonding is a phosphate thioester. For example, a CpG oligonucleotide may contain all phosphodiester in the backbone; or a mixture of phosphodiester and nucleoside intermolecular heads in the backbone; or all nucleoside intermolecular heads in the backbone. In various embodiments, a CpG oligonucleotide contains a phosphate thioester in the Rp or Sp conformation. Immunomodulatory CpG oligonucleotides can modulate immune responses, including activating or antagonizing them. In some embodiments, “immunomodulatory” CpG oligonucleotides can activate immune responses. Oligonucleotides, including CpG oligonucleotides, may be single-stranded, or in some embodiments, may be at least partially double-stranded. As used herein, the term “oligonucleotide chain” encompasses single-stranded oligonucleotides. Single-stranded oligonucleotides may have double-stranded regions, and double-stranded oligonucleotides may have single-stranded regions. Oligonucleotides may also form one or two single-stranded loops having one or more double-stranded regions. See, for example, Schmidt et al. 2015 Nucl. Acid Therp. 25:130-140. Exemplary oligonucleotides include, but are not limited to, structural genes, genes including control and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and double-stranded siRNAs and other RNA interference agents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribozymes, microRNAs, microRNA mimics, supermirs, aptamers, antimirs, antagomirs, Ul adaptors, triplet-forming oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immunostimulatory oligonucleotides, and decoy oligonucleotides. In some embodiments, CpG oligonucleotides may comprise one or more regions having (1) a single-stranded region and (2) another region that is double-stranded. As a non-limiting example, such a structure is reported in Schmidt et al., 2015 Nucl. Acid Therp. 25:130-140. In some embodiments, the CpG oligonucleotide has the structure of a covalently closed DNA molecule comprising a single-stranded loop and a double-stranded stem, or two single-stranded loops connected by a double-stranded stem, wherein the stem and / or one or two loops may contain one or more CpG region motifs.In some embodiments, the CpG oligonucleotides of this disclosure may comprise any novel CpG region motif disclosed herein and have the structure of a covalently closed DNA molecule comprising a single-stranded loop and a double-stranded stem, or two single-stranded loops connected by a double-stranded stem, wherein the stem and / or one or two loops may comprise one or more CpG region motifs. In some embodiments, this disclosure relates to CpG oligonucleotides comprising a first strand comprising one or more novel CpG region motifs, optionally further comprising a second strand. In some embodiments, the C residues in the CpG comprise base and / or sugar modifications, such as 5-methyl C, 2'-modified 5mC (e.g., 2'-OMe 5-methyl C; or 2'-MOE m5C, etc.). In some embodiments, immunomodulatory CpG oligonucleotides comprise base and / or sugar modifications, such as 5-methyl C, 2'-modified 5mC (e.g., 2'-OMe 5-methyl C; or 2'-MOE m5C, etc.).

[0363] CpG oligonucleotides may contain one chain; alternatively, they may also contain a second chain or other additional chains. CpG oligonucleotides may also contain or be conjugated to other components that are not nucleotides.

[0364] Adjuvant: An "adjuvant" is an immunomodulatory agent that enhances the magnitude, breadth, quality, and / or lifespan of a specific immune response against a co-administered antigen. Among other things, adjuvants can be used to reduce the dose and frequency of immunization required to achieve protective immunity. In some embodiments, the provided CpG oligonucleotide technology (e.g., oligonucleotides, compositions, methods, etc.) can be used as an adjuvant. See, for example, Shirota et al. 2015 Vaccines 3:390-407, and the references cited therein.

[0365] agonism: As used herein, the terms “agonism,” “agonizing,” “induction,” “stimulation,” “immunostimulation,” etc., for an immune response mean, for example, the complete or at least partial activation or increase of the activity or ability to activate or deactivate an immune response (e.g., a response mediated by immune cells) in mammals such as mice or humans; such activation can be measured by any method known in the art. Methods include, but are not limited to, measuring changes in the secretion of cytokines such as interferon-α, interferon-γ, IL-4, IL-6, IL-8, IL-10, IL-12, TNF-α, etc. As non-limiting examples, such methods include the ELISPOT assay, the use of peripheral blood mononuclear cells, and other assays involving the measurement of immune activity in animals and cells. For example, the amount of cytokinin produced in cells can be determined using specific antibodies. In this way, the number of immune cells in the cells can be measured, and the immune-inducing activity can be evaluated. In various embodiments, the agonism of the immune response is mediated by CpG oligonucleotides. In various embodiments, if the CpG oligonucleotides are administered together with an immunomodulatory agent such as a vaccine, agonism can be measured by altering the antibody levels produced by the agent. In various embodiments, mammals include mice and humans as non-limiting examples.

[0366] Aliphatic: As used herein, “aliphatic” means a straight (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is fully saturated or contains one or more unsaturated units, or a substituted or unsubstituted monocyclic, bicyclic, or polycyclic hydrocarbon ring that is fully saturated or contains one or more unsaturated units (but not aromatic), or a combination thereof. Unless otherwise specified, an aliphatic group contains 1-100 aliphatic carbon atoms. In some embodiments, an aliphatic group contains 1-20 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-10 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-9 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-8 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-7 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-6 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1-5 aliphatic carbon atoms; in still other embodiments, the aliphatic group contains 1, 2, 3, or 4 aliphatic carbon atoms. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups, and hybrids thereof.

[0367] Alkenyl: As used herein, the term “alkenyl” refers to an alkyl group as defined herein that has one or more double bonds.

[0368] Alkyl: As used herein, the term "alkyl" is given its common meaning in the art and can include saturated aliphatic groups, including straight-chain alkyl, branched alkyl, cycloalkyl (alicyclic) groups, alkyl-substituted cycloalkyl, and cycloalkyl-substituted alkyl. In some embodiments, the alkyl group has 1-100 carbon atoms. In some embodiments, the straight-chain or branched alkyl group has about 1-20 carbon atoms in its main chain (e.g., for straight-chain C1-C1 alkyl). 20 For the C2-C branch 20 ), and alternatively about 1-10 carbon atoms. In some embodiments, the cycloalkyl ring has about 3-10 carbon atoms in its ring structure, wherein such ring is monocyclic, bicyclic or polycyclic, and alternatively has about 5, 6 or 7 carbons in the ring structure. In some embodiments, the alkyl group may be a lower alkyl group, wherein the lower alkyl group contains 1-4 carbon atoms (e.g., for straight-chain lower alkyl groups C1-C4).

[0369] Alkynyl group: As used herein, the term "alkynyl group" refers to an alkyl group as defined herein that has one or more triple bonds.

[0370] Animal: As used herein, the term "animal" means any member of the animal kingdom. In some embodiments, "animal" means a human being at any developmental stage. In some embodiments, "animal" means a non-human animal at any developmental stage. In some embodiments, a non-human animal is a mammal (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cattle, horses, primates, and / or pigs). In some embodiments, an animal includes, but is not limited to, mammals, birds, reptiles, amphibians, fish, and / or worms. In some embodiments, an animal may be a transgenic animal, a genetically engineered animal, and / or a clone.

[0371] Antagonism: As used herein, the terms "antagonism," "antagonizing," etc., of an immune response mean, for example, the complete or at least partial inactivation or reduction of the activity, inactivation, or reduction of the ability of an immune response (e.g., an immune cell-mediated response) to be active, or to be inactivated or reduced in activity, in mammals; such inactivation or reduction can be measured by any method known in the art. Methods include, but are not limited to, measuring changes in the secretion of cytokines such as interferon-α, interferon-γ, IL-4, IL-6, IL-8, IL-10, IL-12, TNF-α, etc. As non-limiting examples, such methods include the ELISPOT assay, the use of peripheral blood mononuclear cells, and other assays involving the measurement of immune activity in animals and cells. In various embodiments, the antagonism of the immune response is mediated by CpG oligonucleotides. In various embodiments, as non-limiting examples, mammals include mice and humans.

[0372] Antibody: As used herein, the terms “antibody,” “immunoglobulin,” and related terms refer to, for example, proteins (or fragments thereof, or biologically active fragments thereof) produced primarily by plasma cells used by the immune system to recognize, identify, and / or neutralize specific antigens, epitopes, structures, pathogens, nucleic acids, and other molecules. In some embodiments, antibodies recognize unique molecules of harmful agents called antigens via variable regions. In some embodiments, antibodies include, but are not limited to: monoclonal antibodies (including full-length antibodies having the Fc region of an immunoglobulin), antibody compositions having multi-epitope specificity, multi-specific antibodies (e.g., bispecific antibodies, biantibodies, and single-chain molecules), and antibody fragments. In some embodiments, antibodies are monoclonal antibodies, for example, antibodies obtained from a substantially homogeneous group of antibodies. In some embodiments, antibodies are chimeric antibodies, wherein a portion of the heavy chain and / or light chain is identical or homologous to a corresponding sequence in an antibody derived from a particular species or belonging to a particular antibody class or subclass, while the remaining portion of the chain is identical or homologous to a corresponding sequence in an antibody derived from another species or belonging to another antibody class or subclass, and fragments of such antibodies, provided they exhibit the desired biological activity. The chimeric antibodies described herein include, but are not limited to, "primate-like" antibodies, which comprise a variable domain antigen-binding sequence derived from non-human primates (e.g., Old World monkeys, apes, etc.) and a human constant region sequence. In some embodiments, the antibody fragment comprises a portion of a complete antibody, preferably the antigen-binding and / or variable region of the complete antibody. Non-limiting examples of antibody fragments include Fab, Fab', F(ab′)2, and Fv fragments; biantibodies; linear antibodies; nanobodies; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments. In some embodiments, the antibody may be any of five classes: IgA, IgD, IgE, IgG, and IgM, and may be encoded by mRNA, including heavy chains designated as α, δ, ε, γ, and μ, respectively. In some embodiments, any of the antibody subclasses may be partially or fully encoded, and includes the following subclasses: IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. In various embodiments, antibodies can be used to treat conditions or diseases in a number of therapeutic areas, including but not limited to hematologic, cardiovascular, CNS, poisoning (including antivenom), dermatology, endocrinology, gastrointestinal, medical imaging, musculoskeletal, oncology, immunology, respiratory, sensory, and anti-infective fields. In some embodiments, the antibody is any of an antibody variant, including but not limited to substitution variants, conserved amino acid substitutions, insertion variants, deletion variants, and / or covalent derivatives. In one embodiment, the primary construct and / or mmRNA disclosed herein may encode the Fc region of an immunoglobulin. In another embodiment, the primary construct and / or mmRNA may encode the Fc region of a variant immunoglobulin.In some embodiments, the primary construct and / or mmRNA may encode an antibody having the Fc region of a variant immunoglobulin, as described in U.S. Patent No. 8,217,147.

[0373] Antisense oligonucleotide: As used herein, the term "antisense oligonucleotide" or "ASO" refers to an oligonucleotide or analog having, containing, or composed of a base sequence or analog, which allows the oligonucleotide or analog to hybridize with a target molecule, such as another nucleic acid, a modified nucleic acid, or a nucleic acid analog, for example, by base pairing, such as Watson-Crick base pairing or non-Watson-Crick base pairing. In some embodiments, the antisense oligonucleotide is fully complementary or nearly fully complementary to the target molecule. In some embodiments, any oligonucleotide of any type described herein or known in the art may be used as an antisense oligonucleotide. In various embodiments, the antisense oligonucleotide may perform or participate in any of a variety of biological functions, including RNA interference, RNase H-mediated cleavage, exon skipping, exon skipping prevention, enhancement or blocking of the binding of a reagent (e.g., protein, RNA, protein-RNA complex, or any other molecule) to another nucleic acid, or any other biological function performed by the antisense oligonucleotide, as described herein or known in the art. In some embodiments, the antisense oligonucleotide is an oligonucleotide that participates in RNase H-mediated cleavage; for example, the antisense oligonucleotide hybridizes to a portion of the target mRNA in a sequence-specific manner, thus targeting the mRNA for RNase H cleavage. In some embodiments, the antisense oligonucleotide is significantly involved in RNase H-mediated cleavage of mutant alleles, but much less involved in RNase H-mediated cleavage of wild-type alleles (e.g., not significantly involved in RNase H-mediated cleavage of the target wild-type allele).

[0374] Approximately: As used herein, the term “approximately” or “about” when referring to numbers is generally considered to include numbers that fall within the range of 5%, 10%, 15%, or 20% in either direction (greater or less) unless otherwise stated or obvious from the context (other than such numbers being less than 0% or more than 100% of possible values). In some embodiments, the term “about” when referring to dosage means ±5 mg / kg / day.

[0375] Aptamer: As used herein, the term "aptamer" refers to a nucleic acid molecule, such as a molecule comprising RNA, DNA, or a nucleotide analog, which is capable of binding to a specific molecule with high affinity and specificity (Ellington et al., Nature 346, 818-22 (1990); and Tuerk et al., Science 249, 505-10 (1990)). In various embodiments, ligands binding aptamers include, but are not limited to, small molecules such as drugs, metabolites, intermediates, cofactors, transition state analogs, ions, metals, nucleic acids, and toxins. In some embodiments, aptamers may also bind to natural and synthetic polymers, including proteins, peptides, nucleic acids, polysaccharides, glycoproteins, hormones, receptors, and cell surfaces such as cell walls and cell membranes. In some embodiments, aptamers are about 10 to about 300 nucleotides in length. In some embodiments, aptamers are about 30 to about 100 nucleotides in length. In some embodiments, aptamers can bind to a wide variety of molecules. Each of these molecules can be used as a regulator of gene expression. In some embodiments, organic molecules, nucleotides, amino acids, polypeptides, target features on cell surfaces, ions, metals, salts, and sugars have been shown to be suitable for isolating aptamers that specifically bind to their respective ligands. For example, organic dyes such as Hoechst 33258 have been reported as target ligands for in vitro aptamer selection (Werstuck and Green, Science 282:296-298 (1998)). Other small organic molecules such as dopamine, theophylline, sulforhodamine B, and cellobiose have also been reported as ligands in aptamer isolation. In some embodiments, aptamers are isolated for use with antibiotics such as kanamycin A, livermycin, tobramycin, neomycin B, purpuricin, chloramphenicol, and streptomycin. For a review of aptamers that recognize small molecules, see Famulok, Science 9:324-9 (1999). In some embodiments, the ligands for aptamers of nucleic acids regulated by the aptamer of this disclosure are small organic molecules that are permeable to cells. Small organic molecules that do not generally inhibit translation can be used as ligands. Small molecules can also exhibit in vivo persistence sufficient to achieve the desired level of translational repression. Molecules can also be screened to identify those that are bioavailable, for example, after oral administration. In some embodiments, the ligand is non-toxic. The ligand may optionally be a drug, including, for example, a steroid. In some embodiments, the ligand may be pharmacologically inert in some methods of controlling gene expression. In some embodiments, the ligand is a polypeptide whose presence in cells indicates a disease or pathological condition. In other embodiments, the ligand of the aptamer is an antibiotic, such as chloramphenicol. In an alternative embodiment, the ligand of the aptamer is an organic dye, such as Hoeschst dye 33258. In another embodiment, the ligand may be a metal ion. In one specific embodiment, the aptamer-regulated aptamer domain of a nucleic acid responds to binding with caffeine.In some embodiments, aptamers are developed to bind specific ligands by employing known in vivo or in vitro (most typically, in vitro) selection techniques known as SELEX (Ellington et al., Nature 346, 818-22 (1990); and Tuerk et al., Science 249, 505-10 (1990)). Methods for preparing aptamers are also described in, for example, U.S. Patent No. 5,582,981, PCT Publication No. WO 00 / 20040, U.S. Patent No. 5,270,163, Lorsch and Szostak, Biochemistry, 33:973 (1994), Mannironi et al., Biochemistry 36:9726 (1997), Blind, Proc. Nat'l. Acad. Sci. USA 96:3606-3610 (1999), Huizenga and Szostak, Biochemistry, 34:656-665 (1995), PCT Publication Nos. WO 99 / 54506, WO 99 / 27133, WO 97 / 42317 and U.S. Patent No. 5,756,291. In some embodiments, aptamers include those that target any of the following: VEGF, tissue factor pathway inhibitor (TFPI), factor IXa, complement group 5 (C5), IV Tat protein, and HIV Rev protein.

