A yeast strain ZYS-3 that efficiently degrades gossypol and its application

Abstract

This invention discloses a highly efficient yeast strain ZYS-3 that degrades gossypol and its applications, belonging to the fields of fermentation engineering and livestock feed technology. Using strain ZYS-3, belonging to the *Saccharomyces cerevisiae*, and adding a gossypol adsorbent during fermentation, the gossypol degradation rate reaches 95.23%. This gossypol adsorbent uses biomass porous charcoal as a matrix, and lysine is grafted onto the surface of the biomass porous charcoal using an epoxy silane coupling agent. On the one hand, this reduces the loss of lysine during the substrate humidification process, ensuring the adsorption effect on free gossypol; on the other hand, it utilizes the adsorption function of biomass porous charcoal to enhance the enrichment of free gossypol in cottonseed meal, accelerating the binding of the phenolic hydroxyl groups of free gossypol to the ε-amino groups of lysine to form bound gossypol, reducing the inhibitory effect of free gossypol on the strain, and further improving fermentation efficiency.

Description

Technical Field

[0001] This invention belongs to the field of fermentation engineering and livestock feed technology, specifically a yeast strain ZYS-3 that is highly efficient at degrading gossypol and its applications. Background Technology

[0002] Gossypol, a polyphenol dinaphthalene derivative commonly known as cotton toxin, is a yellow polyphenolic pigment found in cottonseed glands. It exists in the pigment glands of cotton roots, stems, leaves, and seeds, with the highest content in the kernel pigment glands. It is insoluble in water and hexane, but soluble in acetone, chloroform, ether, and butanone, and partially soluble in crude vegetable oil. Gossypol exists mainly in two forms: free gossypol and conjugated gossypol. Conjugated gossypol is not absorbed by animals in their digestive tract and is quickly excreted in feces, exhibiting lower toxicity. Free gossypol, however, due to its active groups, possesses significant cytotoxicity, reproductive toxicity, and antioxidant system-damaging effects. This not only leads to growth inhibition, organ damage, and reproductive disorders in monogastric animals, but its residues also directly threaten the safety of animal-derived food. Therefore, effectively removing or degrading free gossypol from cottonseed meal is crucial for improving its feed value, ensuring animal health, and achieving efficient resource utilization.

[0003] Currently, gossypol detoxification methods mainly include physical, chemical, and biological methods. Biological methods are considered the best way to remove free gossypol from cottonseed meal and improve its nutritional value. Biological methods are low-cost, safe, and can increase the protein and essential amino acid content of cottonseed meal, improving palatability. In recent years, they have been frequently used for cottonseed meal detoxification. Although some studies have reported that certain microorganisms have the ability to degrade gossypol, resources of highly efficient, stable, and safe gossypol-degrading strains are still relatively scarce. Yeast, as a recognized safe microorganism, has gained widespread international acceptance for its application safety. It produces a variety of enzymes that can effectively degrade macromolecules in feed, promote feed conversion, and improve feed utilization.

[0004] Chinese patent application CN102318737A discloses a method for preparing non-toxic cottonseed meal animal feed. This method utilizes multiple different microbial strains for detoxification, but it is difficult to balance the fermentation conditions among these strains, resulting in an unstable detoxification process. Chinese patent CN114680230B discloses a method for preparing low-gossypol, high-nutrient fermented cottonseed meal, and its application. This method utilizes multiple microorganisms and employs two liquid fermentations to detoxify gossypol. The first liquid fermentation increases the decomposition of the cottonseed meal substrate, followed by a second liquid fermentation to further degrade the gossypol. However, this process requires spray drying, and the fermentation operation is more complex than solid-state fermentation.

[0005] Therefore, there is an urgent need to find a strain that can be used for solid-state fermentation of cottonseed meal and can efficiently degrade gossypol in order to meet the needs of large-scale production of cottonseed meal detoxification fermentation. Summary of the Invention

[0006] The purpose of this invention is to provide a highly efficient yeast strain ZYS-3 that degrades gossypol and its application. The selected yeast strain ZYS-3 is applied to cottonseed meal fermentation. Through solid-state fermentation with a single strain, the conditions are controllable and the process is simple. During the fermentation process, a gossypol adsorbent is added to reduce the inhibitory effect of free gossypol on the strain, thereby efficiently degrading gossypol and meeting the application requirements of feed additives.

[0007] The objective of this invention can be achieved through the following technical solutions:

[0008] ZYS-3, a strain that efficiently degrades gossypol, is a type of yeast called *Gnaphalium tumefaciens*. Meyerozyma guilliermondii (), deposited at the China Center for Type Culture Collection, accession number CCTCC M 20251701, date of deposit: July 28, 2025.

[0009] Colony and cell morphology of strain ZYS-3: On YPD plates, colonies are round, approximately 4.0 mm in diameter, milky white, convex, glossy, moist, and with regular edges. Under a light microscope, the cells are mostly oval, with a size of 0.4-0.6 μm. Under an electron microscope, single cells are oval, irregularly arranged, and have obvious budding scars.

