Ackermann muciniphile, combined microbial agent thereof and application of ackermann muciniphile in inflammatory enteritis

Abstract

The invention relates to the technical field of microorganisms, and discloses Ackermann muciniphila, a combined microbial agent thereof and application of the Ackermann muciniphila in inflammatory enteritis. The invention provides Akkermansia muciniphila AIML-559, and the preservation number of the Akkermansia muciniphila AIML-559 is CGMCC (China General Microbiological Culture Collection Center) No. 34246. The invention relates to a combined microbial agent, which is characterized by comprising Ackermann muciniphila AIML-559 and Bifidobacterium adolescentis AIML-528 (the preservation number is CGMCC (China General Microbiological Culture Collection Center) No.34300). The combined microbial agent is prepared from the following raw materials: Ackermann muciniphila AIML-559 and Bifidobacterium adolescentis AIML-528 The ackermann mucophil combined microbial inoculum is suitable for treatment intervention of inflammatory bowel disease (IBD), and can relieve weight loss, hemolysis, anemia, diarrhea, intestinal bleeding and other symptoms of IBD mice.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, and particularly relates to Akkermansia muciniphila and a combined bacterial agent thereof and application in inflammatory bowel disease. BACKGROUND

[0002] Intestinal flora refers to a microbial community living in the human intestinal tract, mainly including bacteria, archaea, fungi, viruses and other microorganisms, among which bacteria are the main component of intestinal flora, about 1000 species. Intestinal flora includes Firmicutes, Bacteroidetes, Actinobacteria, Verrucomicrobia, Fusobacteria and Proteobacteria. Among them, Firmicutes and Bacteroidetes are two major phyla. Intestinal flora can maintain the immune balance of the intestinal tract by regulating the immune system, prevent excessive inflammatory response; maintain intestinal homeostasis by maintaining intestinal barrier function to prevent the invasion of pathogens and harmful substances. Existing studies have shown that many diseases are related to intestinal microbial imbalance, and the decrease of intestinal flora diversity or the change of the abundance of certain specific flora may cause inflammatory bowel disease (IBD), irritable bowel syndrome (IBS), obesity and metabolic diseases.

[0003] Inflammatory bowel disease (IBD) includes ulcerative colitis (UC) and Crohn's disease (CD), which is a chronic, recurrent, inflammatory intestinal disease. Its symptoms, complications and frequent medical examinations have a serious impact on the physiology, psychology and quality of life of patients. Environmental, inflammatory, genetic and other factors can cause IBD, and studies have confirmed that intestinal flora imbalance is closely related to the pathogenesis of IBD, and IBD is characterized by a decrease in the number of beneficial bacteria (such as Faecalibacterium prausnitzii) and an increase in the number of harmful bacteria (such as Enterobacteriaceae bacteria), and a decrease in flora diversity. Intestinal flora imbalance promotes the occurrence and development of IBD by damaging the intestinal mucosal barrier and inducing abnormal activation of the immune system. Intestinal flora imbalance destroys the integrity of the intestinal mucosal barrier, increases intestinal permeability, and makes it easier for pathogens and harmful substances to enter the blood circulation, triggering an inflammatory response. At the same time, the increase in the abundance of certain harmful bacteria can induce abnormal activation of immune cells, aggravating IBD.

[0004] The drug therapy of IBD mainly includes aminosalicylates, glucocorticoids, immunosuppressants and biological agents, but long-term use may increase the risk of infection, cause side effects such as osteoporosis, hypertension and diabetes. Emerging therapies such as fecal microbiota transplantation and stem cell therapy have not been widely used in clinical practice. Due to the limitations of existing treatment methods, there is an urgent need for new treatment strategies, and existing research has gradually focused on probiotics, so it is necessary to develop probiotics with anti-inflammatory effects, improved intestinal health and relief of inflammatory bowel disease to improve the symptoms of IBD patients, prevent disease progression, reduce the occurrence of complications and improve the quality of life of IBD patients. Ordinary probiotics have limited therapeutic effect on IBD, and ideal intervention strategies need to have multiple effects such as anti-inflammatory, improved intestinal microecology, relief of disease symptoms and improved quality of life of patients. Therefore, exploring probiotic combinations with synergistic effects can provide new ideas for the development of IBD-related foods, drugs or health products. SUMMARY

[0005] Therefore, the present application provides a mucinophilic Akkermansia and its combined bacterial agent and application in inflammatory bowel disease. The combined bacterial agent comprises Akkermansia muciniphila AIML-528 and Bifidobacterium adolescentis AIML-559, and can be used for the treatment and intervention of inflammatory bowel disease (IBD), and has the effects of relieving the clinical symptoms of patients, delaying the progression of the disease, and improving the overall quality of life of IBD patients.