[0376] Aryl: As used herein, the term "aryl," used alone or as part of a larger category such as "aralkyl," "aralkyloxy," or "aryloxyalkyl," refers to a monocyclic, bicyclic, or polycyclic system having a total of five to thirty ring members, wherein at least one ring in said system is aromatic. In some embodiments, the aryl group is a monocyclic, bicyclic, or polycyclic system having a total of five to fourteen ring members, wherein at least one ring in said ring system is aromatic, and wherein each ring in said ring system contains 3 to 7 ring members. In some embodiments, the aryl group is a biaryl group. The term "aryl" may be used interchangeably with the term "aryl ring." In some embodiments of the invention, "aryl" refers to an aromatic ring system, including but not limited to phenyl, biphenyl, naphthyl, binatyl, anthracene, etc., which may have one or more substituents. As used herein, it also includes, within the scope of the term "aryl," groups in which the aromatic ring is fused with one or more non-aromatic rings, such as indanyl, phthalimide, naphthalimide, phenanthridine, or tetrahydronaphthyl, etc. In some embodiments, the aryl group has a linker or linker point on the aromatic ring.

[0377] Bioactive Agent: As used herein, the term "bioactive agent" refers to any agent (including, but not limited to, active compounds) that has, mediates, or participates in biological activity, or is capable of having, mediating, or participating in biological activity. In various embodiments, the bioactive agent may be organic or inorganic. Non-limiting examples of bioactive agents include: small molecules, peptides, proteins, components of CRISPR-Cas systems, carbohydrates, therapeutic agents, chemotherapeutic agents, vaccines, nucleic acids, and lipids. In some embodiments, the bioactive agent comprises inorganic or organic molecules, including small molecules, peptides (e.g., cell-penetrating peptides), carbohydrates (including monosaccharides, oligosaccharides, and polysaccharides), proteins (including nucleoproteins, mucins, lipoproteins, synthetic polypeptides, or small molecules linked to proteins, glycoproteins), steroids, nucleic acids, lipids, hormones, or combinations thereof, which, when administered in vivo to animals (including, but not limited to, birds and mammals, including humans), cause a biological effect. In some embodiments, the bioactive agent is charged. In some embodiments, the bioactive agent is positively charged. In some embodiments, the bioactive agent is negatively charged. In some embodiments, the bioactive agent is a nucleic acid. In some embodiments, the bioactive agent is a CpG oligonucleotide.

[0378] Carbohydrates: As used herein, the term "carbohydrate" refers to a biomolecule containing carbon, oxygen, and hydrogen; in some embodiments, carbohydrates include sugars, starches, or cellulose. In some embodiments, sugars include monosaccharides, disaccharides, oligosaccharides, and polysaccharides. In some embodiments, polysaccharides serve as structural components or for energy storage. In some embodiments, carbohydrates are involved in the immune system, fertilization, prevention of pathogenesis, blood clotting, and / or development. In some embodiments, bioactive agents contain carbohydrates.

[0379] Cell-penetrating peptides: As used herein, the terms “cell-penetrating peptide,” “cell-penetrating protein,” “CPP,” etc., refer to peptides or proteins capable of crossing cell membranes. In various embodiments, CPPs are conjugated to bioactive agents to facilitate the transport of reagents across membranes. In some embodiments, CPPs can be used to facilitate the uptake of such reagents across cell membranes, such as the plasma membrane and / or nuclear membrane of mammalian cells. In some embodiments, CPPs are capable of internalization into the cell and passing through cell membranes (particularly including the outer “restrictive” cell membrane (often also referred to as the “plasma membrane”), endosome membrane, and endoplasmic reticulum membrane), and / or directing a given reagent or cargo through these cell membranes. In some embodiments, any possible internalization mechanisms are envisioned, including energy-dependent (i.e., active) transport mechanisms (e.g., endocytosis) and energy-independent (i.e., passive) transport mechanisms (e.g., diffusion). In various embodiments, internalization involves localizing at least a portion of the peptide that has passed through the plasma cell membrane into the cytoplasm (in contrast to localization in different cellular compartments such as vesicles, endosomes, or the nucleus). Non-limiting examples of CPPs are peptides having the amino acid sequence GRKKRRQRRRPPQ (Vives; E. et al. (1997), ibid.). Non-limiting examples of CPPs include the HIV-1 TAT translocation domain (Green; M. and Loewenstein, PM (1988) Cell 55, 1179-1188) and the homologous domain from the antennapedia protein of Drosophila (Joliot; A. et al. (1991) Proc. Natl. Acad. Sci. USA). 88, 1864-1868); the 16-amino acid sequence of pAntp, known as penetratin or tentacledopodin (Derossi, D. et al. (1994) J. Biol. Chem. 269, 10444-10450); the base sequence of HIV-1 Tat protein (Vives, E. et al. (1997) J. Biol. Chem. 272, 16010-16017); and a synthetic peptide developed from the amphiphilic model peptide MAP (Oehlke, J. et al. (1998) Biochim. Biophys. Acta 1414, 127-139). Further non-limiting examples of CPP are described in U.S. Patent Nos. 9,303,076; and 9,302,014.

[0380] Characteristic portion: As used herein, the phrase "characteristic portion" or "characteristic sequence" of a protein or polypeptide (or nucleic acid), etc., is a continuous segment containing amino acids (or nucleotides, modified nucleotides, or nucleotide analogs), or a collection of continuous segments containing amino acids (or nucleotides, modified nucleotides, or nucleotide analogs), which together are characteristic of the protein or polypeptide (or nucleic acid). Each such continuous segment generally contains at least two amino acids. Furthermore, those skilled in the art will understand that at least 5, 10, 15, 20, or more amino acids (or nucleotides, modified nucleotides, or nucleotide analogs) are typically required to be characteristic of a protein (or nucleic acid). Generally, a characteristic portion is a portion that shares at least one functional characteristic with the associated intact protein, in addition to the sequence identity specified above. In some embodiments, the characteristic sequence is a sequence found in all members of a polypeptide or nucleic acid family, and is therefore available to those skilled in the art for defining members of the family.

[0381] Characteristic structural element: As used herein, the term “characteristic structural element” refers to a unique structural element (e.g., a core structure, a set of side attachments, sequence elements, etc.) found in all members of a family of peptides, small molecules, or nucleic acids, and is therefore used by those skilled in the art to define members of a family.

[0382] Chemotherapy agents: As used herein, the term "chemotherapy agent" refers to a drug or agent capable of killing growing cells, including cancer cells. Chemotherapy agents are frequently used to treat various forms of cancer. In some embodiments, non-limiting examples of chemotherapy agents include doxorubicin, paclitaxel (Taxostatin), docetaxel (Taxotere), actinomycin D, doxorubicin, daunorubicin, pentorubicin, idarubicin, epirubicin, bleomycin, procainoxine, camptothecin and its derivatives, bleomycin, etoposide, teniposide, mitomycin, vinca alkaloids such as vincristine and vinblastine, and platinum-based compounds such as cisplatin and gemcitabine. In some embodiments, the composition comprises a lipid and a portion of a chemotherapy agent capable of mediating at least one function of the chemotherapy agent.

[0383] Comparable: As used herein, the term "comparable" is used to describe two sets (or more sets) of conditions or environments that are sufficiently similar to each other to allow for comparison of obtained results or observed phenomena. In some embodiments, a comparable set of conditions or environments is characterized by a plurality of substantially identical features and one feature that varies slightly. Those skilled in the art will appreciate that a set of conditions is comparable to each other when characterized by a sufficient number and type of substantially identical features to guarantee the reasonable conclusion that differences in results or observed phenomena obtained under different sets of conditions or environments are caused by or indicated by changes in those features.

[0384] Conjugate: As used herein, the term "conjugate" refers to a composition comprising two or more components, portions, or molecules that are physically linked together, for example, directly or indirectly, by covalent bonds (as a non-limiting example, where one or more connectors are inserted between two adjacent components, portions, or molecules). As used herein, the term "conjugated" in reference to a composition comprising two or more components, portions, or molecules means the state in which two or more components, portions, or molecules are physically linked together. In some embodiments, the composition comprises lipids and bioactive agents, wherein the lipids and bioactive agents are conjugated.

[0385] CRISPR: As used herein, the terms “CRISPR,” “CRISPR / Cas system,” etc., refer to a bioactive system involving clusters of regularly spaced short palindromic repeats (CRISPR), which is a segment of prokaryotic DNA containing a short repeating sequence of bases, or various artificial systems derived from or inspired by naturally occurring prokaryotic systems. In some embodiments, the bioactive agent comprises components of a CRISPR / Cas system. In some embodiments, components of a CRISPR / Cas system include, but are not limited to: a gene encoding a Cas protein (including, by way of non-limiting example, Cas9, dCas9, and variants thereof, both naturally occurring and artificial) or the protein itself; guide RNA; any component of the Cas crRNA complex; the cas (CRISPR-associated) gene or gene product; and any other bioactive molecules involved in naturally occurring or artificial CRISPR / Cas systems. See, for example, Jinek et al., 2012 Science 337:816-821; Cong et al., 2013 Science 339:819-823; U.S. Patent Application 20140234972; DiCarlo, 2013 Nucl. Acids Res. 41:4336-43; Hwang et al., 2013 Nat. Biotech. 31:227-9; and Flowers et al., 2014 Development 141:2165-71.

[0386] Alicyclic: As used herein, the term "alicyclic" refers to a saturated or partially unsaturated alicyclic monocyclic, bicyclic, or polycyclic system having, for example, 3 to 30 members, wherein the alicyclic system is optionally substituted. Alicyclic groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, norbornyl, adamantyl, and cyclooctadienyl. In some embodiments, the cycloalkyl group has 3-6 carbons. The term "alicyclic" may also include an alicyclic ring fused to one or more aromatic or non-aromatic rings, such as decahydronaphthyl or tetrahydronaphthyl, wherein the radical or attachment point is located on the alicyclic ring. In some embodiments, the carbocyclic group is bicyclic. In some embodiments, the carbocyclic group is tricyclic. In some embodiments, the carbocyclic group is polycyclic. In some embodiments, "alicyclic" (or "carbocyclic" or "cycloalkyl") refers to monocyclic C3-C6 hydrocarbons, or C8-C10 bicyclic hydrocarbons (which are fully saturated or contain one or more unsaturated units, but are non-aromatic, and have a single attachment point to the remainder of the molecule), or C9-C16 tricyclic hydrocarbons (which are fully saturated or contain one or more unsaturated units, but are non-aromatic, and have a single attachment point to the remainder of the molecule).

[0387] Dosing regimen: As used herein, a “dosing regimen” or “treatment regimen” refers to a set of unit doses (usually more than one) administered to a subject, typically separated by a period of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which may involve one or more doses. In some embodiments, a dosing regimen includes multiple doses, each separated from the others by a period of equal length; in some embodiments, a dosing regimen includes multiple doses and at least two distinct periods separating the individual doses. In some embodiments, all doses within a dosing regimen have the same unit dosage. In some embodiments, the different doses within a dosing regimen have different amounts. In some embodiments, a dosing regimen includes a first dose at a first dosage, followed by one or more additional doses at a second dosage different from the first dosage. In some embodiments, a dosing regimen includes a first dose at a first dosage, followed by one or more additional doses at a second dosage identical to the first dosage.

[0388] Equivalent reagent: As used herein, the term "equivalent reagent" refers to a molecule, compound, or other reagent capable of functionally replacing another molecule, compound, or reagent, even if the structures of said molecule, compound, or reagent are not similar, identical, or related. Those skilled in the art will understand upon reading this disclosure that, in the context of this disclosure, the scope of applicable reagents is not limited to those explicitly mentioned or exemplified herein. In particular, those skilled in the art will recognize that active agents typically have a structure consisting of a core and attached side portions, and further should understand that simple changes to such core and / or side portions may not significantly alter the activity of the reagent. For example, in some embodiments, replacing one or more side portions with groups having comparable three-dimensional structural and / or chemical reactivity characteristics can produce a substituted compound or portion equivalent to or partially equivalent to the parent reference compound. In some embodiments, adding or removing one or more side portions can produce a substituted compound equivalent to the parent reference compound. In some embodiments, changes to the core structure, such as by adding or removing a small number of bonds (typically no more than 5, 4, 3, 2, or 1 bond, and typically only single bonds), can produce a substituted compound equivalent to the parent reference compound. In many embodiments, equivalent compounds can be prepared using readily available raw materials, reagents, and conventional or provided synthetic procedures, by means of methods shown, for example, in the general reaction schemes described below, or by modifications thereof. Variations known per se but not mentioned herein can also be utilized in these reactions.

[0389] Equivalent dose: As used herein, the term "equivalent dose" is used to compare doses of different pharmaceutical active agents that affect the same biological outcome. Two different agents are considered "equivalent" to each other according to this disclosure if doses of both agents achieve comparable levels or extents of biological outcome. In some embodiments, equivalent doses of different pharmaceutical agents used according to this disclosure are determined using in vitro and / or in vivo assays as described herein. In some embodiments, one or more lysosomal activators used according to this disclosure are used at doses equivalent to a reference lysosomal activator; in some such embodiments, the reference lysosomal activator for such purposes is selected from: small molecule allosteric activators (e.g., pyrazolopyrimidine), iminosaccharides (e.g., isofagomine), antioxidants (e.g., n-acetylcysteine), and cell transport regulators (e.g., Rab1a peptide).

[0390] Halogen: As used herein, the term “halogen” means F, Cl, Br or I.

[0391] Heteroaliphatic: As used herein, the term "heteroaliphatic" is given its common meaning in the art and refers to an aliphatic group as described herein, wherein one or more carbon atoms are independently replaced by one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, etc.). In some embodiments, one or more units selected from C, CH, CH2, or CH3 are independently replaced by one or more heteroatoms (including their oxidized and / or substituted forms). In some embodiments, the heteroaliphatic group is a heteroalkyl group. In some embodiments, the heteroaliphatic group is a heteroalkenyl group.

[0392] Heteroalkyl: As used herein, the term “heteroalkyl” is given its common meaning in the art and refers to an alkyl group as described herein, wherein one or more carbon atoms are independently replaced by one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, etc.). Examples of heteroalkyl groups include, but are not limited to, alkoxy, poly(ethylene glycol)-, alkyl-substituted amino, tetrahydrofuranyl, piperidinyl, morpholinyl, etc.

[0393] Heteroaryl: As used herein, the terms “heteroaryl” and “heteroaryl-”, used alone or as part of a larger portion (e.g., “heteroarylalkyl” or “heteroarylalkoxy”), refer to a monocyclic, bicyclic, or polycyclic system having a total of five to thirty ring members, wherein at least one ring in the system is aromatic and at least one aromatic ring atom is a heteroatom. In some embodiments, a heteroaryl group is a group having 5 to 10 ring atoms (i.e., monocyclic, bicyclic, or polycyclic), and in some embodiments 5, 6, 9, or 10 ring atoms. In some embodiments, a heteroaryl group has 6, 10, or 14 π electrons shared in a cyclic array; and in addition to a carbon atom, it has one to five heteroatoms. Heteroaryl groups include, but are not limited to, thiophene, furanyl, pyrrole, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiazolyl, pyridinyl, pyrazinyl, indazinyl, purine, naphthidyl, and piperidinyl. In some embodiments, the heteroaryl group is a heterodiaryl group, such as bipyridinyl. As used herein, the terms “heteroaryl” and “heteroaryl-” also include groups in which the heteroaryl ring is fused to one or more aromatic rings, alicyclic rings, or heterocyclic rings, wherein the atomic group or attachment point is located on the heteroaryl ring. Non-limiting examples include indolyl, isoindolyl, benzothiophenyl, benzofuranyl, dibenzofuranyl, indazoleyl, benzimidazolyl, benzothiazolyl, quinolinyl, isoquinolinyl, cenolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolinyl, carbazoleyl, acridineyl, phenazinyl, phenothiazine, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]–1,4–oxazine–3(4H)–one. The heteroaryl group can be monocyclic, bicyclic, or polycyclic. The term “heteroaryl” is used interchangeably with the terms “heteroaryl ring,” “heteroaryl group,” or “heteroaryl family,” any of which includes optionally substituted rings. The term “heteroarylalkyl” refers to an alkyl group substituted with a heteroaryl group, wherein the alkyl and heteroaryl portions are independently optionally substituted.