[0010] The 26S rDNA gene sequence determination results of strain ZYS-3 are as follows:

[0011] NL1: GCATATCAATAAGCGGAGGAAAAG; NL4: GGTCCGTGTTTTCAAGACGG.

[0012] This invention also provides the application of a highly efficient yeast strain ZYS-3 that degrades gossypol in feed additives, comprising the following steps:

[0013] Mix cottonseed meal and gossypol adsorbent evenly, then add an external carbon source and mix evenly. Add water to adjust the moisture content to 50-60%, adjust the pH value to 4-6, let stand for 20-40 minutes, then inoculate with yeast strain ZYS-3 and ferment at 30℃ for 3 days to obtain a non-toxic cottonseed meal feed additive.

[0014] Furthermore, the mass ratio of cottonseed meal, gossypol adsorbent, and added carbon source is 20:1-3:2.

[0015] Furthermore, the added carbon source is any one or more of corn flour, glucose, sucrose, and starch mixed in any mass ratio.

[0016] Furthermore, the gossypol adsorbent is prepared through the following steps.

[0017] S1: Add biomass porous carbon, anhydrous ethanol and deionized water to a reaction vessel, stir for 10-12 min at 50-60℃ and 500-600 r / min, add 3-(2,3-epoxypropoxy)propyltrimethoxysilane, adjust the pH to 3-4 with hydrochloric acid solution, stir for 5-6 h, filter, wash the precipitate and dry to constant weight to obtain epoxidized porous carbon.

[0018] The ratio of biomass porous char, anhydrous ethanol, deionized water and 3-(2,3-epoxypropoxy)propyltrimethoxysilane is 20-25g: 40-50mL: 70-80mL: 10-12mL.

[0019] S2: Add epoxidized porous carbon, lysine and DMF to a reaction vessel, stir for 10-12 min at 50-60℃ and 500-600 r / min, then stir and react at 80-90℃ for 10-12 h, filter, wash the precipitate and vacuum dry to constant weight to obtain gossypol adsorbent.

[0020] The ratio of epoxidized porous carbon, lysine, and DMF is 20-22g: 40-45g: 150-170mL.

[0021] The beneficial effects of this invention are:

[0022] 1. The strain ZYS-3 of this invention is *Saccharomyces cerevisiae*, which can efficiently degrade gossypol in cottonseed meal. Under simple conditions such as adding corn flour as a carbon source, its gossypol degradation rate can reach 89.77%. When a gossypol adsorbent is added during fermentation, the gossypol degradation rate reaches 95.23%.

[0023] 2. The strain ZYS-3 of this invention is suitable for solid-state fermentation. Its cottonseed meal fermentation process only takes 3 days. Compared with the existing cottonseed meal solid-state fermentation process, the fermentation time is short, no other auxiliary bacteria need to be added during the fermentation process, the process conditions are simple and controllable, and there is no need to go through multiple fermentation. Compared with liquid fermentation, solid-state fermentation has low equipment requirements and simple process, which helps to scale up production and improve production efficiency.

[0024] 3. The ZYS-3 strain of this invention incorporates a gossypol adsorbent during cottonseed meal fermentation. This gossypol adsorbent uses porous biomass charcoal as a matrix, and lysine is grafted onto the surface of the porous biomass charcoal using an epoxy silane coupling agent. On the one hand, this reduces the loss of lysine during substrate humidification during fermentation, ensuring the adsorption effect on free gossypol. On the other hand, the adsorption function of the porous biomass charcoal enhances the enrichment of free gossypol in the cottonseed meal, accelerates the binding of the phenolic hydroxyl groups of free gossypol to the ε-amino groups of lysine, forming bound gossypol, reducing the inhibitory effect of free gossypol on the strain, and further improving fermentation efficiency. Attached Figure Description

[0025] Figure 1 This is a growth diagram of strain ZYS-3 in Example 1 of the present invention.

[0026] Figure 2 This is a bar chart showing the gossypol degradation rate of the strains screened in Example 1 of the present invention.

[0027] Figure 3 This is a morphological diagram of strain ZYS-3 in Example 2 of the present invention.

[0028] Figure 4 This is a phylogenetic tree diagram of strain ZYS-3 from Example 2.

[0029] Figure 5 This is a graph showing the hemolytic test results in Example 3.

[0030] Figure 6 The graph shows the culture conditions of strain ZYS-3 in Example 5.

[0031] Figure 7 The graph shows the degradation rate of gossypol by strain ZYS-3 under different conditions in Example 6.

[0032] Figure 8 The bar chart shows the effect of each component of strain ZYS-3 on the degradation of gossypol in Example 7.

[0033] Figure 9 This is a roadmap of the first degradation pathway of gossypol in Example 8.

[0034] Figure 10 This is a roadmap of the second degradation pathway of gossypol in Example 8. Detailed Implementation

[0035] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0036] Example 1: Screening of Gossypol-degrading bacteria

[0037] One gram of soil collected in October 2023 from cotton fields in Zhangqiu District, Jinan City, Shandong Province was placed in a liquid culture medium for gossypol-degrading bacteria for enrichment. The enriched solution was obtained by shaking culture at 30℃ and 220r / min for 7 days.