[0006] The technical solutions provided by the present application are as follows:

[0007] The embodiments disclosed in the present application relate to a mucinophilic Akkermansia, which is any one of the following (1)-(3):

[0008] (1) a strain with at least 85%, 90%, 95%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identity to the sequence shown in SEQ ID NO: 1;

[0009] (2) Akkermansia muciniphila preserved in China General Microbiological Culture Collection Center, with a preservation number of CGMCC No. 34246;

[0010] (3) a strain whose 16S rRNA is at least 85%, 90%, 95%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% identical to the 16S rRNA of the strain described in (2).

[0011] The Akkermansia muciniphila AIML-528 has been deposited with the China General Microbiological Culture Collection Center (CGMCC) on April 17, 2025, at the address of No. 1, Xibaixili, Chaoyang District, Beijing, with the accession number of CGMCC NO. 34246.

[0012] The embodiments disclosed in the present application relate to a Bifidobacterium adolescentis, which is any one of the following (1) to (3):

[0013] (1) a strain whose 16S rRNA is at least 85%, 90%, 95%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% identical to the sequence shown in SEQ ID NO: 2

[0014] (2) a Bifidobacterium adolescentis deposited with the China General Microbiological Culture Collection Center (CGMCC), with the accession number of CGMCC No. 34300;

[0015] (3) a strain whose 16S rRNA is at least 85%, 90%, 95%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% identical to the 16S rRNA of the strain described in (2).

[0016] The Bifidobacterium adolescentis AIML-559 has been deposited with the China General Microbiological Culture Collection Center (CGMCC) on April 22, 2025, at the address of No. 1, Xibaixili, Chaoyang District, Beijing, with the accession number of CGMCC NO. 34300.

[0017] The strains of Akkermansia muciniphila AIML-528 and Bifidobacterium adolescentis AIML-559 are subjected to sequencing analysis, and the sequencing sequences are subjected to sequence alignment in NCBI. The results show that AIML-528 is Akkermansia muciniphila, and AIML-559 is Bifidobacterium adolescentis.

[0018] The embodiments disclosed in the present application relate to a microbial agent, which comprises the aforementioned Akkermansia muciniphila AIML-528, or a bacterial suspension thereof, or a fermentation broth thereof, or a fermentation supernatant thereof, or inactivated bacteria and fragments thereof, or metabolites thereof, or a mixture of bacterial cells and filtrate thereof;

[0019] and / or the aforementioned Bifidobacterium adolescentis AIML-559, or a bacterial suspension thereof, or a fermentation broth thereof, or a fermentation supernatant thereof, or inactivated bacteria and fragments thereof, or metabolites thereof, or a mixture of bacterial cells and filtrate thereof.

[0020] The embodiments disclosed in the present application relate to a microbial agent, and the ratio of viable counts of Akkermansia muciniphila AIML-528 and Bifidobacterium adolescentis AIML-559 in the combined microbial agent is 1:10 to 10:1. For example, the ratio of viable counts includes but is not limited to any of 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, etc.

[0021] In the embodiments disclosed in the present application, the total viable count in the microbial agent is not less than 1×10 8 CFU / mL or 1×10 8 CFU / g. For example, the total viable count includes but is not limited to 1×10 8 CFU / mL (CFU / g), 1×10 9 CFU / mL (CFU / g), 5×10 9 CFU / mL (CFU / g), 1×10 10 CFU / mL (CFU / g), 5×10 10 CFU / mL (CFU / g), 1×10 11 CFU / mL (CFU / g), 1×10 12 CFU / mL (CFU / g), 1×10 13Any one of CFU / mL (CFU / g) or the like.

[0022] In the embodiments of the present application, a preparation method of a microbial agent is provided.

[0023] In the preparation method of the combined microbial agent, the mucinophilic Akkermansia and / or Bifidobacterium adolescentis are activated and cultured.

[0024] In the preparation method of the combined microbial agent, the mucinophilic Akkermansia and Bifidobacterium adolescentis are activated and cultured respectively, and then mixed according to the ratio of viable bacteria count.

[0025] In the embodiments of the present application, the preparation method of the microbial agent product is conventional in the art, for example, a freeze-dried preparation is prepared according to the process flow of activating the strain, preparing high-efficiency proliferation culture bacterial liquid, centrifuging to collect bacterial bodies, preparing bacterial suspension, adding freeze-drying protective agent, pre-freezing, and vacuum freeze-drying.

[0026] In the embodiments of the present application, the mucinophilic Akkermansia, the Bifidobacterium adolescentis, the microbial agent, and the microbial agent prepared by the preparation method of the microbial agent are used for preparing a product for relieving symptoms of inflammatory bowel disease or treating inflammatory bowel disease.

[0027] In some embodiments, the inflammatory bowel disease (IBD) includes ulcerative colitis (UC) or Crohn's disease (CD).