[0394] Heteroatom: As used herein, the term "heteroatom" means an atom that is not carbon or hydrogen. In some embodiments, a heteroatom is oxygen, sulfur, nitrogen, phosphorus, or silicon (including any oxidized form of nitrogen, sulfur, phosphorus, or silicon; any basic nitrogen or quaternized form of substituted nitrogen in a heterocyclic ring (e.g., N (as in 3,4-dihydro-2H-pyrrole), NH (as in pyrrolealkyl), or NR). + (e.g., in N-substituted pyrroleyl groups); etc.).

[0395] Heterocyclic group: As used herein, the terms “heterocycle,” “heterocyclic group,” “heterocyclic atom group,” and “heterocyclic ring,” as used herein, are used interchangeably and refer to a monocyclic, bicyclic, or polycyclic portion (e.g., 3- to 30-membered) that is saturated or partially unsaturated and has one or more heteroatom ring atoms. In some embodiments, the heterocyclic group is a stable 5- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocyclic portion that is saturated or partially unsaturated and has one or more, preferably one to four, heteroatoms as defined above, in addition to a carbon atom. When used with respect to the ring atoms of a heterocycle, the term “nitrogen” includes substituted nitrogen. For example, in a saturated or partially unsaturated ring having 0–3 heteroatoms selected from oxygen, sulfur, or nitrogen, nitrogen may be N (e.g., in 3,4-dihydro-2H-pyrrole), NH (e.g., in pyrrolidinyl), or +NR (e.g., in N-substituted pyrrolidinyl). Heterocyclic rings can be attached to their side groups at any heteroatom or carbon atom, resulting in a stable structure, and any ring atom can optionally be substituted. Examples of such saturated or partially unsaturated heterocyclic groups include, but are not limited to, tetrahydrofuranyl, tetrahydrothiophenyl, pyrrolyl, piperidinyl, pyrrololinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolyl, piperazine, dioxalyl, dioxopentyl, and diazapyridine. Basic, oxygen and nitrogen Basic, sulfur-nitrogen Heterocyclic, morpholino, and quinine cyclic groups. The terms “heterocyclic,” “heterocyclic group,” “heterocyclic ring,” “heterocyclic moiety,” and “heterocyclic group” are used interchangeably herein and also include groups in which the heterocyclic ring is fused to one or more aryl, heteroaryl, or alicyclic rings, such as dihydroindolyl, 3H-indolyl, chromyl, phenanthrenediyl, or tetrahydroquinolinyl. The heterocyclic group can be monocyclic, bicyclic, or polycyclic. The term “heterocyclic alkyl” refers to an alkyl group substituted with a heterocyclic group, wherein the alkyl group and the heterocyclic moiety are optionally substituted independently.

[0396] Immunomodulatory Nucleic Acids and CpG Oligonucleotides and Related Terminology: As used herein, the term "immunomodulatory nucleic acid" refers to a nucleic acid capable of modulating an immune response in, for example, a mammalian subject, such as a human subject. In various embodiments, immunomodulatory nucleic acids are capable of stimulating (activating) an immune response; in other embodiments, different immunomodulatory nucleic acids are capable of depressing (antagonizing) an immune response. In one non-limiting example, immunomodulatory nucleic acids include CpG oligonucleotides. As used herein, the term "CpG oligosaccharide nucleotide" refers to an oligonucleotide or other nucleic acid containing a CpG motif, wherein the oligonucleotide may comprise nucleotides, modified nucleotides, and / or nucleotide analogs. In some embodiments, CpG oligonucleotides are capable of activating a TLR9-mediated and / or TLR9-associated immune response in at least one assay; in some embodiments, CpG oligonucleotides are capable of antagonizing an immune response in at least one assay. In others, neither is possible. In some embodiments, CpG oligonucleotides may optionally comprise sugars, bases, or phosphate esters (phosphodiesters), as well as modifications to secondary and tertiary structures. See, for example, Vollmer et al., 2009 Adv. Drug. Del. Rev. 61:195-204. In some embodiments, an example of a modified phosphodiester is a thiophosphate. In some embodiments, one or more thiophosphates (PS) are incorporated into the backbone of the CpG oligonucleotide (in place of phosphodiester or PO); PS has been reported to reduce nuclease degradation and, in at least some cases, to enhance the immunogenicity of the CpG oligonucleotide by 10 to 100 times. Vollmer et al., 2009 Adv. Drug Del. Rev. 61:195-204. In some embodiments, the CpG oligonucleotide may comprise all phosphodies in the backbone; or a mixture of phosphodiesters and nucleoside intermolecular heads in the backbone; or all nucleoside intermolecular heads in the backbone. For example, WO 2015 / 108047 reports a CpG oligonucleotide having a mixture of phosphodiester and nucleoside (e.g., thiophosphate) bonds; in this case, the CpG region motif comprises a phosphodiester, wherein the thiophosphate is side-mounted to the CpG region motif. In various embodiments, the CpG oligonucleotide may comprise a thiophosphate having an Rp or Sp conformation. As used in the references and as used herein, the terms “CpG ODN” or “CpG oligodeoxynucleotide” are not strictly limited to oligonucleotides in which “p” is a phosphate; these terms have been previously used in the literature and are used herein to cover such oligonucleotides that comprise one or more thiophosphates instead of phosphodiester, or even all thiophosphates in their backbone, and / or other modifications. In some embodiments, “immunostimulatory” CpG oligonucleotides are capable of stimulating an immune response. In some embodiments, the CpG oligonucleotide may comprise a single chain; or, optionally, it may also comprise a second chain or other additional chains.In some embodiments, the CpG oligonucleotide may also comprise or be conjugated to other components, said other components being not nucleotides. In some embodiments, the composition comprises a portion of a lipid and an immunomodulatory nucleic acid capable of mediating at least one function of the immunomodulatory nucleic acid. In some embodiments, immunomodulatory activity is the activity of molecules that stimulate or antagonize immune responses, said molecules including, but not limited to, oligonucleotides.

[0397] Immune stimulation: As used herein, the term “immune stimulation” refers to a bioactive agent that has or can have an agonistic effect on at least one immune response, such as CpG oligonucleotides as a non-limiting example.

[0398] Intraperitoneal: As used herein, the phrases “intraperitoneal administration” and “intraperitoneal administration” have their meaning as understood in the art as referring to the administration of a compound or composition into the peritoneum of a subject.

[0399] In vitro: As used herein, the term “in vitro” means that the event occurs in an artificial environment, such as in a test tube or reaction vessel, in a cell culture, etc., rather than in a living organism (e.g., an animal, plant, and / or microorganism).

[0400] In vivo: As used in this article, the term “in vivo” refers to an event that occurs within an organism (e.g., an animal, plant, and / or microorganism).

[0401] Linker: As used herein, the term "linker" refers to a portion that connects two parts of a composition; as a non-limiting example, a linker physically links nucleic acids (including, but not limited to, CpG oligonucleotides) to lipids. Non-limiting examples of suitable linkers include: uncharged linkers; charged linkers; alkyl-containing linkers; phosphate-containing linkers; branched linkers; unbranched linkers; linkers containing at least one cleaving group; linkers containing at least one redox cleaving group; linkers containing at least one phosphate-based cleaving group; linkers containing at least one acid cleaving group; linkers containing at least one ester-based cleaving group; and linkers containing at least one peptide-based cleaving group. Other non-limiting examples of linkers are described herein or in [the following text is missing from the original] Figure 7 The details are as follows.

[0402] Linking portion: As used herein, the term "linking portion" refers to the portion that links one molecule to another. In some embodiments, the linking portion is optionally located between the terminal nucleoside and a solid support or between the terminal nucleoside and another nucleoside, nucleotide, or nucleic acid.

[0403] Lower alkyl groups: As used herein, the term “lower alkyl group” refers to a C1-4 linear or branched alkyl group. Exemplary lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.

[0404] Lipids: As used herein, the term "lipid" refers to any member of a macromolecular group, which is generally at least partially hydrophobic or amphiphilic, and particularly includes phospholipids, triglycerides, diglycerides, monoglycerides, fat-soluble vitamins, sterols, fats, and waxes. In some embodiments, lipids include fatty acids, glycerides, glycerophospholipids, sphingolipids, sterol lipids, isopentenyl lipids, glycolipids, polyketide compounds, and other molecules. In some embodiments, lipids comprise linear, saturated, or partially unsaturated aliphatic chains, for example having a C1... 10 -C 80 or C 10 -C 60 or C 10 -C 40 The length within the range. In some embodiments, lipids may optionally contain one or more C 1-4 Aliphatic groups substituted with linear, saturated, or partially unsaturated aliphatic chains. In some embodiments, lipids include, but are not limited to, lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, α-linolenic acid, γ-linolenic acid, docosahexaenoic acid (cis-DHA), alginate, and dilinolenic acid. In some embodiments, lipids include, but are not limited to: amino lipids; amphiphilic lipids; anionic lipids; apolipoproteins; cationic lipids; low molecular weight cationic lipids; cationic lipids such as CLinDMA and DLinDMA; ionizable cationic lipids; masking components; accessory lipids; lipopeptides; neutral lipids; neutral zwitterionic lipids; hydrophobic small molecules; hydrophobic vitamins; PEG-lipids; uncharged lipids modified with one or more hydrophilic polymers; phospholipids; phospholipids such as 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine; stealth lipids; sterols; cholesterol; and targeting lipids; and any other lipids described herein or reported in the art. In some embodiments, the composition comprises a lipid and a portion of another lipid capable of mediating at least one function of the other lipid. In various embodiments, the compositions of this disclosure comprise any one or more of any lipids described herein or known in the art.

[0405] lncRNA: As used herein, the terms “long non-coding RNA” and “lncRNA” refer to non-protein-coding RNA transcripts longer than approximately 200 nucleotides. This number limit distinguishes long ncRNAs from small regulatory RNAs, such as microRNAs (miRNAs), small interfering RNAs (siRNAs), Piwi-interacting RNAs (piRNAs), small nucleolar RNAs (snoRNAs), and other short RNAs. In some embodiments, the lncRNA has one or more markers of the mRNA, including 5' capping, splicing, and polyadenylation, but has few or no open reading frames (ORFs). In some embodiments, the lncRNA is Air or Xist. In some embodiments, the lncRNA plays a role in regulating the expression of another gene. In some embodiments, the lncRNA is any lncRNA listed in a lncRNA database, including but not limited to: ChIPBase, C-It-Loci, LNCipedia, lncRNABase, lncRNAdb, lncRNome, MONOCLdb, NONCODE, and NRED. In some embodiments, the composition comprises a portion of lipids and a portion of lncRNA, said portion being capable of mediating at least one function of the lncRNA.

[0406] mRNA: As used herein, the terms “messenger RNA,” “mRNA,” etc., refer to any of the large family of RNA molecules that transmit genetic information from DNA to ribosomes, wherein they specify the amino acid sequence of the protein product of gene expression. In various embodiments, after primary transcript mRNA (referred to as premRNA) is transcribed by RNA polymerase, processed mature mRNA is translated into an amino acid polymer: protein, as summarized by the central dogma of molecular biology. In some embodiments, mRNA includes modified mRNA or mmRNA. U.S. Patent No. 9,220,792. In some embodiments, mRNA encodes any of the following: allergens, blood components, gene therapy products, human tissue or cell products for transplantation, vaccines, antibodies, cytokines, growth factors, enzymes, thrombolytic agents, or immunomodulators. In some embodiments, the composition comprises a portion of lipids and mRNA, said portion being capable of mediating at least one function of the mRNA.

[0407] ncRNA: As used herein, the term “ncRNA” refers to non-coding RNA, of which several types exist, including but not limited to lncRNA (long non-coding RNA). In some embodiments, ncRNAs are involved in regulating the expression of genes or proteins or gene products. Wahlestedt 2013 Nat. Rev. Drug Disc. 12:433-446. Antagonists against ncRNAs have been reported. Meng et al., 2015 Nature 518:409-412; and Ling et al., 2013 Nature Rev. Drug Discov. 12:847-865. In some embodiments, the composition comprises nucleic acids (including but not limited to CpG oligonucleotides) and lipids.

[0408] Optionally substituted: As described herein, compounds of this disclosure, such as oligonucleotides, may contain optionally substituted and / or substituted moieties. Generally, regardless of whether the term “optionally” has been used previously, the term “substituted” means that one or more hydrogens of the specified moiety are substituted by a suitable substituent. Unless otherwise stated, an “optionally substituted” group may have a suitable substituent at each substituted position of the group, and when more than one position in any given structure is substituted by more than one substituent selected from a particular group, the substituents may be the same or different at each position. In some embodiments, the optionally substituted group is unsubstituted. The combinations of substituents contemplated in this disclosure are preferably those that result in the formation of stable or chemically viable compounds. As used herein, the term “stable” means a compound that is substantially unchanged when subjected to conditions that allow for its production, detection, and, in some embodiments, its recovery, purification, and use for one or more purposes disclosed herein.

[0409] Suitable monovalent substituents include halogens; ––(CH2) 0–4 R°;–(CH2) 0–4 OR°;-O(CH2) 0-4 R o ,–O–(CH2) 0– 4C(O)OR°;–(CH2) 0–4 CH(OR°)2;–(CH2) 0–4 Ph, which can be replaced by R°; -(CH2) 0–4 O(CH2) 0–1 Ph, which can be substituted by R°; –CH=CHPh, which can be substituted by R°; –(CH2) 0–4 O(CH2) 0–1 -pyridyl group, which can be substituted by R°; –NO2; –CN; –N3; (CH2) 0–4 N(R°)2;–(CH2)0–4 N(R°)C(O)R°; –N(R°)C(S)R°; –(CH2) 0–4 N(R°)C(O)NR°2; -N(R°)C(S)NR°2; –(CH2) 0–4 N(R°)C(O)OR°; –N(R°)N(R°)C(O)R°; –N(R°)N(R°)C(O)NR°2; –N(R°)N(R°)C(O)OR°; –(CH2) 0–4 C(O)R°; –C(S)R°; –(CH2) 0–4 C(O)OR°;–(CH2) 0–4 C(O)SR°;(CH2) 0–4 C(O)OSiR°3;–(CH2) 0–4 OC(O)R°;–OC(O)(CH2) 0–4 SR, -SC(S)SR°;-(CH2) 0–4 SC(O)R°;–(CH2) 0–4 C(O)NR°2; –C(S)NR°2; –C(S)SR°; –SC(S)SR°,(CH2) 0–4 OC(O)NR°2; C(O)N(OR°)R°; –C(O)C(O)R°; –C(O)CH2C(O)R°; -C(NOR°)R°; (CH2) 0–4 SSR°;-(CH2) 0–4 S(O)2R°;–(CH2) 0–4 S(O)₂OR°;–(CH₂) 0–4 OS(O)2R°;-S(O)2NR°2; (CH2) 0–4 S(O)R°; –N(R°)S(O)2NR°2; –N(R°)S(O)2R°; –N(OR°)R°; –C(NH)NR°2; –P(O)2R°; P(O)R°2; –OP(O)R°2; –OP(O)(OR°)2; –SiR°3; –OSiR°3; –(C 1–4 (linear or branched alkylene)O–N(R°)2; or –(C 1–4 (linear or branched alkylene)C(O)O–N(R°)2, wherein each R° may be substituted as defined below and is independently hydrogen, C 1–20 Aliphatic, with 1–5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus. 1–20 Heteroaliphatic, –CH2-(C 6-14 Aryl), –O(CH2) 0–1 (C 6-14Aryl), -CH2-(5-14 membered heteroaryl ring), having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, a 5-20 membered monocyclic, bicyclic or polycyclic, saturated or partially unsaturated aryl ring, or, notwithstanding the above definition, two independently occurring R° together with their inserted atoms form a 5-20 membered monocyclic, bicyclic or polycyclic, saturated or partially unsaturated aryl ring having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, which may be substituted as defined below.