[0038] Dilute the enrichment solution with sterile water to a concentration of 10. -3The culture medium was spread onto GAMM solid medium and cultured at 30℃ and 220r / min for 3 days. After colonies grew, yeast-like colonies were selected, isolated and purified, and cultured on YPD solid medium at 30℃ and 220r / min for 3 days.

[0039] The bacterial strain was inoculated into a liquid culture medium with gossypol as the sole carbon source, with a final concentration of 600 μg / mL. The culture was carried out at 30℃ and 220 r / min for 4 days, followed by incubation for 24 h. The bacterial culture was then mixed with acetone at a ratio of 1:3, and the mixture was filtered through a 0.22 μm filter membrane to obtain the test sample. The remaining gossypol content in the test sample was detected by high-performance liquid chromatography (HPLC). The chromatographic column was a YMC-PACK ODS series C18 column (250 mm length × 4.6 mm inner diameter × 2.6 µm particle size). The mobile phase A was acetonitrile:0.2% phosphoric acid (83:17 v / v), the flow rate was 1 mL / min, the injection volume was 20 µL, the column temperature was 25℃, and a UV detector (238 nm wavelength) was used.

[0040] Seventeen yeast strains with gossypol as the sole carbon source were isolated, screened, and purified from soil samples. Among them, strain ZYS-3 grew well in solid medium with gossypol as the sole carbon source (see [link to relevant documentation]). Figure 1 Furthermore, the degradation efficiency of gossypol is highest in liquid culture media where gossypol is the sole carbon source (see [link to article]). Figure 2 Therefore, strain ZYS-3 was selected for further research.

[0041] Example 2: Identification and physiological and biochemical characteristics of strain ZYS-3

[0042] Morphological characteristics determination: Preliminary identification of isolated yeast was performed by plate observation, optical microscopy, and electron microscopy.

[0043] On YPD plates, strain ZYS-3 colonies are round, approximately 4.0 mm in diameter, milky white, moderately convex, glossy, moist, and with regular edges. Under a light microscope, the cells are mostly oval, with a size of 0.6 μm. Under an electron microscope, single cells are oval, irregularly arranged, and have obvious budding scars (see [link to relevant documentation]). Figure 3 ).

[0044] The 26S rDNA gene sequence of this strain was amplified and sequenced. First, the ZYS-3 strain was cultured to the stationary phase, and its genomic DNA was extracted. Using the genomic DNA as a template, PCR amplification was performed using universal primers for 26S rDNA, and then the sample was sent to a sequencing company for sequencing. The sequence is shown below:

[0045] 26S rDNA (NL1: GCATATCAATAAGCGGAGGAAAAG, NL4: GGTCCGTGTTTTCAAGACGG).

[0046] The sequencing results were analyzed using BLAST in the GenBank database, and a phylogenetic tree was constructed using MEGA 7.0 software. Figure 4 As shown, strain ZYS-3 and *Saccharomyces cerevisiae* (…) Meyerozyma guilliermondii Clustered into one branch, which is the one most closely related to it.

[0047] Therefore, it is inferred that strain ZYS-3 belongs to *Saccharomyces gimmicki*. Meyerozyma guilliermondii The strain was named M . guilliermondii ZYS-3 is deposited at the China Center for Type Culture Collection, with the strain accession number CCTCC M 20251701.

[0048] Physiological and biochemical properties determination: The strains were determined using a yeast identification kit.

[0049] Metabolic characteristics were analyzed using the yeast identification kit-API20CAUX. The results showed that strain ZYS-3 was positive for glucose, glycerol, 2-keto-glucose hydrochloride, arabinose, xylose, calendula alcohol, xylitol, galactose, raffinose, α-methyl-D-glucose, acetylglucosamine, cellobiose, maltose, sucrose, trehalose, mesotriose, and sorbitol; and negative for inositol and lactose (see Table 1).

[0050] Table 1. Physiological and biochemical characteristics of gossypol-degrading bacterium ZYS-3

[0051]

[0052] Example 3: Hemolytic activity detection of strain ZYS-3

[0053] Hemolysis refers to the rupture of red blood cells and the release of hemoglobin under the influence of hemolytic toxins and other physicochemical factors. It plays a significant role in the pathogenesis of bacterial diseases in animals, and the presence or absence of hemolytic activity in the metabolic products of bacterial strains is considered an important indicator for evaluating the safety of bacterial strains.

[0054] Single colonies of strain ZYS-3 were streaked onto Columbia blood agar plates, with pathogenic Staphylococcus aureus 2370 as a positive control. The plates were incubated upside down in a 30°C incubator for 48 hours, and the presence of hemolytic clear zones was observed.

[0055] The hemolytic test results of strain ZYS-3 are as follows: Figure 5As shown in Figure B, strain ZYS-3 did not form a greenish or clear hemolysis zone on the blood agar plate, while Staphylococcus aureus produced a distinct clear hemolysis zone. Figure 5 A) The test results showed that strain ZYS-3 did not produce hemolytic toxins, and it was preliminarily determined to be a safe strain.