[0028] The symptoms of the inflammatory bowel disease are relieved, including at least one of the following:

[0029] (1) effectively relieving the weight loss of mice caused by inflammatory bowel disease;

[0030] (2) improving the disease signs and disease activity index score of mice with inflammatory bowel disease;

[0031] (3) relieving the diarrhea symptoms of mice with inflammatory bowel disease;

[0032] (4) delaying the intestinal bleeding symptoms of mice with inflammatory bowel disease;

[0033] (5) relieving the hemolysis and anemia symptoms of mice with inflammatory bowel disease.

[0034] In the embodiments of the present application, a product for relieving symptoms of IBD or treating IBD is provided.

[0035] In an embodiment of the present application, the product includes food, medicine, or health care products.

[0036] In an embodiment of the present application, the food product comprises fermented milk, lactic acid bacteria beverage, gummy, biscuit, solid beverage or lozenge;

[0037] In an embodiment of the present application, the pharmaceutical or health product further comprises a pharmaceutically acceptable carrier or excipient;

[0038] The dosage form of the pharmaceutical product comprises a lyophilized preparation or a liquid preparation;

[0039] The dosage form of the pharmaceutical product includes, but is not limited to, tablets, granules, capsules, pills, solutions, emulsions, suspensions, injections, aerosols, powder sprays, lotions, ointments, patches, eye drops, nose drops, gargle, sublingual tablets or suppositories;

[0040] Optionally, the freeze-drying protective agent used for preparing the freeze-dried bacterial powder and the excipient used for preparing other dosage forms are selected from any one or a combination of at least two of skimmed milk, gelatin, dextrin, resistant dextrin, gum arabic, sodium alginate, sucrose, lactose, trehalose, oligomeric lactose, oligomeric fructose, oligomeric maltose, sorbitol, xylitol, sodium carboxymethyl cellulose, microcrystalline cellulose, cysteine, carbomer, polyethylene glycol and vitamin C.

[0041] The technical scheme of the present application has the following advantages:

[0042] 1. The present application provides an Akkermansia muciniphila, which is any one of the following (1) to (3): (1) a strain having at least 85%, 90%, 95%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identity with the sequence shown in SEQ ID NO: 1; (2) Akkermansia muciniphila deposited in the China General Microbiological Culture Collection Center with the accession number CGMCC No. 34246; (3) a strain having at least 85%, 90%, 95%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identity with the 16S rRNA of the strain of (2). The present application researches and finds that the above-mentioned Akkermansia muciniphila has the effect of relieving the symptoms of inflammatory bowel disease or treating inflammatory bowel disease, and thus can be used for developing products for relieving the symptoms of inflammatory bowel disease or treating inflammatory bowel disease.

[0043] 2. The present application provides a Bifidobacterium adolescentis, which is any one of the following (1) to (3): (1) a strain having at least 85%, 90%, 95%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% identity to the sequence shown in SEQ ID NO: 2 of 16S rRNA; (2) Bifidobacterium adolescentis deposited in China General Microbiological Culture Collection Center with a deposit number of CGMCC No. 34300; (3) a strain having at least 85%, 90%, 95%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% identity to 16S rRNA of the strain of (2). The present application research finds that the above-mentioned A. muciniphila has the effect of relieving symptoms of inflammatory bowel disease or treating inflammatory bowel disease, and thus can be used for preparing a product for relieving symptoms of inflammatory bowel disease or treating inflammatory bowel disease.

[0044] 3. The present application provides a microbial agent, which comprises the A. muciniphila, or a bacterial suspension thereof, or a fermentation broth thereof, or a fermentation supernatant thereof, or inactivated bacteria and fragments thereof, or metabolites thereof, or a mixture of bacterial cells and filtrate thereof; and / or the Bifidobacterium adolescentis, or a bacterial suspension thereof, or a fermentation broth thereof, or a fermentation supernatant thereof, or inactivated bacteria and fragments thereof, or metabolites thereof, or a mixture of bacterial cells and filtrate thereof. The present application research finds that the A. muciniphila and the Bifidobacterium adolescentis have a significant synergistic effect, and compared with relieving symptoms of inflammatory bowel disease or treating inflammatory bowel disease alone, can significantly relieve symptoms of inflammatory bowel disease or treat inflammatory bowel disease in a synergistic manner, and thus can be used for preparing a product for relieving symptoms of inflammatory bowel disease or treating inflammatory bowel disease.

[0045] 4. The present application provides a microbial agent, which is a microbial agent containing the A. muciniphila and the Bifidobacterium adolescentis, and the ratio of viable counts of the A. muciniphila and the Bifidobacterium adolescentis is 1:10 to 10:1. The present application research finds that when the A. muciniphila and the Bifidobacterium adolescentis are used in combination, the synergistic effect of relieving symptoms of inflammatory bowel disease or treating inflammatory bowel disease of the two is more significant at the above-mentioned ratio of viable counts.