[0410] Suitable monovalent substituents on R° (or the ring formed by two independently occurring R° along with their inserted atoms) are independently halogens, –(CH2). 0–2 R ● ,–(halogen R ● ),–(CH2) 0–2 OH,–(CH2) 0–2 OR ● ,–(CH2) 0–2 CH(OR ● )2;-O(halogen R ● ),–CN,–N3,–(CH2) 0–2 C(O)R ● ,–(CH2) 0–2 C(O)OH,–(CH2) 0–2 C(O)OR ● ,–(CH2) 0–2 SR ● ,–(CH2) 0–2 SH,–(CH2) 0–2 NH2,–(CH2) 0–2 NHR ● ,–(CH2) 0–2 NR ● 2,–NO2,–SiR ● 3,-OSiR ● 3,C(O)SR ● ,–(C 1–4 (linear or branched alkylene)C(O)OR ● Or –SSR ● , where each R ● It is unsubstituted, or when preceding "halogen", it is substituted by only one or more halogens and is independently selected from C. 1–4 Aliphatic, –CH2Ph, –O(CH2) 0–1 Ph, or a 5-6 membered saturated, partially unsaturated aryl ring with 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents on the saturated carbon atom of R° include =O and =S.

[0411] Suitable divalent substituents include the following: =O, =S, =NNR * 2、=NNHC(O)R * =NNHC(O)OR * =NNHS(O)2R * =NR * =NOR * 、 –O(C(R) * 2)) 2–3 O – or –S(C(R) * 2)) 2–3 S–, where each independently occurring R * C is selected from hydrogen and can be defined as follows: 1–6 Aliphatic, or having an unsubstituted 5-6 membered saturated, partially unsaturated aryl ring with 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents bonded to the ortho-substituted carbon of the "optionally substituted" group include: –O(CR * 2) 2–3 O–, where each independently occurring R * C is selected from hydrogen and can be defined as follows: 1–6 Aliphatic, or having an unsubstituted 5–6 saturated, partially unsaturated aryl ring with 0–4 heteroatoms independently selected from nitrogen, oxygen and sulfur.

[0412] R * Suitable substituents on aliphatic groups include halogens, -R ● -(halogen R) ● -OH, -OR ● –O (halogen R) ● ), –CN, –C(O)OH, –C(O)OR ● –NH2, –NHR ● –NR ● 2 or –NO2, where each R ● It is unsubstituted, or when preceding "halogen", it is substituted by only one or more halogens and is independently C. 1-4 Aliphatic, –CH2Ph, –O(CH2) 0–1 Ph, or a 5-6 member saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0413] In some embodiments, suitable substituents on the substituted nitrogen include or Each of them Independently, for hydrogen, the substituted C can be defined as follows: 1–6Aliphatic, unsubstituted –OPh, or having 0–4 unsubstituted 5–6 membered monocyclic, bicyclic, or polycyclic, saturated, or partially unsaturated aryl rings independently selected from nitrogen, oxygen, and sulfur, or, despite the above definition, two independently occurring Together with its inserted atoms, it forms an unsubstituted 3–12 saturated or partially unsaturated aryl monocyclic or bicyclic ring with 0–4 heteroatoms independently selected from nitrogen, oxygen and sulfur.

[0414] Suitable substituents on the aliphatic group can be halogens, -R ● -(halogen R) ● –OH, –OR ● –O (halogen R) ● ), –CN, –C(O)OH, –C(O)OR ● –NH2, –NHR ● –NR ● 2 or –NO2, where each R ● It is unsubstituted, or when preceding "halogen", it is substituted by only one or more halogens and is independently C. 1–4 Aliphatic, –CH2Ph, –O(CH2) 0– 1Ph, or having a 5-6 member saturated, partially unsaturated, or aryl ring with 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0415] Oral: As used herein, the phrases “oral administration” and “oral-administered” have their meaning as understood in the art as referring to the administration of a compound or composition by oral means.

[0416] Parenteral administration: As used herein, the phrases “parenteral administration” and “administered via parenteral administration” have the meaning as understood in the art, referring to a mode of administration other than enteral and local administration, typically by injection, including but not limited to intravenous, intramuscular, intra-arterial, intrathecal, intracapsular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, tracheal, subcutaneous, subepidermal, intra-articular, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion.

[0417] Partially unsaturated: As used herein, the term “partially unsaturated” refers to a moiety containing at least one double or triple bond. The term “partially unsaturated” is intended to cover groups having multiple unsaturated sites, but not necessarily to include aryl or heteroaryl moieties.

[0418] Peptide: As used herein, the term "peptide" refers to a molecule comprising a plurality of amino acids linked together via peptide bonds. In some embodiments, peptides include dipeptides, tripeptides, oligopeptides, and polypeptides. In some embodiments, a dipeptide contains two amino acids; a tripeptide contains three amino acids; and an oligopeptide contains about 2 to about 50 or more amino acids. In some embodiments, a peptide contains more than about 50 amino acids. In some embodiments, polypeptides and proteins are also molecules comprising a plurality of amino acids linked together via peptide bonds. In some embodiments, a peptide includes any therapeutic peptide listed in the SATPdb database of therapeutic peptides. Singh et al., 2015 Nucl. Acids Res. doi:10.1093 / nar / gkv1114. In some embodiments, the composition comprises a portion of a lipid and a portion of a peptide capable of mediating at least one function of the peptide.

[0419] Pharmaceutical Composition: As used herein, the term "pharmaceutical composition" refers to an active agent formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dose suitable for administration in a treatment regimen that, when administered to a relevant population, shows a statistically significant probability of achieving the intended therapeutic effect. In some embodiments, the pharmaceutical composition may be specifically formulated for administration in solid or liquid form, including those suitable for: oral administration, such as infusions (aqueous or non-aqueous solutions or suspensions), tablets, such as those targeted for buccal, sublingual, and systemic absorption, pellets, powders, granules, pastes for application to the tongue; parenteral administration, such as by subcutaneous, intramuscular, intravenous, or epidural injection, such as, for example, sterile solutions or suspensions, or sustained-release formulations; topical administration, such as as creams, ointments, or controlled-release patches, or sprays applied to the skin, lungs, or mouth; intravaginal or rectal administration, such as as vaginal suppositories, creams, or foams; sublingual; ocular; transdermal; or via the nose, lungs, and other mucosal surfaces.

[0420] Pharmaceutically acceptable: As used herein, the phrase “pharmaceutically acceptable” means that compounds, materials, compositions and / or dosage forms are suitable for contact with human and animal tissues, within reasonable medical judgment, without excessive toxicity, irritation, allergic response or other problems or complications, in proportion to a reasonable benefit / risk ratio.

[0421] Pharmaceutically acceptable carriers: As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition, or medium, such as liquid or solid fillers, diluents, excipients, or solvent encapsulating materials, relating to carrying or transporting the subject compound from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of compatibility with other components of the formulation and harmlessness to the patient. Some examples of materials that can serve as pharmaceutically acceptable carriers include: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; powdered tragacanth gum; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerol, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol; pH buffer solutions; polyesters, polycarbonates, and / or polyanhydrides; and other non-toxic and compatible substances used in pharmaceutical formulations. In some embodiments, pharmaceutically acceptable carriers include any compound, material, composition, and / or dosage form that, to a reasonable medical judgment, is suitable for contact with human and animal tissues without excessive toxicity, irritation, allergic response, or other problems or complications, in proportion to a reasonable benefit / risk ratio. The carrier can cause compositions containing CpG oligonucleotides to be formulated as tablets, pills, sugar-coated pills, capsules, liquids, gels, syrups, pastes, suspensions, etc., for oral administration by a target subject. Pharmaceutical formulations for oral administration as solid excipients can be obtained by adding suitable excipients as needed, followed by milling the resulting mixture, and by processing the particulate mixture to form a tablet core or sugar-coated pill core. In particular, suitable excipients are fillers [e.g., sugars (lactose, sucrose, mannitol, and sorbitol, etc.); cellulose formulations (e.g., corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose, etc.) and / or polyvinylpyrrolidone (PVP)]. Disintegrants may be added if necessary [e.g., croscarmellose, agar, alginate or its salts (e.g., sodium alginate)]. Oral formulations may also be administered in saline or buffer solutions to neutralize the acidic internal state if necessary. Alternatively, oral formulations may be administered without any carrier. The core of the sugar-coated pill may be provided with a suitable coating. For this purpose, a concentrated sugar solution may be used. If necessary, the concentrated sugar solution may contain gum arabic, talc, polyvinylpyrrolidone, carbomer gel, polyethylene glycol and / or titanium dioxide, lacquer solution, suitable organic solvents or solvent mixtures. To identify or characterize different combinations of active compound dosages, dyes or pigments may be added to the tablet or sugar-coated pill coating.Pharmaceutically acceptable carriers may contain pharmaceutically acceptable salts. As used herein, the term "pharmaceutically acceptable salt" means a salt suitable for use in a pharmaceutical context, i.e., within the bounds of reasonable medical judgment, that the salt is suitable for contact with the tissues of humans and lower animals without adverse toxicity, irritation, allergic responses, etc., and in proportion to a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art.

[0422] Pharmaceutically acceptable salts: As used herein, the term "pharmaceutically acceptable salt" means a salt suitable for use in a pharmaceutical context, i.e., within the bounds of reasonable medical judgment, that the salt is suitable for contact with tissues of humans and lower animals without adverse toxicity, irritation, allergic response, etc., and in proportion to a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, SMBerge et al. described pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66:1-19 (1977). In some embodiments, pharmaceutically acceptable salts include, but are not limited to, non-toxic acid addition salts, which are salts of an amino group formed with an inorganic acid such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or an organic acid such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by using other methods used in the art, such as ion exchange. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, hydrogen sulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, disaccharide, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucono-enolate, glyceryl phosphate, gluconate, hemisulfate, heptaate, hexanoate, hydroiodate, 2-hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate fluoroate, nicotinate, nitrate, oleate, oxalate, palmitate, dihydroxynaphthalate, pectate, persulfate, 3-phenylpropionate, phosphate, picrate, neopentanoate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, etc. Representative alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc. In some embodiments, pharmaceutically acceptable salts, where appropriate, include non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, alkyl groups having 1 to 6 carbon atoms, sulfonate, and arylsulfonate.

[0423] Plasmid: As used herein, the term "plasmid" refers to the extrachromosomal (excluding chromosomal) length of DNA; plasmids are generally circular and generally capable of independent replication, although there are exceptions, such as linear plasmids and plasmids that cannot replicate independently (including, but not limited to, suicide vectors). In some embodiments, plasmids may be extrachromosomal under certain conditions (e.g., in a laboratory setting) but capable of integrating into chromosomes (e.g., acting as suicide vectors capable of integrating into the chromosomes of cells or subjects). Plasmids are naturally present in many organisms, including bacteria and some eukaryotes, and are often artificially engineered and produced to carry genes into organisms. Plasmids are generally double-stranded, or alternatively may be single-stranded or partially single-stranded and double-stranded, or have other strands. Artificial plasmids are commonly used in genetic engineering. Plasmids include plasmids that encode or are capable of expressing: nucleic acids, including but not limited to mRNA, RNAi reagents or precursors thereof, antagonists of another nucleic acid (including but not limited to miRNA, RNAi reagents, antagonists of mRNA, etc.) or precursors thereof, or other nucleic acids that have therapeutic benefits. Additional portions of the plasmid may optionally include one or more copies of any one or more components selected from: a gene encoding a replication-related protein, an origin of replication, a gene encoding a replication initiation protein, a replication enhancer origin, a nucleic acid (or a precursor thereof) encoding a therapeutic benefit, one or more promoters, one or more transcription enhancers, one or more transcription terminators, and one or more marker genes (e.g., genes encoding antibiotic resistance or enzymes required for survival and / or growth under certain laboratory conditions). In some embodiments, the plasmid is a suicide vector that may lack any of the following: an origin of replication, a gene encoding a DNA replication initiation protein, or any other component required for independent replication. In some embodiments, the two plasmids may be physically separate but produce a coherently functioning product; for example, one plasmid may encode a gene encoding a transcription enhancer that enhances the transcription of a gene encoded on another plasmid; as another example, one plasmid may contain a gene encoding a DNA replication initiation protein that initiates replication at a DNA replication origin on another plasmid. Various plasmids are known in the art. In some embodiments, the composition comprises lipids and a portion of a plasmid (capable of mediating at least one function of the plasmid).

[0424] Protecting Groups: As used herein, the term “protecting group” is well-known in the art, including those described in detail in *Protecting Groups in Organic Synthesis*, TW Greene and PGMWuts, 3rd edition, John Wiley & Sons, 1999, the entire contents of which are incorporated herein by reference. Also included are those protecting groups particularly suitable for nucleoside and nucleotide chemistry described in *Current Protocols in Nucleic Acid Chemistry*, edited by Serge L. Beaucage et al., 06 / 2012, the entire contents of Chapter 2 of which are incorporated herein by reference. Suitable amino protecting groups include methyl carbamate, ethyl carbamate, 9-fluorenylmethyl carbamate (Fmoc), 9-(2-sulfonyl)fluorenylmethyl carbamate, 9-(2,7-dibromo)fluorenylmethyl methyl carbamate, 2,7-di-tert-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrotetrahydrothioxanthyl)]methyl carbamate (DBD-Tmoc), 4-methoxyacetophenone carbamate (Phenoc), 2 2,2-Trichloroethylcarbamate (Troc), 2-Trimethylsilylethylcarbamate (Teoc), 2-Phenethylcarbamate (hZ), 1-(1-adamantyl)-1-methylethylcarbamate (Adpoc), 1,1-Dimethyl-2-haloethylcarbamate, 1,1-Dimethyl-2,2-dibromoethylcarbamate (DB-t-BOC), 1,1-Dimethyl-2,2,2-trichloroethylcarbamate (TC) BOC), ethyl 1-methyl-1-(4-biphenyl)carbamate (Bpoc), 1-(3,5-di-tert-butylphenyl)-1-methylethylcarbamate (t-Bumeoc), ethyl 2-(2'- and 4'-pyridyl)carbamate (Pyoc), ethyl 2-(N,N-dicyclohexylcarbamate), tert-butyl carbamate (BOC), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc), allyl... Alloc, 1-Isopropylallyl carbamate (Ipaoc), Cinnamyl carbamate (Coc), 4-Nitrocinnamyl carbamate (Noc), 8-Quinolinyl carbamate, N-Hydroxypiperidinyl carbamate, Alkyl dithiocarbamate, Benzyl carbamate (Cbz), p-Methoxybenzyl carbamate (Moz), p-Nitrobenzyl carbamate, p-Bromobenzyl carbamate, p-Chlorobenzyl carbamate, 2,4-Dichlorobenzylcarbamate, 4-Methylsulfinylbenzylcarbamate (Msz), 9-Anthrylmethylcarbamate, Diphenylmethylcarbamate, 2-Methylthioethylcarbamate, 2-Methylsulfonylethylcarbamate, 2-(p-toluenesulfonyl)carbamate, [2-(1,3-dithiaalkyl)]carbamate (Dmoc), 4-Methylthiophenylcarbamate (Mtpc), 2,4-Dimethylthiophenylcarbamate (Bmpc), 2-phosphonium ethylcarbamate (Peoc), 2-triphenylphosphonium isopropylcarbamate (Ppoc), 1,1-dimethyl-2-cyanoethylcarbamate, m-chloro-p- Acyloxybenzyl carbamate, p-(dihydroxyboryl)carbamate, 5-benzisoxazolyl methyl carbamate, 2-(trifluoromethyl)-6-chromone methyl carbamate (Tcroc), m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate, o-nitrobenzyl carbamate, 3,4-dimethoxy-6-nitrobenzyl carbamate, methyl phenyl(o-nitrophenyl)carbamate, phenothiazinyl-(10)-carbonyl derivative, N'-p-toluenesulfonylaminocarbonyl derivative, N'-phenylaminothiocarbonyl derivative, tert-amyl carbamate, S-benzyl thiocarbamate, p-cyanobenzyl carbamate, cyclobutyl carbamate Esters, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropyl methyl carbamate, p-decoxybenzyl carbamate, 2,2-dimethoxycarbonylvinyl carbamate, o-(N,N-dimethylformamido)carbamate, 1,1-dimethyl-3-(N,N-dimethylformamido)carbamate, 1,1-dimethylpropynyl carbamate, methyl di(2-pyridyl)carbamate, 2-furanylmethyl carbamate, 2-iodoethyl carbamate, isobornyl carbamate, isobutyl carbamate, isoniazid carbamate, p-(p'-methoxyphenylazo)carbamate, 1-methylcyclobutyl carbamate, 1- Methylcyclohexyl carbamate, 1-methyl-1-cyclopropylmethyl carbamate, ethyl 1-methyl-1-(3,5-dimethoxyphenyl)carbamate, ethyl 1-methyl-1-(p-phenylazophenyl)carbamate, ethyl 1-methyl-1-phenethylcarbamate, ethyl 1-methyl-1-(4-pyridyl)carbamate, phenyl carbamate, benzyl p-(phenylazo)carbamate, 2,4,6-tri-tert-butylphenylcarbamate, benzyl 4-(trimethylammonium)carbamate, 2,4,6-trimethylbenzyl carbamate, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropionamide, pyridineamide,