[0056] Example 4: Drug resistance detection of strain ZYS-3

[0057] The fungal susceptibility test was performed using the DL-96 Fμngμs kit. Strain ZYS-3 was cultured on YPD plates for 24 hours. Several single colonies were picked and prepared into a 0.5 McFarland unit suspension. 100 μL of the fungal susceptibility solution was added to well H12 of the kit as a negative control. Then, 20 μL of the suspension was added to the fungal susceptibility solution, mixed thoroughly, and then added to each well of the kit, 100 μL per well. The kit was then incubated at 35°C for 48 hours. The positive control wells were then observed to see if they turned pink or purplish-red.

[0058] The results of the fungal susceptibility testing kit are shown in Table 2. Nine commonly used antifungal drugs were selected for resistance testing: amphotericin B, flucytosine, micafungin, caspofungin, fluconazole, isaconazole, voriconazole, posaconazole, and itraconazole. The screened strain ZYS-3 was sensitive (S) to all nine drugs and did not exhibit resistance. Therefore, strain ZYS-3 is safe in terms of drug resistance.

[0059] Table 2 Results of Antimicrobial Susceptibility Testing of Strains

[0060]

[0061] Example 5: Exploration of the optimal culture conditions for the fermentation process of strain ZYS-3

[0062] 1. Inoculate 1% (v / v) of bacterial culture of strain ZYS-3 into 5 mL of YPD medium and incubate at 20℃, 25℃, 30℃, 35℃, 40℃, and 45℃ on a shaker at 220 rpm for 24 h. Take 1 mL of the bacterial culture sample and measure its OD value using a UV spectrophotometer. 600 Values, with time as the x-axis, OD 600 Values ​​are plotted on the ordinate, showing temperature versus OD. 600 The relationship curve was used to determine the optimal temperature for strain ZYS-3.

[0063] like Figure 6 As shown in Figure A, strain ZYS-3 exhibits strong stability in growth and reproduction within a temperature range of 20℃ to 40℃, with minimal differences in growth activity under different temperature conditions. However, when the temperature is further increased to above 40℃, the OD... 600The significant decrease indicates that high temperatures significantly inhibited its growth and reproduction. Therefore, the optimal growth temperature for strain ZYS-3 is around 30℃.

[0064] 2. Inoculate 1% (v / v) of bacterial suspension ZYS-3 into 5 mL of YPD medium. Adjust the pH of the medium beforehand with hydrochloric acid or sodium hydroxide to 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0. Incubate at the optimal temperature obtained in the above experiment using a shaker at 220 rpm for 24 h. Take 1 mL of the bacterial suspension sample and measure its OD using a UV spectrophotometer. 600 Values, with time as the x-axis, OD 600 Plot pH and OD on the ordinate. 600 The relationship curve was used to determine the optimal pH value for strain ZYS-3.

[0065] like Figure 6 As shown in Figure B, under optimal conditions of 30℃, the strain exhibits OD values ​​between pH 4 and 10. 600 The values ​​were all within a relatively high range (2.201-2.637): among them, the OD of strain ZYS-3 was highest at pH 5. 600 The highest value was 2.637, indicating that the optimal pH for growth is 5.

[0066] 3. Inoculate 1% (v / v) of bacterial culture of strain ZYS-3 into 100 mL of YPD medium and incubate at 30 °C and 220 r / min on a shaker for 24 h. Take 1 mL of bacterial culture sample every three hours and measure its OD using a UV spectrophotometer. 600 Values, with time as the x-axis, OD 600 The values ​​are plotted on the ordinate to create the growth curve of strain ZYS-3.

[0067] like Figure 6 As shown in Figure C, the growth curve of strain ZYS-3 indicates that under the optimal temperature of 30℃ and pH of 5, strain ZYS-3 is in a lag phase within 0-3h, enters a vigorous logarithmic growth phase from 3-9h, and enters a stationary phase within 9-24h as the growth of the strain slows down.

[0068] Example 6: Optimization of substrate formulation for cottonseed meal solid-state fermentation

[0069] By adding gossypol to cottonseed meal to simulate the solid-state fermentation process for removing gossypol, the degradation rate of gossypol by strain ZYS-3 under different conditions was detected.

[0070] 1. Based on the optimal temperature of strain ZYS-3 being 30℃, 50g of cottonseed meal was placed in a fermentation bag with 40% moisture, 6% inoculum, and 10% added fermentation substrate for solid-state fermentation. Solid-state fermentation samples were collected at 24h, 48h, 72h, 96h, and 120h of fermentation to determine the gossypol degradation rate. A curve was plotted with fermentation time as the x-axis and gossypol degradation rate as the y-axis to determine the optimal fermentation time of cottonseed meal.

[0071] like Figure 7 As shown in Figure A, the gossypol content in cottonseed meal gradually decreases with increasing fermentation time. However, compared to cottonseed meal fermented for 96 hours and 120 hours, cottonseed meal fermented for 72 hours has a strong yeast aroma, no off-odor, and moderate material viscosity. Furthermore, the gossypol degradation rate is not significantly different between 72 hours and 120 hours. Considering palatability and fermentation efficiency, 72 hours is selected as the optimal fermentation time.