[0046] Biological preservation

[0047] The Akkermansia muciniphila AIML-528 strain of the present application is preserved in the China General Microbiological Culture Collection Center (CGMCC), located at No. 1, Beichen West Road, 3rd Courtyard, Chaoyang District, Beijing, on April 17, 2025, and has the preservation number CGMCC NO. 34246.

[0048] The Bifidobacterium adolescentis AIML-559 strain of the present application is preserved in the China General Microbiological Culture Collection Center (CGMCC), located at No. 1, Beichen West Road, 3rd Courtyard, Chaoyang District, Beijing, on April 22, 2025, and has the preservation number CGMCC NO. 34300. BRIEF DESCRIPTION OF DRAWINGS

[0049] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the drawings needed in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0050] Figure 1 is a colony morphology diagram of Akkermansia muciniphila AIML-528 in Example 1 of the present application;

[0051] Figure 2 is a growth curve diagram of Akkermansia muciniphila AIML-528 in Example 1 of the present application;

[0052] Figure 3 is a growth curve diagram of Bifidobacterium adolescentis AIML-559 in Example 2 of the present application;

[0053] Figure 4 is the body weight change of IBD mice after intervention by Akkermansia muciniphila combined bacterial agent in Example 4 of the present application;

[0054] Figure 5 is the disease activity index evaluation (A), stool character evaluation (B) and fecal bleeding evaluation (C) of IBD mice after intervention by Akkermansia muciniphila combined bacterial agent in Example 4 of the present application;

[0055] Figure 6 is the change of white blood cell count (A), neutrophil count (B), red blood cell count (C) and hemoglobin (D) of IBD mice after intervention by Akkermansia muciniphila combined bacterial agent in Example 4 of the present application

[0056] "*" indicates significant difference from the model group (*: p<0.05; **: p<0.01; ***: p<0.001). DETAILED DESCRIPTION

[0057] The following examples are provided to better further understand the present application and are not limited to the best mode contemplated, do not constitute limitations on the scope of the application and the protection range, and any product identical or similar to the present application obtained by anyone under the inspiration of the present application or by combining the present application with other prior art features falls within the protection scope of the present application.

[0058] The specific experimental steps or conditions not indicated in the examples can be performed according to the conventional experimental steps described in the literature in the art or the operation or conditions. The reagents or instruments not indicated by the manufacturer are conventional reagent products that can be obtained by purchase.

[0059] In the following examples, BHI and MRS were purchased from Qingdao Haibo Biotechnology Co., Ltd.; L-threonine, L-cysteine hydrochloride, vitamin K1, hemin, glycerol were purchased from Beijing Jianqiang Weiyede Technology Co., Ltd.; disodium hydrogen phosphate, potassium dihydrogen phosphate, sodium chloride, manganese sulfate monohydrate, sodium hydroxide, ammonium chloride were purchased from National Pharmaceutical Group Chemical Reagent Co., Ltd.; rumen fluid was purchased from Shanghai Bofeimaisike Chemical Technology Co., Ltd.; agar was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.; Tween-80 was purchased from Beijing Coupling Technology Co., Ltd.; cobalt chloride was purchased from Sanen Chemical Technology (Shanghai) Co., Ltd.; pig gastric mucin protein was purchased from Sigma-Aldrich; vancomycin was purchased from Beijing Luqiao Counting Co., Ltd.; mucinophilic Akkermansia muciniphila standard strain BSM22959 was purchased from Beina Biological Technology Co., Ltd.

[0060] Example 1: Screening, culture and identification of Akkermansia muciniphila AIML-528

[0061] I. Preparation of culture medium

[0062] 1. Preparation of isolation medium

[0063] (1) Medium composition: pig gastric mucin 1 g, disodium hydrogen phosphate 0.53 g, potassium dihydrogen phosphate 0.4 g, sodium chloride 2 g, ammonium chloride 0.3 g, L-threonine 4 g, L-cysteine hydrochloride 1 g, manganese sulfate monohydrate 4 mL, cobalt chloride 400 μL, Tween-80 1 mL, agar 15 g, hemin 20 mL, vitamin K1 400 μL, vancomycin 10 mL, rumen fluid 10 mL.

[0064] (2) Accurately weigh / transfer the above reagents (except vitamin K1, hemin, vancomycin) into the reagent bottle, add 1 L of purified water, and stir until dissolved.

[0065] (3) Adjust the pH to 7.0-7.2 using 0.1 mol / L NaOH solution.

[0066] (4) Weigh 7.5 g of agar into a 1000 mL conical flask, and add 484.8 mL of the solution prepared in step (1) except for hemin, vitamin K1, and vancomycin.

[0067] (5) High-pressure sterilization at 118°C for 15 min. When the medium temperature cools to about 50°C, add the corresponding amount of vitamin K1, hemin, and vancomycin, mix well, pour the medium into disposable petri dishes, each with a volume of 15-20 mL, and after the medium solidifies, invert and seal in a self-sealing bag.