[0425] 3-Pyridine amide, N-benzoylphenylalanyl derivatives, benzamide, p-phenylbenzamide, o-nitrophenylacetamide, o-nitrophenoxyacetamide, acetylacetamide, (N'-dithiobenzyloxycarbonylamino)acetamide, 3-(p-hydroxyphenyl)propionamide, 3-(o-nitrophenyl)propionamide, 2-methyl-2-(o-nitrophenoxy)propionamide, 2-methyl-2-(o-phenylazophenoxy)propionamide, 4-chlorobutyramide, 3-methyl-3-nitrobutyramide, o-nitrocinnamamide, N-acetylmethionine derivatives, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide, 4,5-diphenyl-3-oxazoline-2-one, N-phthalamide Imines, N-dithiasuccinimide (Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole, N-1,1,4,4-tetramethyldimethsilylazacyclopentane adduct (STABASE), 5-substituted 1,3-dimethyl-1,3,5-triazacyclohexane-2-one, 5-substituted 1,3-dibenzyl-1,3,5-triazacyclohexane-2-one, substituted 3,5-dinitro-4-pyridinone, N-methylamine, N-allylamine, N-[2-(trimethylsilyl)ethoxy]methylamine (SEM), N-3-acetoxypropylamine, N-(1-isopropyl-4-nitro-2-oxo-3-pyrrololin-3-yl)amine, Quaternary ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzocycloheptanamine, N-triphenylmethylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluoreneamine (PhF), N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocene-methylamino (Fcm), N-2-pyridinemethylamino N'-oxide, N-1,1-dimethylthiomethyleneamine, N-benzylamine, N-p-methoxybenzylamine, N-diphenylmethyleneamine, N-[(2-pyridyl)trimethylmethyl]methyleneamine, N-(N',N'-dimethylaminomethylene)amine, N,N'-diisopropylamine, N-p- Nitrobenzylamine, N-salicylic acid, N-5-chlorosalicylic acid, N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N-cyclohexylamine, N-(5,5-dimethyl-3-oxo-1-cyclohexenyl)amine, N-borane derivatives, N-diphenylboronic acid derivatives, N-[phenyl(pentacarbonylchromium or tungsten)carbonyl]amine, N-copper chelate, N-zinc chelate, N-nitroamine, N-nitrosamine, amine N-oxide, diphenylphosphamide (Dpp), dimethylthiophosphamide (Mpt), diphenylthiophosphamide (Ppt), dialkylaminophosphate, dibenzylaminophosphate, diphenylaminophosphate, benzenesulfinamide, o-nitrobenzenesulfinamide (Nps)

[0426] 2,4-Dinitrobenzenesulfinamide, pentachlorobenzenesulfinamide, 2-nitro-4-methoxybenzenesulfinamide, triphenylmethylsulfinamide, 3-nitropyridinesulfinamide (Npys), p-toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6-trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte) 4-Methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylsomn-6-sulfonamide (Pmc), methylsulfonamide (Ms), β-trimethylsilylethylsulfonamide (SES), 9-anthracitesulfonamide, 4-(4',8'-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and benzoylmethylsulfonamide. Appropriately protected carboxylic acids also include, but are not limited to, silyl-, alkyl-, alkenyl-, aryl-, and arylalkyl-protected carboxylic acids. Examples of suitable silyl groups include trimethylsilyl, triethylsilyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, triisopropylsilyl, and so on. Examples of suitable alkyl groups include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, triphenylmethyl, tert-butyl, and tetrahydropyran-2-yl. Examples of suitable alkenyl groups include allyl. Examples of suitable aryl groups include optionally substituted phenyl, biphenyl, or naphthyl groups. Examples of suitable arylalkyl groups include optionally substituted benzyl groups (e.g., p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl) and 2- and 4-pyridinemethyl groups. Suitable hydroxyl protecting groups include methyl, methoxymethyl (MOM), methylthiomethyl (MTM), tert-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacol methyl (GUM), tert-butoxymethyl, 4-pentenoxymethyl (POM), silyloxymethyl, and 2-methoxyethoxymethyl (MEM). 2,2,2-Trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiaranyl, 1-methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiaranyl, 4-methoxytetrahydrothiaranyl S,S-dioxide, 1-[(2-chloro4-methyl)phenyl]-4-methoxypiperidin-4-yl (CTMP), 1,4-Dioxane-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methylenebenzofuran-2-yl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 1-methyl-1-methoxyethyl, 1-methyl-1-benzyloxyethyl, 1-methyl-1-benzyloxy-2-fluoroethyl, 2,2,2-trichloroethyl, 2-trimethylsilylethyl, 2-(phenylselenoyl)ethyl, tert-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyano Benzyl, p-phenylbenzyl, 2-pyridinemethyl, 4-pyridinemethyl, 3-methyl-2-pyridinemethyl N-oxygen bridge, diphenylmethyl, p,p'-dinitrodiphenylmethyl, 5-dibenzocycloheptanyl, triphenylmethyl, α-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, di(p-methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl, 4-(4'-bromoacetophenoneoxyphenyl)diphenylmethyl, 4,4',4”-tris(4,5-dichlorophthaliminophenyl)methyl, 4,4',4”-tris(acetylpropionyloxyphenyl)methyl, 4,4',4”-tris(benzoyloxyphenyl)methyl, 3-(imidazol-1-yl)bis(4',4”-dimethoxyphenyl)methyl, 1,1-bis(4- Methoxyphenyl)–1'–pyrenemethyl, 9–anthrayl, 9–(9–phenyl)zanthrayl, 9–(9–phenyl–10–oxo)anthrayl, 1,3–benzodithiolan–2–yl, benzoisothiazolyl S,S–dioxobridge, trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl (DEIPS), dimethylhexylsilyl, tert-butyldimethylsilyl (TBDMS), tert-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl Alkyl (DPMS), tert-butylmethoxyphenylsilyl (TBMPS), formate, benzoylformate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, phenoxyacetate, p-chlorophenoxyacetate, 3-phenylpropionate, 4-oxovalerate (acetylpropionate), 4,4-(ethylidene dithio)valerate (acetylpropionyl dithioacetal), neovalerate, adamantinate, crotonate, 4-methoxycrotonate, benzoate, p-phenylbenzoate, 2,4,6-trimethylbenzoate (mesitoate), alkylmethyl carbonate, 9-fluorenylmethyl carbonate (Fmoc), alkyl ethyl carbonate, alkyl 2,2,2-Trichloroethyl carbonate (Troc), 2-(trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl)ethyl carbonate (Psec), 2-(triphenylphosphonyl)ethyl carbonate (Peoc), alkyl isobutyl carbonate, alkyl vinyl carbonate, alkyl allyl carbonate, alkyl p-nitrophenyl carbonate, alkyl benzyl carbonate, alkyl p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o-nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl S-benzyl thiocarbonate, 4-ethoxy-1-naphthyl carbonate, methyl dithiocarbonate, 2-iodobenzoate, 4-azidobutyrate, 4-nitro-4-methylvalerate, o-(dibromomethyl)benzoate, 2-formylbenzenesulfonate, 2-(methylthiomethoxy) Ethyl, 4-(methylthiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4-methylphenoxyacetate, 2,6-dichloro-4-(1,1,3,3-tetramethylbutyl)phenoxyacetate, 2,4-bis(1,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinoate, (E)-2-methyl-2-butenoate, o-(methoxycarbonyl)benzoate, α-naphthyl ester, nitrate, alkyl N,N,N',N'-tetramethylphosphine, alkyl N-phenylcarbamate, borate, dimethylphosphino, alkyl 2,4-dinitrophenyl sulfenate, sulfate, methanesulfonate, benzyl sulfonate, and toluenesulfonate (Ts). To protect 1,2, or 1,3-diols, protecting groups include methylene acetal, ethylene acetal, 1-tert-butyl ethylene ketal, 1-phenyl ethylene ketal, (4-methoxyphenyl)ethylene acetal, 2,2,2-trichloroethylene acetal, acetone, cyclopentylene ketal, cyclohexylene ketal, cycloheptylene ketal, benzylene acetal, p-methoxybenzylene acetal, 2,4-dimethoxybenzylene acetal, 3,4-dimethoxybenzylene acetal, 2-nitrobenzylene acetal, methoxymethylene acetal, and ethoxymethylene acetal. Dimethoxymethylene orthoester, 1-methoxyethyl orthoester, 1-ethoxyethyl orthoester, 1,2-dimethoxyethyl orthoester, α-methoxybenzyl orthoester, 1-(N,N-dimethylamino)ethylene derivative, α-(N,N'-dimethylamino)benzyl derivative, 2-oxacyclopentyl orthoester, di-tert-butylsilyl (DTBS), 1,3-(1,1,3,3-tetraisopropyldisiloxy) derivative (TIPDS), tetra-tert-butoxydisiloxane-1,3-Dialkyl derivatives (TBDS), cyclic carbonates, cyclic borates, ethyl borate, and phenyl borate. In some embodiments, the hydroxyl protecting group is acetyl, tert-butyl, tert-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 2-trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl (triphenylmethyl), 4,4'-dimethoxytriphenylmethyl, trimethylsilyl, triethylsilyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylcarbamate, chloroacetyl, trichloroacetyl, trifluoroacetyl, neopentanoyl, 9-fluorenylmethyl carbonate, methanesulfonate, toluenesulfonate, trifluoromethanesulfonate, triphenylmethyl, monomethoxytriphenylmethyl (MMTr), 4,4'-dimethoxytriphenylmethyl (DMTr) ) and 4,4',4”-trimethoxytriphenylmethyl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl, 2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrobenzenesulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenyl, 2,4 6-Trimethylphenyl, 2-(2-nitrophenyl)ethyl, butylthiocarbonyl, 4,4',4'-tris(benzoyloxy)triphenylmethyl, diphenylcarbamoyl, acetylpropionyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenylxanthine-9-yl (pixyl)), or 9-(p-methoxyphenyl)xanthine-9-yl (MOX). In some embodiments, each hydroxyl protecting group is independently selected from acetyl, benzyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, and 4,4'-dimethoxytriphenylmethyl. In some embodiments, the hydroxyl protecting group is selected from triphenylmethyl, monomethoxytriphenylmethyl, and 4,4'-Dimethoxytriphenylmethyl. In some embodiments, the phosphorus protecting group is a group that is attached to the internucleotide phosphate bond throughout the oligonucleotide synthesis. In some embodiments, the phosphorus protecting group is attached to the sulfur atom of the internucleotide thiophosphate bond. In some embodiments, the phosphorus protecting group is attached to the oxygen atom of the internucleotide thiophosphate bond. In some embodiments, the phosphorus protecting group is attached to the oxygen atom of the internucleotide phosphate bond. In some embodiments, the phosphorus protecting group is 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylcarbamoyl)-1-propyl, 4-oxopentyl, 4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl,N-methyl)aminoethyl, 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl.

[0427] Protein: As used herein, the term "protein" refers to a polypeptide (i.e., a string of at least two amino acids linked together by peptide bonds). In some embodiments, a protein comprises only naturally occurring amino acids. In some embodiments, a protein comprises one or more non-naturally occurring amino acids (e.g., portions that form one or more peptide bonds with adjacent amino acids). In some embodiments, one or more residues in a protein chain contain non-amino acid portions (e.g., glycans, etc.). In some embodiments, a protein comprises more than one polypeptide chain, for example linked by one or more disulfide bonds or otherwise bound together. In some embodiments, a protein contains L-amino acids, D-amino acids, or both; in some embodiments, a protein contains one or more amino acid modifications or analogs known in the art. Useful modifications include, for example, terminal acetylation, amidation, methylation, etc. The term "peptide" is generally used to refer to a polypeptide of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids in length. In some embodiments, a protein is an antibody, an antibody fragment, its biologically active portion, and / or a characteristic portion thereof.

[0428] Ribozymes: As used herein, the term “ribozyme” refers to catalytic RNA that acts as an enzyme and does not require protein for catalysis. In some embodiments, ribozymes are self-processing RNA that catalyzes RNA cleavage and ligation reactions. In some embodiments, the substrate recognition domain of a ribozyme is artificially modified to specifically cleave at cis (same nucleic acid strand) or trans (non-covalently linked nucleic acid) stimulation sites. Scherer et al., 2003 Nat Biotechnol. 21:1457-1465. In some embodiments, ribozymes undergo in vitro selection and directed evolution to generate improved properties and novel functions for therapeutic and diagnostic reagents. In some embodiments, ribozymes are engineered to be activated by allosteric changes in effector molecules, which has led to the development of artificial “riboswitches” as biosensors and synthetic biology tools. Wieland et al., 2010 Chem Biol. 17:236-242; Liang et al., 2011 MolCell. 43:915-926. In some embodiments, ribozymes are derived from “hammerhead” or “hairpin / paperclip” motifs. In some embodiments, the ribozyme is delivered to target cells in RNA form or may be transcribed by a therapeutic gene. In some embodiments, the ribozyme is chemically modified with any one or more of the following modifications: 5'-PS backbone bond, 2'-O-Me, 2'-deoxy-2'-C-allyluridine, and terminally reversed 3'-3'-deoxy-abase-free nucleotide. A non-limiting example of a ribozyme is Angiozyme (RPI.4610), which targets the mRNA of vascular endothelial growth factor receptor-1 (VEGFR-1) to block angiogenesis and tumor growth. Kobayashi et al., 2005 Cancer Chemother Pharmacol. 56:329-336; Weng et al., 2005 Mol Cancer Ther. 4:948-955. Another non-limiting example of a ribozyme is Heptazyme, a synthetic ribozyme targeting hepatitis C virus (HCV). Sandberg et al., 2001 Hepatology 34:333a-333a; Tong et al., 2002 Hepatology 36:360a-360a; Berk 2006 Hepatology 43:S13-S30. In some embodiments, the ribozyme includes a ribozyme targeting any of the following: VEGFR-1, HCV IRES, HIV U5 and pol, HIV Tat and Vpr, CCR5, HIV Tat and Rev. In some embodiments, the composition comprises a portion of lipids and a portion of the ribozyme capable of mediating at least one function of the ribozyme.