[0072] 2. After determining the optimal fermentation time, 50g of cottonseed meal was placed in a fermentation bag, and glucose, corn flour, starch, and sucrose were added at a ratio of 10% respectively as external carbon sources for solid-state fermentation. After fermentation, solid-state fermentation samples were taken, and the gossypol degradation rate was measured. The fermentation effects under different carbon sources were compared, with the gossypol degradation rate and viable cell count as the ordinates, to determine the optimal carbon source for the strain's fermentation.

[0073] like Figure 7 As shown in Figure B, the degradation rates of glucose, sucrose, starch, and corn flour as carbon sources were 75.64%, 75.14%, 71.24%, and 73.57%, respectively. After 3 days of fermentation, the viable bacterial counts in the four carbon sources—glucose, sucrose, starch, and corn flour—were 8.35 × 10⁻⁶. 8 CFU / g, 7.67×10 8 CFU / g, 6.2×10 8 CFU / g, 7.75×10 8 The small difference in CFU / g may be due to the fact that cottonseed meal itself contains a certain amount of sugars, proteins, and amino acids, which means that the added carbon source has little impact on its growth. However, it has advantages in the degradation rate of the fermentation substrate and the number of viable bacteria. Considering cost factors, corn flour was chosen as the external carbon source.

[0074] 3. After determining the optimal fermentation time and the most suitable carbon source, 50g of cottonseed meal was placed into a fermentation bag, and water was added at moisture contents of 40%, 45%, 50%, 55%, and 60% respectively for solid-state fermentation. After fermentation, samples were taken and the gossypol degradation rate was measured. A curve was plotted with moisture content as the abscissa and gossypol content and degradation rate as the ordinate to determine the optimal moisture content for cottonseed meal fermentation.

[0075] As the moisture content of the material increases, the efficiency of the strain in degrading gossypol gradually improves. However, excessively high moisture content can easily lead to cottonseed meal clumping, affecting oxygen transfer within the material and thus the strain's efficiency in degrading gossypol. Insufficient moisture content, on the other hand, results in slow cell growth and limited reproduction. Therefore, a moisture content of 55% was chosen as the optimal moisture content. Figure 7 C).

[0076] 4. After determining the optimal fermentation time, the most suitable carbon source, and the optimal moisture content, 50g of cottonseed meal was placed into a fermentation bag and inoculated with bacterial solution at proportions of 2%, 4%, 6%, 8%, and 10% for solid-state fermentation. After fermentation, samples were taken and the gossypol degradation rate was measured. The relationship curve between inoculation amount and gossypol degradation rate was plotted with inoculation amount as the abscissa and gossypol content and gossypol degradation rate as the ordinate to determine the optimal inoculation amount for cottonseed meal fermentation.

[0077] As the inoculum size increases, the degradation efficiency of gossypol also increases, reaching a maximum of 89.77% at an inoculum size of 10%. Figure 7 D).

[0078] Example 7: Determination of intracellular and extracellular localization and species of active components in the degradation of gossypol by strain ZYS-3

[0079] The bacterial suspension of strain ZYS-3 was inoculated at a volume fraction of 1% into YPD medium containing 600 μg / mL gossypol and cultured on a shaker at 30℃ and 220 rpm for 9 days until all gossypol was degraded. Four aliquots of the bacterial suspension were then centrifuged at 5000 rpm for 10 min to prepare samples. For the first sample, the supernatant was filtered through a 0.22 μm aqueous filter membrane. For the second sample, the supernatant was filtered through a 0.22 μm aqueous filter membrane and then sterilized in an autoclave at 121℃ for 20 min. The third... For the first sample, the supernatant was discarded, the bacterial precipitate was retained, and it was resuspended in sterile water. The precipitate was then sterilized in a high-pressure steam autoclave at 121°C for 20 min for later use. For the fourth sample, the bacterial precipitate was ultrasonically disrupted and centrifuged at 12000 r / min for 30 min. The supernatant of the disrupted bacterial precipitate was filtered through a 0.22 μm filter membrane for later use. 600 μg / mL of gossypol was added to the above samples, and after incubation for 24 h, the residual amount of gossypol (peak area) was detected. The degradation rate of gossypol was calculated using YPD medium without the addition of ZYS-3 strain as a control.

[0080] Based on the highest degradation rate measured in the above experiments, two additional sets of experiments were designed. For the first sample: a ZYS-3 bacterial culture without gossypol induction was prepared to test whether it could produce the corresponding gossypol-degrading substances without gossypol induction. For the second sample: proteinase K (1 mg / mL) was added to disrupt the protein, to test whether protein substances played a role in degrading gossypol. Both samples were incubated with gossypol (600 μg / mL) for 24 hours, and the gossypol content was measured.