[0068] (6) Store at 4°C, and use within 4 weeks.

[0069] 2. Preparation of enrichment medium

[0070] (1) Accurately weigh / transfer BHI 38.0 g, L-threonine 4.0 g, manganese sulfate 0.04 g, L-cysteine 0.5 g, and cobalt chloride 0.04 g into a 1000 mL conical flask, add 979.6 mL of purified water, stir until dissolved, and high-pressure sterilize at 121°C for 15 min.

[0071] (2) When the medium temperature cools to about 50°C, add hemin (0.5 mg / mL) 20.0 mL and vitamin K1 (0.5%, v / v) 400 μL.

[0072] II. Isolation and culture of strains

[0073] 1. Treatment and preservation of fecal samples

[0074] (1) Use a sterile spoon to transfer the feces into a beaker and weigh it in a biological safety cabinet.

[0075] (2) Add diluent (0.9% sodium chloride aqueous solution containing 0.05% L-cysteine hydrochloride) at a ratio of 1:2 (w / v).

[0076] (3) Use a magnetic stirrer to thoroughly stir and prepare a uniform fecal solution, and filter with sterile gauze. After filtration, add sterile glycerol at a ratio of 1:1 (v / v) of filtered fecal solution to glycerol.

[0077] (4) Mix using a vortex mixer, and aliquot 2-3 mL each into 15 mL centrifuge tubes, with at least 10 aliquots of samples.

[0078] (5) Sample tube mark the fecal sample number, processing date and experimenter's name, and seal in -80℃.

[0079] (6) Fill in the fecal sample storage information table.

[0080] 2. Thawing and enrichment culture of fecal sample

[0081] (1) Take one fecal sample.

[0082] (2) Thaw quickly in 37℃ water bath.

[0083] (3) Add 10 mL enrichment medium to resuspend, and use the enrichment medium to make 9 gradient dilutions with 10 times ratio.

[0084] (4) Take 10-100 μL of the required dilution gradient of bacterial liquid, and streak or spread inoculate into 3-5 different isolation medium plates.

[0085] (5) Perform isolation culture according to the culture conditions of the target strain, and observe the growth.

[0086] (6) After completion of culture, seal the culture plates and store in 4℃.

[0087] III. Strain proliferation, preservation and identification

[0088] (1) Pick single colonies from each isolation medium, and take photos.

[0089] (2) Inoculate the single colonies into 5 mL enrichment medium, perform proliferation culture according to the culture conditions of the target strain, and observe the growth.

[0090] (3) After completion of proliferation culture, take 1 mL of bacterial liquid into a 1.5 mL centrifuge tube and store in 4℃ for sequencing identification.

[0091] (4) Add sterile glycerol into the remaining 4 mL of bacterial liquid, and the final concentration of glycerol is 30%-50%. Mix thoroughly and seal in 4℃ for temporary storage.

[0092] (5) After completion of strain identification, divide the bacterial liquid of the target strain into 2 mL cryogenic tubes, 1 mL per tube, and store in -80℃ refrigerator or liquid nitrogen.

[0093] IV. 16S rRNA sequencing and identification of mucinophilic Akkermansia bacteria AIML-528 strain

[0094] The preserved strain is sent to Beijing Ruibo Xingke Biotechnology Co., Ltd. for strain identification, and the steps are: genomic DNA extraction-16S rRNA amplification-PCR product detection and purification-sequence and result comparison. The gene amplification can see a single clear band, and through BLAST homologous comparison, the similarity with other strain sequences is:

[0095] (1) Akkermansia muciniphila (NR074436.1) 100.000%

[0096] (2) Akkermansia muciniphila (NR042817.1) 99.857%.

[0097] The final annotation result is Akkermansia muciniphila (NR074436.1) 100.000%, which is Akkermansia muciniphila, and the internal number is AIML-528.

[0098] The strain 16s rRNA sequence is:

[0099] >16S-L2-13.32413981

[0100] AGTCGAACGAGAGAATTGCTAGCTTGCTAATAATTCTCTAGTGGCGC

[0101] ACGGGTGAGTAACACGTGAGTAACCTGCCCCCGAGAGCGGGATAGC

[0102] CCTGGGAAACTGGGATTAATACCGCATAGTATCGAAAGATTAAAGCA

[0103] GCAATGCGCTTGGGGATGGGCTCGCGGCCTATTAGTTAGTTGGTGAG

[0104] GTAACGGCTCACCAAGGCGATGACGGGTAGCCGGTCTGAGAGGATG

[0105] TCCGGCCACACTGGAACTGAGACACGGTCCAGACACCTACGGGTGGC

[0106] AGCAGTCGAGAATCATTCACAATGGGGGAAACCCTGATGGTGCGAC

[0107] GGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAA

[0108] GGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAA

[0109] GGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAA

[0110] GGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAA

[0111] GGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAA

[0112] GGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAA

[0113] GGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAA

[0114] GGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAA

[0115] GGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAA

[0116] GGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAA

[0117] GGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAA

[0118] GGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAA

[0119] GGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAA

[0120] GGGAGCAAATTAAAAAGATAGTACCACAAGAGGAAGAGACGGCTAA

[0121] TCGTGTCGTGAGATGTTTGGTTAAGTCCAGCAACGAGCGCAACCCCT

[0122] GTTGCCAGTTACCAGCACGTGAAGGTGGGGACTCTGGCGAGACTGCC

[0123] CAGATCAACTGGGAGGAAGGTGGGGACGACGTCAGGTCAGTATGGC

[0124] CCTTATGCCCAGGGCTGCACACGTACTACAATGCCCAGTACAGAGGG

[0125] GGCCGAAGCCGCGAGGCGGAGGAAATCCTAAAAACTGGGCCCAGTT

[0126] CGGACTGTAGGCTGCAACCCGCCTACACGAAGCCGGAATCGCTAGTA

[0127] ATGGCGCATCAGCTACGGCCGCCGTGAATACGTTCCCGGGTCTTGTAC

[0128] ACACCGCCCGTCACATCATGGAAGCCGGTCGCACCCGAAGTATCTGA

[0129] AGCCAACCGCAAGGAGGCAGGGTCCTAAGGTGAGACTGGTAACTGGGATGAAGTC (see SEQ IDNO.1)

[0130] V. Culture and Growth Curve Determination of Akkermansia myxophilus strain AIML-528

[0131] Spread 100 μL of AIML-528 bacterial suspension onto enrichment medium plates (enrichment medium with 15 g / L agar added) and incubate anaerobically at 37°C for 48 hours. Figure 1 As shown.

[0132] Thaw and resuscitate one vial of AIML-528 frozen bacterial culture, and anaerobically culture it in 5 mL of enrichment medium at 37°C for 48 hours. Inoculate the culture at a 1% inoculation ratio into 20 mL of enrichment medium. Measure the OD of the bacterial culture at 0, 24, 28, 32, 40, 44, 48, 54, and 120 hours of culture. 600Absorbance value, pH and viable count. The bacterial liquid obtained at the culture time point described above was diluted 10 times with 0.9% sodium chloride, and the diluted bacterial liquid was spread on the enrichment medium plate at 100 μL. After anaerobic culture at 37°C for 48 hours, the count was performed. As shown in Table 1 and Figure 2

[0133] Table 1 Growth curve of Akkermansia muciniphila AIML-528 strain

[0134]

[0135] The Akkermansia muciniphila AIML-528 strain described above is preserved in the China General Microbiological Culture Collection Center (CGMCC) located at No. 1, Beichen West Road, Chaoyang District, Beijing, with a preservation date of April 17, 2025 and a preservation number of CGMCC NO. 34246.

[0136] Example 2: Culture and identification of Bifidobacterium adolescentis AIML-559

[0137] I. 16S rRNA sequencing and identification of Bifidobacterium adolescentis AIML-559 strain

[0138] The preserved strain was sent to Beijing Ruibo Xingke Biotechnology Co., Ltd. and Wuhan Huada Biological Technology (Wuhan) Co., Ltd. for strain identification. The steps are: genomic DNA extraction - 16S rRNA amplification - PCR product detection and purification - sequencing and result comparison. The gene amplification shows a single clear target band, and the sequencing result shows, after BLAST comparison, that the similarity with other strain sequences is:

[0139] (1) Bifidobacterium adolescentis (NR118589.1) 99.854%

[0140] (2) Bifidobacterium adolescentis strain iVS-1 (CP123050.1) 99.79%

[0141] (3) Bifidobacterium adolescentis strain PRL2019 (CP053072.1) 99.79% It is determined that AIML-559 is Bifidobacterium adolescentis.

[0142] The 16S rRNA sequence of the strain is:

[0143] ​>338F-L-559.34106707

[0144] GGGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCG

[0145] CGTGCGGGATGACGGCCTTCGGGTTGTAAACCGCTTTTGACTGGGAG

[0146] CAAGCCCTTCGGGGTGAGTGTACCTTTCGAATAAGCACCGGCTAACT

[0147] ACGTGCCAGCAGCCGCGGTAATACGTAGGGTGCAAGCGTTATCCGGA

[0148] ATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTG

[0149] AAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTT

[0150] GAGTGCGGTAGGGGAGACTGGAATTCCCGGTGTAACGGTGGAATGT

[0151] GTAGATATCGGGAAGAACACCAATGGCGAAGGCAGGTCTCTGGGCC

[0152] GTCACTGACGCTGAGGAGCGAAAGCGTGGGGAGCGAACAGGATTAG

[0153] ATACCCTGGTAGTCCACGCCGTAAACGGTGGATGCTGGATGTGGGGA

[0154] CCATTCCACGGTCTCCGTGTCGGAGCCAACGCGTTAAGCATCCCGCC

[0155] TGGGGAGTACGGCCGCAAGGCTAAAACTCAAAGAAATTGACGGGGG

[0156] CCCGCACAAGCGGCGGAGCATGCGGATTAATTCGATGCAACGCGAA

[0157] GAACCTTACCTGGGCTTGACATGTTCCCGACAGCCGTAGAGATACGGTCTCCCTTCGGGGCGGGTTCACAGGTGGTGCATGG (see SEQ ID NO. 2).

[0158] II. Growth curve determination of Bifidobacterium adolescentis AIML-559 strain

[0159] One AIML-559 cryopreserved bacterial solution was thawed and recovered, and was anaerobically cultured at 37℃ for 16 hours in 5 mL of MRS medium. The recovered bacterial solution was inoculated in 20 mL of MRS medium at an inoculation ratio of 1%, and the OD values of the bacterial solution were determined at 0, 4, 7, 16, 20, 24 and 48 hours of culture. 600 Absorbance values, pH and viable cell counts. The bacterial solution obtained at the above-mentioned culture time points was diluted 10 times with 0.9% sodium chloride, and 100 μL of the diluted bacterial solution was spread on an enrichment medium plate, which was anaerobically cultured at 37℃ for 24 hours and then counted. As shown in Table 2 and Figure 3 .

[0160] The Bifidobacterium adolescentis AIML-559 strain was continuously cultured for 48 hours, and it was found that the strain reached the stationary phase at about 24 hours and had a long stable growth phase.

[0161] Table 2 Growth curve of Bifidobacterium adolescentis AIML-559 strain

[0162]

[0163] The Bifidobacterium adolescentis AIML-559 strain was deposited with the China General Microbiological Culture Collection Center (CGMCC) at No. 1, Beichen West Road, 3# Courtyard, Chaoyang District, Beijing, on April 22, 2025, and was assigned the accession number CGMCC NO. 34300.

[0164] Example 3: Genome virulence factor analysis of Akkermansia muciniphila AIML-528 strain

[0165] The Akkermansia muciniphila AIML-528 strain of the present application was subjected to whole genome sequencing analysis by Shanghai Sangon Biotech, and it was found that there was no sequence with a similarity of more than 70% to the virulence factors in the VFDB (Virulence Factors of Pathogenic Bacteria) BLAST comparison.

[0166] Example 4: Pharmacodynamic experiment of Akkermansia muciniphila combined bacterial agent in acute IBD model mice

[0167] 1. Experimental animals

[0168] The information of experimental animals is shown in Table 3.

[0169] Table 3 Information of experimental animals

[0170]

[0171] 2. Clinical observation record

[0172] After the animals received rest for 24 hours, clinical observation was performed on all animals and weight was recorded. Detailed clinical observation was performed on all animals twice a week, and weight was recorded. After the modeling / experiment of animals, disease activity index score (DAI) was required, daily weight record. If the animals have abnormal conditions, they should be recorded in detail and the experiment responsible person should be informed. The remaining animals in the group should be euthanized as soon as possible, if they need to be retained, they should be weighed and clinically observed twice a week.

[0173] 3. Random grouping

[0174] At the beginning of the experiment, the animals were randomly divided into 7 groups according to their body weight, including 1 control group, 1 DSS model group and 5 test groups, with an average weight of ±1.0 g between groups, and 6 animals in each group. After grouping, the animals should be given the corresponding solvent, test substance or drug according to the pretreatment, modeling and intervention treatment plan every day.

[0175] 4. Animal pretreatment

[0176] After the animals were grouped, the control group was given normal drinking water, and the DSS model group and the test group were continuously given drinking water containing antibiotics [Vancomycin 0.045 mg / mL + Kanamycin 0.4 mg / mL + Polymyxin B 0.15 mg / mL + Metronidazole 0.215 mg / mL + Gentamicin 0.035 mg / mL] for 7 days, and fresh antibiotic drinking water was replaced every day. On the last day, normal drinking water was replaced, and Clindamycin 10 mg / kg was injected intraperitoneally.

[0177] 5. Drug administration and animal model establishment

[0178] (1) Preparation of bacterial agent

[0179] AIML-528, BSM22959 (purchased from Northland) frozen bacteria liquid was recovered, inoculated in 5 mL enrichment medium respectively, and cultured at 37°C anaerobically for 48 hours. Then, 1% of the recovered bacteria was inoculated into 20 mL enrichment medium respectively, and cultured at 37°C anaerobically for 24 hours. The bacteria were centrifuged at 4000g at 4°C for 10 minutes, washed twice with PBS, and resuspended in 2 mL PBS.