[0429] RNAi reagents: As used herein, the term "RNAi reagent" refers to molecules capable of mediating RNA interference. This term encompasses a wide range of structures and forms, including, in addition to the various natural and artificial structures capable of mediating RNA interference, siRNAs (including, but not limited to, those with a "canonical" structure) as non-restrictive examples. As used herein, the terms "RNA interference" or "RNAi" refer to post-transcriptional targeted gene silencing technology mediated by RISC (RNA interference silencing complex), which uses RNAi reagents to degrade messenger RNA (mRNA) containing sequences that are identical or very similar to those of the RNAi reagent. See: Zamore and Haley, 2005, Science, 309, 1519-1524; Zamore et al., 2000, Cell, 101, 25-33; Elbashir et al., 2001, Nature, 411, 494-498; and Kreutzer et al., PCT Publication WO 00 / 44895; Fire, PCT Publication WO 99 / 32619; Mello and Fire, PCT Publication WO 01 / 29058; etc. RNAi occurs naturally when long dsRNA is introduced into the cell and cleaved into shorter fragments called siRNA by ribonuclease III (Dicer). Naturally occurring siRNA is typically about 21 nucleotides long and contains a 19-base-pair duplex (“canonical” structure) with two 2-nt overhangs. One strand of the siRNA has been reported to be incorporated into the RNA-induced silencing complex (RISC). This strand (called the antisense strand or guide strand) guides the RISC to the complementary mRNA. One or more nucleases in the RISC are then reported to mediate the cleavage of the target mRNA to induce silencing. Cleavage of the target RNA has been reported to occur in the middle of a region complementary to the antisense strand. See: Nykanen et al., 2001 Cell 107:309; Sharp et al., 2001 Genes Dev.15:485; Bernstein et al., 2001 Nature 409:363; Elbashir et al., 2001 Genes Dev.15:188. As various non-limiting examples, RNAi reagents include: siRNA (including but not limited to those with canonical structures), shRNA, miRNA, sisiRNA, partially mesoduplex RNA (mdRNA), DNA-RNA chimeras, siRNA containing two mismatches (or more), neutral siRNA, aiRNA, or siRNA containing terminal or internal spacer regions (e.g., siRNA in 18-mer form).In various non-limiting examples, the RNAi agent is shRNA (small hairpin RNA or short hairpin RNA), which has been reported to contain RNA sequences that produce tight hairpin turns and, like siRNA, is silenced via a RISC target. The antisense and sense strands are thus reportedly linked by the hairpin. shRNA has been reported to be expressed via, for example, plasmids or via viral or bacterial vectors. A wide variety of shRNAs have been reported in the art. See, for example: Xiang et al., 2006. Nature Biotech. 24:697-702; Macrae et al., 2006 Science 31 1:195-8; Lombardo et al., 2007. Nature Biotech. 25:1298-1306; Wang et al., 2011. Pharm. Res. 28:2983-2995; Senzer et al., 2011 Mol. Ther. 20:679-686. In various non-limiting examples, RNAi agents are miRNAs (microRNAs), which are reportedly small RNA molecules (approximately 22 nt), and like siRNAs, they also target silencing genes via RISC. Naturally occurring miRNAs are encoded by eukaryotic nuclear DNA; miRNAs are generated through post-transcriptional RNA processing and function via base pairing with complementary sequences within the mRNA molecule, typically leading to translational repression or target degradation and gene silencing. The human genome has been reported to encode over 1000 miRNAs, which can target approximately 60% of mammalian genes and are abundant in many human cell types. A wide variety of naturally occurring and artificial derivatives of miRNAs have been reported in this art. See, for example: Lewis et al., 2003. Cell 1 15:787-798; Lim et al., 2003. Genes Dev.17:991-1008; He et al., 2004. Nat. Rev. Genet.5:522-31; Bentwich et al., 2005. Nat. Genet.37:766-70; Lewis et al., 2005. Cell 120:15-20; Kusenda et al., 2006. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub 150:205-15; Zhang et al., 2006. J. Gen. Gen.36:1-6; Brodersen et al., 2008. Science 320:1 185-90; Friedman et al., 2009. Genome Res. 19(1):92-105; Bartel 2009. Cell 136(2):215-33.In various non-limiting examples, the RNAi reagent is a sisiRNA (internal segmented small interfering RNA) in which the sense strand contains at least one single-stranded cleavage. This cleavage reduces the incorporation of the sense strand into the RISC complex and thus reduces off-target effects. See: WO2007 / 107162. In various non-limiting examples, a DNA-RNA chimera is used, in which the seed portion of each strand is DNA, and the remainder of each strand is RNA. See: Yamato et al., 2011 Cancer Gene Ther. 18:587-597. In various non-limiting examples, the RNAi reagent is a siRNA containing two mismatched siRNAs, in which the molecule has been reported to contain three short double-stranded regions. In one embodiment of this RNAi reagent, the guide (antisense) strand is a 22-mer, while the sense strand is a 20-mer (generating only a single 2-nt overhang at the 3' end of the antisense strand; and two mismatches have reportedly generated double-stranded regions of 6, 8, and 4 bp. See: U.S. Patent Application 2009 / 0209626. In various embodiments, the RNAi reagent is neutral siRNA, wherein the negative charge of the phosphate backbone is reversibly masked; Meade et al., 2014 Nat. Biotech. 32:1256-1261. In various non-limiting examples, the RNAi reagent is aiRNA (asymmetric interfering RNA) containing a sense strand shorter than 19-nt, such that the antisense strand has reportedly been preferentially loaded into the RISC, and thus off-target effects are reduced. In various embodiments of this RNAi reagent, the antisense strand is 21 nt long, but the sense strand is only 15 or 16 nt long. See: Sun et al., 2008 Nature Biotech. 26:1379-1382; and Chu and Rana. 2008 RNA 14:1714-1719. In various non-limiting examples, the RNAi agent is siRNA (e.g., siRNA in 18-mer form) containing a terminal or internal spacer region, which has been reported to contain a chain shorter than that of a canonical siRNA, wherein said chain contains an internal or terminal spacer region, such as ribitol or other types of nonnucleotide spacer regions. See: WO2015 / 051366. In some embodiments, the RNAi agent includes those targeting any of the following: miR-122, VEGF, VEGF-R1, RTP801, caspase 2, KRT6A (N171K)), ADRB2, TRPV1, Syk kinase, RSV nucleocapsid, β-catenin, KRASG12D, Apo B, PLK1, KSP and VEGF, TTR, Bcr-Abl, PKN3, P53, RRM2, furin and GM-CSF, LMP2, LMP7, MECL1, HIV Tat and Rev.In some embodiments, the composition comprises a portion of a lipid and an RNAi reagent, said portion being capable of mediating at least one function of the RNAi reagent.

[0430] Small molecules: As used herein, the terms “small molecule” or “low molecular weight molecule” or “LMW molecule”, etc., refer to molecules having a relatively low molecular weight. As a non-limiting example, small molecules include molecules with a molecular weight less than about 7500, 7000, 6000, 5000, 4000, 3000, 2500, 2000, 1500, 1000, 900, 800, 700, 600, 500, 400, 300, 200, or 100. In some embodiments, small molecules are bioactive agents and inhibit or reduce the level, product, and / or activity of a target gene or target gene product. Exemplary small molecules include, but are not limited to, small organic molecules (e.g., Cane et al. 1998. Science 282:63) and libraries of natural product extracts. In another embodiment, small molecules are small organic non-peptide compounds. In some embodiments, small molecule inhibitors indirectly or directly inhibit or reduce the level, product, and / or activity of a target gene or target gene product. In some embodiments, the composition comprises a portion of a lipid and a small molecule, said portion being capable of mediating at least one function of the small molecule.

[0431] Small nucleolar RNA (snoRNA): As used herein, the terms “small nucleolar RNA,” “snoRNA,” etc., refer to any class of small RNA molecules that, for example, guide the chemical modification of other RNAs. In some embodiments, snoRNAs are capable of guiding the chemical modification of other RNAs, including ribosomal RNAs, transfer RNAs, and small nuclear RNAs. In some embodiments, two main classes of snoRNAs have been reported: C / D box snoRNAs associated with methylation, and H / ACA box snoRNAs associated with pseudouridine acidification.

[0432] Splice-converting oligonucleotides (SSOs): As used herein, the term "splice-converting oligonucleotide" or "SSO" refers to an oligonucleotide capable of altering pre-mRNA splicing. In a non-limiting example, an SSO may bind to a 5' or 3' splice junction or an exon splice enhancer or silencing site. In doing so, the SSO may modify splicing in various ways, such as promoting exon substitution, exon exclusion, or exon inclusion. In various embodiments, the SSO may induce exon skipping; or, in other cases, prevent exon skipping. Crooke 2004 Curr. Mol. Med. 4:465-487; Bennett et al., 2010 Ann. Rev. Pharmacol. Toxicol. 50:259-293; and Kole et al., 2012 Nat. Rev. Drug Discov. 11:125-140. Non-limiting examples of SSOs are oligonucleotides reported to mediate exon skipping in dystrophin premRNA. A non-limiting example of an SSO is WV-942. Non-limiting examples of SSOs are oligonucleotides capable of preventing exon skipping in SMN2 premRNA; see Rigo et al. 2012 J. Cell Biol. 199:21-25; and Kaczmarek et al. 2015 Exp. Opin. Exp. Drugs 24:867-881. In some embodiments, SSOs convert splicing in genes associated with muscle-related diseases. In some embodiments, SSOs are capable of skipping or mediating exon skipping, wherein mutations in the exons are associated with muscle-related diseases. In some embodiments, SSOs are capable of preventing or mediating the prevention of exon skipping, wherein mutations in the exons are associated with muscle-related diseases. In some embodiments, SSOs are capable of skipping or mediating exon skipping in genes associated with muscle-related diseases. In some embodiments, SSOs are capable of skipping or mediating exon skipping in dystrophin genes. In some embodiments, SSO can skip or mediate the skipping of exons 51, 45, 53, or 44 in the dystrophin gene. In some embodiments, SSO can prevent or mediate the prevention of exon skipping in genes associated with SMA. In some embodiments, SSO can prevent or mediate the prevention of exon skipping in the SMN2 gene. In some embodiments, SSO can prevent or mediate the prevention of exon 7 skipping in the SMN2 gene.

[0433] Stereochemical isomers, stereoforms, stereoisomers: As used herein, the phrases “stereochemical isomer,” “stereoform,” “stereoisomer,” “stereoisomer,” etc., refer to different compounds composed of the same atoms bonded in the same bond sequence but with different three-dimensional structures, and are not interchangeable. In some embodiments of this disclosure, the provided chemical composition may be a pure formulation comprising various stereochemical isomers of the compound; in some embodiments, the provided chemical composition may be a mixture comprising two or more stereochemical isomers of the compound. In some embodiments, such mixtures contain equal amounts of different stereochemical isomers; in some embodiments, such mixtures contain different amounts of at least two different stereochemical isomers. In some embodiments, the chemical composition may contain all diastereomers and / or enantiomers of the compound. In some embodiments, the chemical composition may contain fewer than all diastereomers and / or enantiomers of the compound. In some embodiments, if a specific enantiomer of the compound of this disclosure is desired, it may be prepared, for example, by asymmetric synthesis or by chiral derivatization, wherein the resulting diastereomeric mixture is separated and the auxiliary groups are cleaved to provide a pure desired enantiomer. Alternatively, when the molecule contains a basic functional group such as an amino group, diastereomeric salts are formed with a suitable optically active acid and distinguished, for example, by fractional crystallization. In some embodiments, the stereorandom composition comprises two or more stereoisomers.

[0434] Subject: As used herein, the term “subject” or “test subject” means any organism to which the provided compound or composition is administered, for example, for experimental, diagnostic, preventive, and / or therapeutic purposes, in accordance with this disclosure. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.) and plants. In some embodiments, the subject may have and / or be susceptible to diseases, conditions, and / or illnesses.

[0435] Essentially: As used herein, the term “essentially” refers to a qualitative condition that exhibits the overall or near-overall degree or range of a intended characteristic or property. Those skilled in the art of biology will understand that biological and chemical phenomena rarely (if any) complete and / or proceed to completion or attainment or avoidance of absolute results. Therefore, the term “essentially” is used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0436] "Having": refers to an individual who has been diagnosed with and / or exhibits one or more symptoms of a disease, condition, and / or condition.

[0437] Susceptible: An individual "susceptible" to a disease, condition, and / or status is an individual who has a higher risk of developing a disease, condition, and / or status than members of the general public. In some embodiments, an individual susceptible to a disease, condition, and / or status may not be diagnosed with a disease, condition, and / or status. In some embodiments, an individual susceptible to a disease, condition, and / or status may exhibit symptoms of a disease, condition, and / or status. In some embodiments, an individual susceptible to a disease, condition, and / or status may not exhibit symptoms of a disease, condition, and / or status. In some embodiments, an individual susceptible to a disease, condition, and / or status will develop a disease, condition, and / or status. In some embodiments, an individual susceptible to a disease, condition, and / or status will not develop a disease, condition, and / or status.

[0438] Systemic: As used herein, the phrases “systemic application,” “systemic application,” “peripheral application,” and “peripheral application” have their domain-understood meanings referring to the administration of a compound or composition to the recipient’s system.

[0439] Targeted compound or portion or component: As used herein, the terms “targeted portion,” “targeted compound or portion,” “targeted compound,” “target component,” etc., are structures capable of targeting a compound or composition to a specific cell or tissue or subset of cells or tissues. In some embodiments, the targeting portion is designed to utilize cell or tissue-specific expression of a specific target, receptor, protein, or other subcellular component; in some embodiments, the targeting portion is a compound or composition that targets cells or tissues and / or binds to a ligand (e.g., small molecule, antibody, peptide, protein, carbohydrate, aptamer, etc.) of the target, receptor, protein, or other subcellular component. In some embodiments, the targeting portion targets muscle cells or tissues with a composition comprising lipids and nucleic acids (including but not limited to CpG oligonucleotides). In some embodiments, the targeting portion comprises a compound that targets muscle cells or tissues. In some embodiments, the targeting portion comprises fetoglobulin, epidermal growth factor, fibroblast growth factor, insulin and / or dexamethasone, or components or fragments or combinations thereof. In some embodiments, the targeting portion targets neurons or other cells or tissues in the neuromuscular system with a composition comprising lipids and nucleic acids (including but not limited to CpG oligonucleotides). In some embodiments, the targeting portion comprises a rabies virus peptide (see Kumar et al. 2007 Nature 448:39-43; and Hwang Do et al. 2011 Biomaterials 32:4968-4975). In some embodiments, the targeting portion is a portion of mRNA capable of binding to a neurotransmitter transporter, dopamine transporter, serotonin transporter, or norepinephrine transporter, or α-synuclein, or encoding any of these components (see U.S. Patent No. 9,084,825). In some embodiments, the targeting portion is a transferrin receptor ligand or an α-transferrin antibody, thus reportedly utilizing a transferrin receptor-mediated pathway across the vascular endothelium. Clark et al., 2015 Proc. Natl. Acad. Sci. USA 112:12486-12491; Bien-Ly et al., 2014 J. Exp. Med. 211:233-244; and Youn et al., 2014 Mol. Pharm. 11:486-495. In some embodiments, the targeting portion binds to integrin. In some embodiments, the targeting portion binds, for example, αIIβ3 on platelets. In some embodiments, the targeting portion binds, for example, β2 integrin on leukocytes. In some embodiments, the targeting portion binds, for example, αvβ3 on tumor cells. In some embodiments, the targeting portion binds to GPCRs (G protein-coupled receptors) (see Hanyaloglu et al., 2008 Ann. Rev. Pharm. Tox. 48:537-568).In some embodiments, the targeting portion binds to, for example, the gastrin-releasing peptide receptor on cancer cells (see Cornelio et al. 2007 Ann. Oncol. 18: 1457-1466). In some embodiments, the targeting portion comprises a carbonic anhydrase inhibitor.