[0081] Degradation rate results are as follows Figure 8 As shown, the degradation effects of intracellular and extracellular components of strain ZYS-3 on gossypol differed significantly. The cell-free supernatant exhibited the highest gossypol degradation efficiency at 50.26%, while the intracellular components showed a degradation efficiency of only 5.4%, indicating that the active substances for degrading gossypol are primarily located extracellularly. Furthermore, the degradation rates of gossypol by inactivated cell precipitate and inactivated cell supernatant were 40.92% and 18.99%, respectively. The inactivated cell precipitate showed a certain degree of physical adsorption of gossypol; the increased cell wall porosity after heat treatment allowed for the strong adsorption of free gossypol. The significant decrease in the gossypol degradation rate by the inactivated cell supernatant confirms that this extracellular active component is heat-sensitive and may be a protein.

[0082] The treatment group also showed that the degradation rate of the supernatant decreased to 27.55% after the addition of proteinase K. This suggests that a certain protein enzyme exists in the cell-free supernatant of strain ZYS-3 that degrades gossypol, and proteinase K disrupts the structure of this enzyme, leading to a decrease in enzyme activity. Furthermore, even without gossypol induction, the cell-free supernatant of strain ZYS-3 still showed a 44.89% degradation rate of gossypol, suggesting that this strain can produce a (partial) gossypol-degrading enzyme without gossypol induction, exhibiting naturally occurring gossypol-degrading properties.

[0083] Example 8: Analysis of intermediate products of gossypol degradation by strain ZYS-3

[0084] Using the supernatant of strain ZYS-3 as the control group, the supernatant of the strain after incubation with gossypol for 24 hours was used as the experimental group. 600 μL of fermentation broth was mixed with 600 μL of acetonitrile and filtered through a 0.22 μm organic phase filter membrane. The degradation intermediates were detected by LC-MS.

[0085] The LC gradient elution program was set as follows: 5 min acetonitrile: 0.1% formic acid = 50:50; 8 min: acetonitrile ratio linearly increased from 50% to 100%, and 0.1% formic acid ratio correspondingly decreased from 50% to 0%; 12 min acetonitrile: 0.1% formic acid = 100:0; 15 min: acetonitrile ratio linearly decreased from 100% to 5%, and 0.1% formic acid ratio correspondingly increased from 0% to 95%. Column temperature was 40℃, detection wavelength was 375nm, flow rate was 0.4mL / min, and injection volume was 5μL. The MS program was set to electrospray ionization, negative ion mode; scan mass range: 1000m / z; fragmenter voltage: 200V; other conditions were set to default.

[0086] EIC (Extractable Ion Chromatography) is a graph of the ionic intensity of a specific mass (or mass-to-charge ratio) against time. It is used to identify characteristic ions and is one of the most useful methods in LC-MS analysis for complex mixtures and trace analysis. In this example, the initial content of gossypol added during fermentation was low, and the intermediate degradation products of gossypol, due to their unstable nature and lack of accumulation, had even lower content, resulting in no obvious peaks on the LC-MS total ion chromatogram (TIC). Therefore, based on the molecular weight information obtained through comparative retrieval, the corresponding mass-to-charge ratio was input, and the EIC ion chromatogram was observed.

[0087] Comparing the chromatograms of gossypol standard and the supernatant of the strain without gossypol, it can be seen that the substances eluting before 3 min are likely culture medium components, while the substance with a retention time of around 11.7 min is m / z 517 gossypol. Therefore, the substances eluting between 3 and 10 min in the experimental group are likely products of gossypol degradation. Additionally, some products, due to their similar structure or functional groups to gossypol, have similar retention times and were therefore not distinguished from the gossypol peak in the EIC extraction ion chromatogram.

[0088] Based on the identification results of the above intermediate products, it is preliminarily speculated that strain ZYS-3 produces extracellular enzymes to degrade gossypol. Two pathways of gossypol degradation were identified by LC-MS spectroscopy under the mediation of extracellular enzymes.

[0089] Option 1: Figure 9 The pathway of gossypol binding to lysine was revealed. The ε-amino group of lysine readily binds to the phenolic hydroxyl group of gossypol, undergoing a browning reaction to form conjugated gossypol. The specific metabolic process is as follows: Gossypol first loses an aldehyde group, while the tertiary group at the para-position of the aldehyde group is progressively hydrolyzed; subsequently, a phenolic hydroxyl group on the benzene ring of gossypol binds to a lysine molecule, forming a compound with m / z 561; finally, the tertiary group at the para-position of the aldehyde group is completely hydrolyzed, forming a compound with m / z 533.

[0090] Approach Two: Figure 10 The elimination, oxidation, and ring-opening pathways of the active group in gossypol were revealed. This pathway comprises two branches:

[0091] Branch 1: The aldehyde group corresponding to the tertiary group of gossypol is first eliminated, and then hydroxyl addition generates products m / z 477 and m / z 493. The introduction of the hydroxyl group increases the electron cloud density of the naphthalene ring, promoting the quinone reaction and oxidizing the phenolic hydroxyl group of gossypol to a para-quinone structure, generating product m / z 507. During subsequent degradation, the benzene ring of gossypol undergoes ring-opening and reacts with ammonium ions in the environment, ultimately generating product m / z 506.