[0440] Tautomerism: As used herein, the phrase “tautomerism” describes different isomers of an organic compound that can readily interconvert. Tautomers are characterized by the migration of hydrogen atoms or protons, accompanied by the conversion of single bonds and adjacent double bonds. In some embodiments, tautomers may originate from proton shift tautomerism (i.e., proton repositioning). In some embodiments, tautomers may originate from valence tautomerism (i.e., rapid recombination of bonding electrons). All such tautomerisms are intended to be included within the scope of this disclosure. In some embodiments, the tautomerisms of the compound exist in moving equilibrium with each other, such that attempts to prepare separate substances result in the formation of mixtures. In some embodiments, the tautomerisms of the compound are separable and separable compounds. In some embodiments of the invention, chemical compositions may be provided as pure preparations comprising or including a single tautomerism of a compound. In some embodiments of the invention, chemical compositions may be provided as mixtures of two or more tautomerisms of a compound. In some embodiments, such mixtures contain equal amounts of different tautomerisms; in some embodiments, such mixtures contain different amounts of at least two different tautomerisms of a compound. In some embodiments of the invention, the chemical composition may contain all tautomeric forms of the compound. In some embodiments of the invention, the chemical composition may contain fewer than all tautomeric forms of the compound. In some embodiments of the invention, the chemical composition may contain one or more tautomeric forms of the compound, the amounts of which vary over time due to interconversion. In some embodiments of the invention, the tautomer is a keto-enol tautomer. Those skilled in the art will recognize that the keto-enol tautomer can be “retained” (i.e., chemically modified so that it is retained in the “enol” form) using any suitable reagent known in the art to provide an enol derivative which can then be isolated using one or more suitable techniques known in the art. Unless otherwise stated, this disclosure covers all tautomeric forms of the relevant compound, whether in pure form or in mixtures thereof.

[0441] Therapeutic agent: As used herein, the phrase “therapeutic agent” means any agent that, when administered to a subject, has a therapeutic effect and / or induces the desired biological and / or pharmacological effect. In some embodiments, a therapeutic agent is any substance that can be used to reduce, improve, alleviate, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or features of a disease, condition, and / or symptom.

[0442] Therapeutic Effective Amount: As used herein, the term "therapeutic effective amount" means the amount of a substance (e.g., a therapeutic agent, composition, and / or formulation) that, when administered as part of a treatment regimen, elicits a desired biological response. In some embodiments, a therapeutically effective amount of a substance is an amount sufficient to treat, diagnose, prevent, and / or delay the onset of a disease, condition, and / or condition when administered to a subject who has or is susceptible to such a disease, symptom, and / or condition. As will be appreciated by those skilled in the art, the effective amount of a substance can vary depending on factors such as the desired biological endpoint, the substance to be delivered, the target cells or tissues, etc. For example, an effective amount of a compound in a formulation for treating a disease, condition, and / or condition is an amount that reduces, improves, alleviates, inhibits, prevents, delays its onset, reduces its severity, and / or reduces the incidence of one or more symptoms or features of the disease, condition, and / or condition. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver the therapeutically effective amount.

[0443] Treatment: As used herein, the terms “treat,” “treatment,” or “treating” refer to any method used to partially or completely reduce, improve, alleviate, suppress, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or features of a disease, condition, and / or condition. Treatment may be administered to subjects who do not exhibit signs of a disease, condition, and / or condition. In some embodiments, treatment may be administered to subjects who exhibit only early signs of a disease, condition, and / or condition, for purposes such as reducing the risk of developing a pathology associated with the disease, condition, and / or condition.

[0444] Unsaturated: As used herein, the term “unsaturated” means that a portion has one or more unsaturated units.

[0445] Unit dose: As used herein, the term "unit dose" refers to the amount administered as a single dose and / or as a physically discrete unit of a pharmaceutical composition. In many embodiments, a unit dose contains a predetermined amount of active agent. In some embodiments, a unit dose contains the entire single dose of the agent. In some embodiments, more than one unit dose is administered to achieve an overall single dose. In some embodiments, multiple unit doses are required or anticipated to be administered to achieve the desired effect. A unit dose may be, for example, a volume of liquid (e.g., an acceptable carrier) containing a predetermined amount of one or more therapeutic agents, a predetermined amount of one or more therapeutic agents in solid form, a sustained-release formulation, or a drug delivery device containing a predetermined amount of one or more therapeutic agents, etc. It should be understood that a unit dose may be present in a formulation that includes any of a variety of components in addition to a therapeutic agent. For example, as described below, it may include an acceptable carrier (e.g., a pharmaceutically acceptable carrier), a diluent, a stabilizer, a buffer, a preservative, etc. The carrier may be a solvent, such as water or an alcohol. The carrier may optionally contain any one or more of the following: excipients, diluents, fillers, salts, buffers, stabilizers, solubilizers, lipids, or other substances well reported in the art for medical compositions. The oligonucleotide can be administered to a subject directly or together with a nucleic acid delivery complex. As a non-limiting example, the nucleic acid delivery complex can be a nucleic acid that binds (e.g., ionic or covalently, or encapsulated in this manner) to a targeting moiety (e.g., a molecule that generates a high-affinity bond to target cells (e.g., the surface of B cells) and / or increases cellular uptake by the target cells). Non-limiting examples of nucleic acid delivery complexes include nucleic acids that bind to sterols such as cholesterol, lipids (e.g., cationic lipids, virions, or liposomes), or target-cell-specific binding factors (e.g., ligands recognized by target-cell-specific receptors). Preferred complexes are sufficiently stable in vivo to prevent significant uncoupling prior to internalization by target cells. However, the complex can be cleaved under appropriate conditions within the cell, releasing the nucleic acid in its functional form.

[0446] Vaccine: As used herein, the term "vaccine" refers to a molecule that improves immunity against a specific disease or infectious agent. Vaccines encoded in polynucleotides, primary constructs, or mmRNAs of this disclosure can be used to treat conditions or diseases in many therapeutic areas, such as, but not limited to, cardiovascular, CNS, dermatology, endocrinology, oncology, immunology, respiratory, and anti-infectives. In some embodiments, a vaccine comprises an agent that is immunologically similar to a pathogenic microorganism or a fragment thereof; in some embodiments, a vaccine is made from a weakened or killed form of a virus, microorganism, parasite, or other pathogen or a fragment thereof. In some embodiments, a vaccine stimulates the body's immune system to recognize the agent as a threat, destroy it, and retain a record of it, making it easier for the immune system to recognize and destroy any of these microorganisms it subsequently encounters. In some embodiments, a vaccine is prophylactic or therapeutic. In various embodiments, a vaccine may be a virus, bacteria, parasite, or another pathogen. In some embodiments, the vaccine is selected from the following viruses: common cold virus, hepatitis A virus, hepatitis B virus, hepatitis E virus, human papillomavirus, influenza virus, Japanese encephalitis virus, measles virus, mumps virus, poliovirus, rabies virus, rhinovirus, rotavirus, rubella virus, varicella-zoster virus, smallpox virus, and yellow fever virus. In various embodiments, the vaccine is selected from the following vaccines: viral vaccine, adenovirus vaccine, Coxsackie B virus vaccine, cytomegalovirus vaccine, human dengue fever vaccine, human eastern equine encephalitis virus vaccine, Ebola vaccine, enterovirus 71 vaccine, EB vaccine, hepatitis C vaccine, HIV vaccine, human HTLV-1 T lymphocytic leukemia vaccine, Marburg virus disease vaccine, norovirus vaccine, human respiratory syncytial virus vaccine, severe acute respiratory syndrome (SARS) vaccine, human West Nile virus vaccine, and Zika virus vaccine. In some embodiments, the vaccine is selected from the following bacteria: Bacillus anthracis, Vibrio cholerae, Bordetella pertussis, Clostridium tetani, Corynebacterium diphtheriae, Haemophilus influenzae (Hib), Neisseria meningitidis, Streptococcus pneumoniae, Coxiella burnetii, Mycobacterium tuberculosis, and Salmonella typhi.In various embodiments, the vaccine is selected from the following vaccines: bacterial disease vaccine, dental caries vaccine, Ehrlich disease vaccine, leprosy vaccine, Lyme disease vaccine, Staphylococcus aureus vaccine, Streptococcus pyogenes vaccine, syphilis vaccine, tularemia vaccine, and Yersinia pestis vaccine. In various embodiments, the vaccine is selected from the following vaccines: parasitic disease vaccine, malaria vaccine, schistosomiasis vaccine, Chagas disease vaccine, hookworm vaccine, human onchocerciasis / river blindness vaccine, trypanosomiasis vaccine, and visceral leishmaniasis vaccine. In various embodiments, the vaccine is selected from: non-communicable disease vaccine, Alzheimer's disease amyloid vaccine, breast cancer vaccine, ovarian cancer vaccine, prostate cancer vaccine, and Talimogene laherparepvec (T-VEC). In some embodiments, the composition comprises lipids and a portion of the vaccine, said portion being capable of mediating at least one function of the vaccine.

[0447] Wild-type: As used herein, the term "wild-type" has its meaning in the context of the field, referring to an entity that has the structure and / or activity found in nature in a "normal" state or background (in contrast to mutants, diseases, alterations, etc.). Those skilled in the art will understand that wild-type genes and peptides often exist in many different forms (e.g., alleles).

[0448] The methods and structures described herein with respect to the compounds and compositions of this disclosure are also applicable to pharmaceutically acceptable acid or base addition salts and all stereoisomer forms of these compounds and compositions.

[0449] Generally, the properties of CpG oligonucleotides, including their ability to stimulate or antagonize immune responses, can be determined using any method or technique described herein or known in the art.

[0450] Some embodiments

[0451] In some embodiments, this disclosure relates to the understanding that CpG oligonucleotide-mediated immune responses can be influenced by the stereochemistry of chiral nucleotide-to-nucleotide bonds (e.g., thiophosphates) in the CpG region motif of the oligonucleotide.

[0452] In some embodiments, this disclosure covers insights into how CpG oligonucleotide-mediated immune responses can be influenced by stereochemistry. In some embodiments, the data presented in this disclosure show that stereorandom and stereopure CpG oligonucleotide compositions can exhibit different immunomodulatory activities. Different stereopure CpG oligonucleotide compositions can also exhibit different immunomodulatory activities.

[0453] According to some embodiments of this disclosure, when an oligonucleotide containing a CpG region motif has one or more chiral centers (e.g., within a CpG region motif), different stereoforms of such oligonucleotides may have different characteristics and / or activities, one or more of which may affect their utility and / or effectiveness. In some embodiments, chiral centers that can affect the characteristics and / or activity of the oligonucleotide are found, for example, in internucleotide bonds involving one or more thiophosphates or other modified phosphodiester bonds.

[0454] In some embodiments, this disclosure relates to chiral-controlled CpG oligonucleotide compositions that are chiral because the compositions comprise oligonucleotides of various oligonucleotide types at predetermined levels, wherein the oligonucleotide type is defined by: 1) a base sequence; 2) a backbone (internucleotide) bonding pattern; 3) a backbone (internucleotide) chiral center pattern; and 4) a backbone (internucleotide) phosphorus modification pattern; wherein each oligonucleotide of each oligonucleotide type independently comprises at least one common CpG region motif. In some embodiments, the oligonucleotides of the various oligonucleotide types provided further comprise one or more chemical modifications of one or more bases and / or sugars. In some embodiments, the oligonucleotides provided comprise one or more modified sugars. In some embodiments, the oligonucleotides provided comprise one or more 2'-modified sugars. In some embodiments, the 2'-modification is 2'-OR, where R is an optionally substituted C 1-6 Aliphatic. In some embodiments, the provided oligonucleotide comprises one or more modified bases. In some embodiments, the provided oligonucleotide comprises one or more modified 5mC. In some embodiments, the provided oligonucleotide comprises one or more modified sugars and one or more modified bases.

[0455] In some embodiments, although the data provided in this disclosure show that some CpG region motifs in at least some chiral controlled CpG oligonucleotide compositions exhibit greater immunomodulatory activity (e.g., greater agonist or antagonist activity) than others, this disclosure covers any chiral controlled CpG oligonucleotide composition in which the CpG region motif comprises a stereodefined phosphate thioester or other nucleotide bond, and which the CpG oligonucleotide demonstrates greater agonist or antagonist activity than a negative control (e.g., in the absence of an oligonucleotide composition) or a reference composition (e.g., a stereorandom composition of oligonucleotides having the same base sequence and / or chemical modifications, another chiral controlled oligonucleotide composition of oligonucleotides having the same base sequence and / or chemical modifications, etc.). In some embodiments, this disclosure provides chiral controlled oligonucleotide compositions comprising any CpG region motif disclosed herein.

[0456] In some embodiments, this disclosure relates to chiral-controlled CpG oligonucleotide compositions that are chiral because the compositions comprise oligonucleotides of various oligonucleotide types at predetermined levels, wherein the oligonucleotide type is defined by: 1) a base sequence; 2) a backbone (internucleotide) bonding pattern; 3) a backbone (internucleotide) chiral center pattern; and 4) a backbone (internucleotide) phosphorus modification pattern; wherein each oligonucleotide of each oligonucleotide type independently comprises at least one common CpG region motif, which is any CpG region motif disclosed herein.

[0457] In some embodiments, this disclosure relates to chiral controlled CpG oligonucleotide compositions that are chiral because the compositions comprise predetermined levels of oligonucleotides of various oligonucleotide types, wherein the oligonucleotide type is defined by: 1) a base sequence; 2) a backbone (internucleotide) bonding pattern; 3) a backbone (internucleotide) chiral center pattern; and 4) a backbone (internucleotide) phosphorus modification pattern; wherein each oligonucleotide of each oligonucleotide type independently comprises at least one common CpG region motif: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; wherein each (*R / S) is an independent chiral internucleotide bond, and N1 and N2 are any nucleosides. In some embodiments, this disclosure relates to chiral-controlled CpG oligonucleotide compositions comprising a plurality of oligonucleotides, each of which: (a) hybridizes to a specific target sequence; (b) has a base sequence including at least one C residue in a CpG region motif present in all of the plurality of oligonucleotides (“common C residue”), and has a 5-methyl, modified sugar motif, or both; and (c) comprises one or more chiral nucleotide inter-bonds such that each oligonucleotide is a specific stereoform, characterized by stereoisomorphism at each of the one or more chiral nucleotide inter-bonds, wherein stereoisomorphism identifies which stereoisomer is present at the specific chiral nucleotide inter-bond, wherein the composition is chiral-controlled because it contains predetermined levels of each stereoform.

[0458] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides comprising a chain containing about 14 to about 49 nucleotides, wherein the chain comprises at least one copy of the CpG regional motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2, wherein at least one (*R / S) is a phosphate thioester in the Rp conformation and at least one (*R / S) is a modified internucleotide bond in the Sp conformation, and N1 and N2 are each independently any nucleoside.

[0459] In some embodiments, this disclosure relates to chiral-controlled oligonucleotide compositions comprising CpG oligonucleotides comprising a chain containing about 14 to about 49 nucleotides, wherein the chain comprises at least one copy of the CpG regional motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2, wherein at least one (*R / S) is a phosphate thioester in the Rp conformation and at least one (*R / S) is a phosphate thioester in the Sp conformation, and N1 and N2 are each independently any nucleoside.

[0460] In some embodiments, this disclosure relates to compositions comprising CpG oligonucleotides comprising a chain containing about 14 to about 49 nucleotides, wherein the chain comprises at least one copy of the CpG regional motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2, wherein at least one (*R / S) is a phosphate thioester in the Rp conformation and at least one (*R / S) is a phosphate thioester in the Sp conformation, and N1 and N2 are any nucleosides.

[0461] In some embodiments, this disclosure relates to compositions comprising a plurality of oligonucleotides, wherein each oligonucleotide: (a) hybridizes to a specific target sequence; and (b) comprises a sequence including at least one CpG region motif (“common CpG region motif”) present in all of the plurality of oligonucleotides, the CpG region motif having the structure: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; wherein each (*R / S) is an independent chiral nucleotide bond, and N1 and N2 are any nucleosides.

[0462] In some embodiments, this disclosure relates to compositions comprising a plurality of oligonucleotides, each of which: (a) consists of a specific base sequence; and (b) comprises a sequence including at least one CpG region motif (“common CpG region motif”) present in all of the plurality of oligonucleotides, the CpG region motif having the structure: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; wherein at least one (*R / S) is a phosphate thioester in the Rp conformation, and at least one (*R / S) is a phosphate thioester in the Sp conformation, and N1 and N2 are each independently any nucleoside.

[0463] In some embodiments, this disclosure relates to compositions comprising a plurality of oligonucleotides, each of which: (a) hybridizes to a specific target sequence; and (b) has a sequence comprising at least one CpG region motif (“common CpG region motif”) present in all of the plurality of oligonucleotides, the CpG region motif...

Claims

1. A chirally controlled oligonucleotide composition comprising a CpG oligonucleotide comprising a strand comprising from about 14 to about 49 nucleotides, wherein the strand comprises at least one copy of the CpG region motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2, wherein at least one (*R / S) is a modified internucleotide linkage in the Rp conformation and at least one (*R / S) is a modified internucleotide linkage in the Sp conformation, and N1 and N2 are each independently any nucleoside.

2. A chirally controlled oligonucleotide composition comprising a CpG oligonucleotide comprising a strand comprising from about 14 to about 49 nucleotides, wherein the strand comprises at least one copy of the CpG region motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2, wherein at least one (*R / S) is a phosphorothioate in the Rp conformation and at least one (*R / S) is a phosphorothioate in the Sp conformation, and N1 and N2 are each independently any nucleoside.

3. A composition comprising a CpG oligonucleotide comprising a strand comprising from about 14 to about 49 nucleotides, wherein the strand comprises at least one copy of the CpG region motif N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2, wherein at least one (*R / S) is a phosphorothioate in the Rp conformation and at least one (*R / S) is a phosphorothioate in the Sp conformation, and N1 and N2 are each independently any nucleoside.

4. A composition comprising a plurality of oligonucleotides, each of which: (a) hybridizes to a particular target sequence; and (b) comprises a sequence that includes at least one CpG region motif ("common CpG region motif") present in all of the oligonucleotides in the plurality, the CpG region motif having the structure: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; where each (*R / S) is independently a chiral internucleotide linkage, and N1 and N2 are each independently any nucleoside.

5. A composition comprising a plurality of oligonucleotides, each of which: (a) consists of a particular base sequence; and (b) comprises a sequence that includes at least one CpG region motif ("common CpG region motif") present in all of the oligonucleotides in the plurality, the CpG region motif having the structure: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; where at least one (*R / S) is a phosphorothioate in the Rp conformation and at least one (*R / S) is a phosphorothioate in the Sp conformation, and N1 and N2 are each independently any nucleoside.

6. A composition comprising a plurality of oligonucleotides, each of which: (a) hybridizes to a particular target sequence; and (b) comprises a sequence that includes at least one CpG region motif ("common CpG region motif") present in all of the oligonucleotides in the plurality, the CpG region motif having the structure: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; where at least one (*R / S) is a phosphorothioate in the Rp conformation and at least one (*R / S) is a phosphorothioate in the Sp conformation, and N1 and N2 are each independently any nucleoside. (b) has a sequence comprising at least one CpG region motif ("common CpG region motif") that is present in all of the oligonucleotides in the plurality of oligonucleotides, the CpG region motif having the structure: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; where each (*R / S) is independently a chiral internucleotide linkage, wherein the composition is chirally controlled in that for each common CpG region motif it contains a predetermined level of each stereoisomer 1-8 (S1-S8): S1: N1-(*R)-C-(*R)-G-(*R)-N2; S2: N1-(*R)-C-(*R)-G-(*S)-N2; S3: N1-(*R)-C-(*S)-G-(*R)-N2; S4: N1-(*R)-C-(*S)-G-(*S)-N2; S5: N1-(*S)-C-(*R)-G-(*R)-N2; S6: N1-(*S)-C-(*R)-G-(*S)-N2; S7: N1-(*S)-C-(*S)-G-(*R)-N2; S8: N1-(*S)-C-(*S)-G-(*S)-N2.

7. An oligonucleotide composition that is chirally controlled in that the composition comprises a predetermined level of oligonucleotides of each oligonucleotide type, wherein an oligonucleotide type is defined by: 1) a base sequence; 2) a pattern of backbone linkages; 3) a pattern of backbone chiral centers; and 4) a pattern of backbone phosphorus modifications; where each oligonucleotide of each oligonucleotide type independently comprises at least one common CpG region motif: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; where each (*R / S) is independently a chiral internucleotide linkage, and N1 and N2 are each independently any nucleoside.

8. An oligonucleotide composition that is chirally controlled in that the composition comprises a predetermined level of oligonucleotides of each oligonucleotide type, wherein an oligonucleotide type is defined by: 1) a base sequence; 2) a pattern of backbone linkages; 3) a pattern of backbone chiral centers; and 4) a pattern of backbone phosphorus modifications; where each oligonucleotide of each oligonucleotide type independently comprises at least one common CpG.

9. An oligonucleotide composition that is chirally controlled in that the composition comprises a predetermined level of a plurality of oligonucleotides that share common: 1) a base sequence; 2) a pattern of backbone linkages; 3) a pattern of backbone phosphorus modifications; where each oligonucleotide of the plurality of oligonucleotides independently comprises at least one common CpG region motif: N1-(*R / S)-C-(*R / S)-G-(*R / S)-N2; where each (*R / S) is independently a chiral internucleotide linkage, and N1 and N2 are each independently any nucleoside; and wherein the plurality of oligonucleotides share the same stereochemistry at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 chiral internucleotidic linkages.

10. The oligonucleotide composition of claim 9, wherein the plurality of oligonucleotides share the same stereochemistry at at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 chiral internucleotidic linkages.

11. A composition comprising a plurality of oligonucleotides, each of the oligonucleotides: (a) hybridizing to a particular target sequence; (b) having a base sequence that includes at least one C residue in a CpG region motif that is present in all of the oligonucleotides of the plurality ("common C residue"), and having a modified base moiety, a modified sugar moiety, or both; and (c) comprises one or more chiral internucleotide linkages such that each oligonucleotide is a specific stereoform, which is characterized by a stereo identity at each of one or more chiral internucleotidic linkages, wherein a stereo identity identifies which stereoisomer is present at a particular chiral internucleotidic linkage, wherein the composition is chirally controlled in that it contains predetermined levels of each stereo form.

12. An oligonucleotide composition that is chirally controlled in that the composition comprises predetermined levels of oligonucleotides of each oligonucleotide type, wherein an oligonucleotide type is defined by: 1) a base sequence; 2) a pattern of backbone linkages; 3) a pattern of backbone chiral centers; and 4) a pattern of backbone phosphorus modifications; wherein the base sequence includes at least one C residue in a CpG region motif that has a modified base, a modified sugar moiety, or both; and the composition has a reduced ability to activate a TLR9-mediated and / or TLR9-associated immune response relative to the ability of a non-chirally controlled composition that comprises random levels of oligonucleotides of each oligonucleotide type.

13. An oligonucleotide composition that is chirally controlled in that the composition comprises predetermined levels of oligonucleotides of each oligonucleotide type, wherein an oligonucleotide type is defined by: 1) a base sequence; 2) a pattern of backbone linkages; 3) a pattern of backbone chiral centers; and 4) a pattern of backbone phosphorus modifications; wherein the base sequence includes at least one C residue in a CpG region motif that has a 5-methyl, a modified sugar moiety, or both; and the composition has a reduced ability to activate a TLR9-mediated and / or TLR9-associated immune response relative to the ability of a non-chirally controlled composition that comprises random levels of oligonucleotides of each oligonucleotide type.

14. A composition comprising a plurality of compounds having the structure: A c -[-L LD -(R LD ) a ] b or [(A c ) a -L LD ] b -R LD or salts thereof, wherein: A c for oligonucleotide chain ([H] b -Ac is an oligonucleotide); a is 1-1000; b is 1-1000; each L is independently a covalent bond or an optionally substituted C1-C6 aliphatic LD independently a covalent bond or an optionally substituted C1-C6 aliphatic 80 a saturated or partially unsaturated aliphatic group in which one or more methylene units are optionally and independently replaced with T LD or an optionally substituted group selected from C1–C6alkylene, C1–C6alkenylene, -C≡C-, C1–C6heteroaliphatic moiety, -C(R)2–, –Cy–, –O–, –S–, -S-S-, -N(R)-, -C(O)-, -C(S)-, -C(NR)-, -C(O)N(R)-, -N(R)C(O)N(R), -N(R)C(O)-, -N(R)C(O)O-, -OC(O)N(R)-, -S(O)-, -S(O)2-, -S(O)2N(R)-, -N(R)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O–; Each R LD Independently for the optionally replaced C1-C 80 A saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by a group selected from the following optionally substituted groups: C1–C6 alkylene, C1–C6 alkenylene, -C≡C-, C1–C6 heteroaliphatic moiety, -C(R)2–, -Cy–, -O–, -S–, -SS-, -N(R)-, -C(O)-, -C(S)-, -C (NR)-, -C(O)N(R)-, -N(R)C(O)N(R), -N(R)C(O)-, -N(R)C(O)O-, -OC(O)N(R)-, -S (O)-, -S(O)2-, -S(O)2N(R)-, -N(R)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O–; T LD has the following structure: W is O, S, or Se; X, Y and Z are each independently -0-, -S-, -N(-L-R 1 ) or L; L is a covalent bond or an optionally substituted, linear or branched C1-C6alkylene, wherein one or more methylene units of L are optionally and independently replaced with an optionally substituted group selected from C1-C6alkylene, C1-C6alkenylene, -CºC-, C1-C6heteroaliphatic, -C(R)2-, -Cy-, -0-, -S-, -S-S-, -N(R)-, -C(O)-, -C(S)-, -C(NR)-, -C(O)N(R)-, -N(R)C(O)N(R)-, -N(R)C(O)-, -N(R)C(O)O-, -OC(O)N(R)-, -S(O)-, -S(O)2-, -S(O)2N(R)-, -N(R)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-; 10 L is a covalent bond or an optionally substituted, linear or branched C1-C6alkylene, wherein one or more methylene units of L are optionally and independently replaced with an optionally substituted group selected from C1-C6alkylene, C1-C6alkenylene, -CºC-, C1-C6heteroaliphatic, -C(R)2-, -Cy-, -0-, -S-, -S-S-, -N(R)-, -C(O)-, -C(S)-, -C(NR)-, -C(O)N(R)-, -N(R)C(O)N(R)-, -N(R)C(O)-, -N(R)C(O)O-, -OC(O)N(R)-, -S(O)-, -S(O)2-, -S(O)2N(R)-, -N(R)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, and -C(O)O-; L is a covalent bond or an optionally substituted, linear or branched C1-C6alkylene, wherein one or more methylene units of L are optionally and independently replaced with an optionally substituted group selected from C1-C6alkylene, C1-C6alkenylene, -CºC-, C1-C6heteroaliphatic, -C(R)2-, -Cy-, -0-, -S R 1 halogen, R, or an optionally substituted C1–C 50 aliphatic, wherein one or more methylene units are optionally and independently replaced with an optionally substituted group selected from C1–C6alkylene, C1–C6alkenylene, -C≡C-, C1–C6heteroaliphatic moiety, -C(R)2-, –Cy–, –O–, –S–, –S–S–, -N(R)–, -C(O)–, –C(S)–, –C(NR)–, –C(O)N(R)–, -N(R)C(O)N(R), -N(R)C(O)–, –N(R)C(O)O–, -OC(O)N(R)-, –S(O)–, –S(O)2–, -S(O)2N(R)–, -N(R)S(O)2- –SC(O)–, –C(O)S–, –OC(O)–, and -C(O)O– each R' is independently -R, -C(O)R, -CO2R, or -SO2R, or: two R' groups together with their intervening atoms form an optionally substituted 3-30 membered monocyclic, bicyclic, or polycyclic ring having, in addition to the intervening atoms, 0-10 heteroatoms; -Cy- is an optionally substituted bivalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, and heterocyclylene; and each R is independently hydrogen, or an optionally substituted group selected from C1-C6 aliphatic, carbocyclyl, aryl, heteroaryl, and heterocyclyl.

15. A compound having the structure of Formula O-I: or a salt thereof, wherein: each BA is independently selected from C 1-30 cycloaliphatic, C 6-30 aryl, C 5-30 heteroaryl, C 3-30 heterocyclyl, an optionally substituted group of natural and modified nucleobase moieties; R 5E and R s each independently -H, -F, -CI, -Br, -I, -CN, -N3, -NO, -N02, -L-R', -L-OR', -L-SR', -L-N(R')2, -0-L-OR', -0-L-SR', or -0-L-N(R')2; s is 0-20; Each L is independently covalently bonded, or selected from C atoms having 1-10 heteroatoms. 1-30 Aliphatic groups and C 1-30 A divalent, optionally substituted linear or branched group of a heteroaliphatic group, wherein one or more methylene units are optionally and independently replaced with C. 1-6 Alkylene, C 1-6 Alkenylene, -C≡C-, -C(R')2-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)O-, -S( O)-, -S(O)2-, -S(O)2N(R')-, -C(O)S-, -C(O)O-, -P(O)(OR')-, -P(O)(SR')-, -P(O)(R')-, -P(O)(NR')-, -P(S)(OR')-, -P(S)(SR' -P(S)(R')-, -P(S)(NR')-, -P(R')-, -P(OR')-, -P(SR')-, -P(NR')-, -P(OR')[B(R')3]-, -OP(O)(OR')O-, -OP(O)(SR')O-, -OP(O)(R')O-, -OP(O)(NR')O-, -OP(OR')O-, -OP(SR')O-, -OP(NR')O-, -OP(R')O- or -OP(OR')[B(R')3]O-; and one or more carbon atoms are optionally and independently replaced by Cy. L ; each Cy is independently an optionally substituted tetravalent radical selected from C L is independently selected from C 3-20 aliphatic ring, C 6-20 aryl ring, 5-20 membered heteroaryl ring having 1-10 heteroatoms, and 3-20 membered heterocyclyl ring having 1-10 heteroatoms; each ring A is independently an optionally substituted 3-20 membered monocyclic, bicyclic, or polycyclic ring having 0-10 heteroatoms; each L P independently has the structure of Formula L-I: or a salt form thereof, wherein: P L P for P(=W), P or P→B(R')3; W is O, S, or Se; R 1 -L-R, halogen, -CN, -NO2, -Si(R)3, -OR, -SR, or -N(R)2; X, Y and Z are each independently -0-, -S-, -N(-L-R 1 ) - or L; z is 1-1000; L 3E -L- or -L-L-; R 3E is -R', -L-R', -OR', or a solid support; each R' is independently -R, -C(O)R, -C(O)OR, or -S(O)2R; each R is independently -H, or a group selected from C 1-30 aliphatic, C 1-30 heteroaliphatic, C 6-30 aryl, C 6-30 arylaliphatic, C 6-30 arylheteroaliphatic, an optionally substituted group of 5-30 membered heteroaryl having 1-10 heteroatoms, and 3-30 membered heterocyclyl having 1-10 heteroatoms, or two R groups optionally and independently together form a covalent bond, or: two or more R groups on the same atom optionally and independently together with the atom form an optionally substituted 3-30 membered monocyclic, bicyclic, or polycyclic ring having, in addition to the atom, 0-10 heteroatoms; or two or more R groups on two or more atoms optionally and independently together with their intervening atoms form an optionally substituted 3-30 membered monocyclic, bicyclic, or polycyclic ring having, in addition to the intervening atoms, 0-10 heteroatoms.

16. The compound of claim 15, wherein z is at least 10.

17. The composition of any one of claims 1-14, wherein the oligonucleotide has a structure according to claim 16.

18. The composition of claim 17, wherein the composition has an enhanced ability to activate a TLR9-mediated and / or TLR9-associated immune response relative to the ability of a composition that is achiral controlled because it comprises a random level of each oligonucleotide type.

19. The composition of claim 17, wherein the oligonucleotide of the composition comprises two or more CpGs.

20. The composition of claim 19, wherein the oligonucleotide has a predetermined level that is 1%-100% of all oligonucleotides in the composition.

21. A method for modulating hTLR9 activity of an oligonucleotide comprising administering the composition of claim 19.

22. An oligonucleotide, composition, method, compound selected from the examples described in the disclosure, and portions and combinations thereof.

23. An oligonucleotide, composition, method, compound selected from Examples 1-483.

Images