[0092] Branch 2: Based on the elimination and quinolation reactions of the active phenolic hydroxyl group, the phenolic hydroxyl group is replaced by an amino group, generating product m / z 458; finally, the benzene ring opens, also generating product m / z 506. The introduction of the hydroxyl group increases the electron cloud density of the naphthalene ring, promoting the quinolation reaction, oxidizing the phenolic hydroxyl group of gossypol to a para-quinone structure, generating product m / z 507. During subsequent degradation, the benzene ring of gossypol opens and reacts with ammonium ions in the environment, ultimately generating product m / z 506.

[0093] In summary, the principle of efficient degradation of gossypol by strain ZYS-3 is the production of extracellular enzymes to degrade gossypol. Under the mediation of extracellular enzymes, two metabolic pathways of gossypol were determined by LC-MS: one is the lysine binding pathway, and the other is the elimination, oxidation and naphthalene ring opening pathway of active groups (phenolic hydroxyl group, aldehyde group).

[0094] The composition and content of the culture medium in the examples are as follows:

[0095] Liquid culture medium for gossypol-degrading bacteria: 5g glycerol, 2g cottonseed meal, 0.5g KH2PO4, 1g (NH4)2SO4, 0.5g yeast extract, 1000mL sterile water.

[0096] YPD liquid culture medium: 20g glucose, 20g peptone, 10g yeast extract, 1000mL sterile water.

[0097] YPD solid medium: YPD liquid medium with 2% agar added.

[0098] GAMM liquid medium: Gossypol 0.6g, NaCl 1.0g, (NH4+) 4）2 SO4 5.0g, MgSO4·7H2O 0.5g, KH2PO4 1.0g, agar 25g, sterile water 1000mL.

[0099] GAMM solid medium: 2% agar added to GAMM liquid medium.

[0100] Columbia blood agar medium: 40.0g Columbia blood agar powder, 5g sodium chloride, 1000mL sterile water.

[0101] Application Example 1: Application of Yeast Strain ZYS-3

[0102] First, the fermentation substrate was determined according to Example 6, wherein the fermentation substrate was cottonseed meal, the added carbon source was corn flour, and the amount of corn flour added was 10 wt% of cottonseed meal. In order to improve the fermentation effect, gossypol adsorbent was also added, and the amount of gossypol adsorbent added was 10 wt% of cottonseed meal.

[0103] The application of yeast strain ZYS-3 in non-toxic cottonseed meal feed additives is as follows:

[0104] Mix 50 kg of cottonseed meal and 5 kg of gossypol adsorbent evenly, then add 5 kg of corn flour and mix evenly. Add water to adjust the humidity of the fermentation substrate to 55%, adjust the pH value to 5, let it stand in the fermentation tank for 30 minutes, and then inoculate yeast strain ZYS-3 at a 10% inoculation rate. Ferment at 30℃ for 3 days to obtain a non-toxic cottonseed meal feed additive.

[0105] The gossypol adsorbent is prepared through the following steps:

[0106] S1: Add 25g of biomass porous char, 450mL of anhydrous ethanol and 80mL of deionized water to a reaction vessel, stir for 12min at 60℃ and 600r / min, then add 12mL of 3-(2,3-epoxypropoxy)propyltrimethoxysilane, adjust the pH to 4 with hydrochloric acid solution, continue stirring for 5-6h, filter, wash the precipitate three times with deionized water and anhydrous ethanol respectively, and dry it under vacuum at 80℃ to constant weight to obtain epoxidized porous char.

[0107] Among them, the biomass porous char was purchased from Liyang Desheng Activated Carbon Factory, with a particle size of 4mm, and was made from rice straw pyrolysis at 500℃.

[0108] S2: Add 22g of epoxidized porous carbon, 45g of lysine and 170mL of DMF to the reaction vessel, stir for 12min at 60℃ and 600r / min, then heat to 90℃ and stir for 12h. Filter, wash the precipitate three times with deionized water and anhydrous ethanol respectively, and dry it under vacuum at 80℃ to constant weight to obtain the gossypol adsorbent.

[0109] Comparative Example 1: Based on Application Example 1, lysine in step S2 was omitted, and epoxidized porous carbon in step S1 was used directly as the gossypol adsorbent.

[0110] Comparative Example 2: Based on Application Example 1, the epoxidized porous carbon in step S2 was replaced with the raw biomass porous carbon in step S1, while the other steps remained unchanged. The prepared product was used as a gossypol adsorbent.

[0111] Comparative Example 3: Based on Application Example 1, the epoxidized porous carbon prepared in step S2 was discarded, and lysine raw material was directly used as the gossypol adsorbent.

[0112] The gossypol adsorbents prepared in Comparative Examples 1-3 were used to prepare cottonseed meal feed additives according to the method in Application Example 1, and were labeled as Comparative Example 1, Comparative Example 2 and Comparative Example 3, respectively.

[0113] The performance of the non-toxic cottonseed meal feed additives prepared in Comparative Examples 1-3 and Application Example 1 was tested. The feed was prepared by mixing 57% corn, 20% barley, 2% wheat bran, 4% brown rice, 1% soybean oil and 16% non-toxic cottonseed meal feed additives by mass percentage.

[0114] 1. Referring to the standard GB 13086-2022 "Determination of Free Gossypol in Feed", the detoxification rate of free gossypol was determined using ULtimate3000 high-performance liquid chromatography and UV-4802 ultraviolet-visible spectrophotometer. The results are shown in Table 3.

[0115] Table 3. Results of Gossypol Detoxification Rate Test

[0116]

[0117] 2. Forty healthy pigs with an initial weight of approximately 84 kg were selected and raised in a closed pigsty with a cement floor and good ventilation. They had free access to feed and water. The pigpens were cleaned regularly each day, and suitable lighting and temperature were maintained. The pigs' feed intake, feces, and health status were observed daily. Other feeding and management followed the standard pig farm management system. The experiment lasted for 28 days. At the beginning and end of the experiment, the pigs were weighed on an empty stomach, and the feed consumption of each replicate (pen) was recorded. The average daily weight gain, average daily feed intake, and feed conversion ratio were calculated. The results are shown in Table 4.

[0118] Table 4. Growth Results of Pigs After Feed Intake

[0119]

[0120] Free gossypol contains active aldehyde and hydroxyl groups. When it combines with enzymes and proteins, it makes proteins difficult to digest and can damage the gastric mucosa tissue of the digestive tract, thus reducing the animal's digestive capacity, leading to decreased appetite and weight loss. It can also increase the permeability of the body's blood vessel walls, damage the animal's heart, liver, kidneys and other organs, and affect the animal's reproductive function, thus reducing its reproductive performance.

[0121] As shown in Table 3, the non-toxic cottonseed meal feed additives prepared in Examples 1-3 can significantly reduce the content of free gossypol and have a high detoxification rate in cottonseed meal. As shown in Table 4, the non-toxic cottonseed meal feed additives can significantly promote the growth of pigs when applied to feed.

[0122] In Comparative Example 1, after lysine was removed, only the physical adsorption of epoxidized porous carbon remained. Free gossypol could not form a complex state, which may inhibit the growth of the strain, leading to incomplete fermentation and reduced gossypol degradation. In addition, it is also easy to react with some of the amino acids produced during fermentation, which in turn leads to a decrease in the nutritional content of the feed.

[0123] In Comparative Example 2, the epoxidized porous carbon was replaced with the biomass porous carbon from step S1. Lysine could not be fixed on the surface of the porous carbon through the epoxy groups. The adsorbed lysine would be removed during the subsequent washing process, and the resulting product could not effectively complex free gossypol.

[0124] In Comparative Example 3, the prepared epoxidized porous carbon was discarded. The exogenously added lysine was lost as the moisture content decreased during the humidification process of the fermentation substrate, and could not fully combine with free gossypol, resulting in a decrease in the detoxification rate.

[0125] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the invention.

Claims

1. Application of a yeast strain ZYS-3 with high gossypol degradation efficiency in feed additives, characterized in that, The specific application method is as follows: The cottonseed meal and the gossypol adsorbent are stirred uniformly, then the additional carbon source is added and stirred uniformly, water is added to adjust the moisture content to 50-60%, the pH value is adjusted to 4-6, after standing for 20-40 min, the yeast strain ZYS-3 is inoculated, and fermentation is carried out at 30℃ for 3 days, to obtain the non-toxic cottonseed meal feed additive; The yeast strain ZYS-3 is Meyerozyma guilielmondi (formerly known as Williopsis saturnus) Meyerozyma guilliermondii , and is preserved in the China Center for Type Culture Collection with a preservation number of CCTCCM20251701. The gossypol adsorbent is prepared by the following steps: the epoxidized porous carbon, lysine and DMF are added into a reaction kettle, stirring is carried out at 50-60℃ and 500-600 r / min for 10-12 min, stirring reaction is carried out at 80-90℃ for 10-12 h, the precipitate is washed and vacuum dried to constant weight, to obtain the gossypol adsorbent. The epoxidized porous carbon is prepared by the following steps: the biomass porous carbon, anhydrous ethanol and deionized water are added into a reaction kettle, stirring is carried out at 50-60℃ and 500-600 r / min for 10-12 min, 3-(2,3-epoxypropoxy) propyl trimethoxysilane is added, the pH value is adjusted to 3-4 with hydrochloric acid solution, stirring reaction is carried out for 5-6 h, the precipitate is washed and dried to constant weight, to obtain the epoxidized porous carbon.

2. Use according to claim 1, characterized in that, The mass ratio of the cottonseed meal, the gossypol adsorbent and the additional carbon source is 20:1-3:

2.

3. Use according to claim 1, characterized in that, The additional carbon source is any one or more of corn powder, glucose, sucrose and starch mixed in any mass ratio.

4. Use according to claim 1, characterized in that, The use amount ratio of the epoxidized porous carbon, lysine and DMF is 20-22 g:40-45 g:150-170 mL.

5. The use according to claim 1, characterized in that, The use amount ratio of the biomass porous carbon, anhydrous ethanol, deionized water and 3-(2,3-epoxypropoxy) propyl trimethoxysilane is 20-25 g:40-50 mL:70-80 mL:10-12 mL.

Images