[0180] AIML-559 frozen bacteria liquid was recovered, inoculated in 5 mL MRS medium, and cultured at 37°C anaerobically for 24 hours. Then, 1% of the recovered bacteria was inoculated into 30 mL enrichment medium, and cultured at 37°C anaerobically for 24 hours. The bacteria were centrifuged at 4000g at 4°C for 10 minutes, washed twice with PBS, and resuspended in 3 mL PBS.

[0181] Directly pipette 1.4 mL of the resuspended AIML-528 bacteria to obtain a bacterial agent (G3) containing 2 x 10 8 CFU AIML-528 per 200 μL. Similarly, a bacterial agent (G4) containing 2 x 10 8 CFU DSM22959 per 200 μL and a bacterial agent (G5) containing 2 x 10 8 CFU AIML-559 per 200 μL were obtained.

[0182] Mix 0.7 mL of the resuspended AIML-528 bacteria with 0.7 mL of the resuspended AIML-559 bacteria to obtain a combined bacterial agent (G6) containing 1 x 10 8 CFU AIML-528 and 1 x 10 8 CFU AIML-559 per 200 μL. Similarly, a combined bacterial agent (G7) containing 1 x 10 8 CFU DSM22959 and 1 x 10 8 CFU AIML-559 per 200 μL was obtained.

[0183] The required bacterial agent was prepared on the day of administration.

[0184] (2) Administration plan

[0185] The day when the test group and the control group were given the pretreatment was counted as the first day of the experiment (D1). On the ninth day of the experiment (D9), the control group was given normal drinking water, the DSS model group and the test group were continuously given drinking water containing 3.0% DSS for 7 days, and the test group was simultaneously given the test drug. Fresh DSS drinking water was replaced every 2 days. After the modeling was completed, the normal drinking water was restored in each group. The administration and modeling plan is shown in Table 4. The entire experimental period was 16 days.

[0186] 3.0% DSS preparation: Weigh 30 g of DSS (dextran sodium sulfate) and dissolve in 1 L of sterile water, stir until fully dissolved. Prepare fresh daily.

[0187] Table 4 Schedule of Interventional Treatments

[0188]

[0189]

[0190] Note: P.O. means oral gavage (test article); ad libitum drinking means free access to drinking water; QD x 7 (D9-D15) means test article given daily on D9-D15, control group given PBS vehicle; 7 Days (D9-D15) means 3.0% DSS in drinking water given for 7 consecutive days on D9-D15.

[0191] 6. Disease Activity Index Score (DAI)

[0192] Body weights should be recorded daily for all animals in the study after the start of dosing; disease activity index scores should be recorded once daily. DAI scores are defined as follows:

[0193] (1) Body weight loss: 0 (none), 1 (1-≤5%), 2 (5-≤10%), 3 (10-20%), 4 (>20%);

[0194] (2) Stool consistency: 0 (dry and normal), 1 (partially formed but not sticking to the anus), 2 (loose but not sticking to the anus), 3 (loose and sticking to the anus), 4 (watery stool);

[0195] (3) Stool blood: 0 (no blood), 1 (occult blood), 2 (visible blood), 3 (visible blood and sticking to the anus), 4 (significant bleeding, blood around the anus).

[0196] 7. Collection of Anti-coagulated Whole Blood

[0197] On Day 16 of the experiment (D16), animals were anesthetized and approximately 100 μL of whole blood was collected from the orbital plexus. The whole blood sample was placed in a clean 1.5 mL EDTA anti-coagulation tube for blood count analysis.

[0198] 8. Euthanasia

[0199] Animals should be euthanized if they lose more than 30% of their initial body weight, or if they are severely injured, cannot eat or drink on their own, or are in a moribund state for any reason.

[0200] 9. Experimental Results

[0201] (1) The combination of *Akermansia myxophilus* AIML-528 and its bacterial agent effectively alleviated weight loss caused by inflammatory bowel disease in mice. Weight change is an important indicator of inflammatory bowel disease progression. The combined bacterial agent group (G6) showed significantly later symptoms of weight loss than the DSS model group (G2), and the disease progressed more slowly. The AIML-528 combined bacterial agent group had a better intervention effect than the standard strain DSM22959 combined bacterial agent group (G7). Experimental results are as follows: Figure 4 As shown.

[0202] (2) The combination of *Akkermansia myxophilus* AIML-528 and its inoculum significantly improved the disease signs and disease activity index scores in IBD mice. IBD mice treated with AIML-528 combined with the inoculum (G6) showed better relief of diarrhea symptoms compared to the standard strain DSM22959 combined with the inoculum (G7), and exhibited a more significant therapeutic effect in delaying intestinal bleeding and alleviating bleeding symptoms. The reduction in intestinal symptoms can decrease the risk of other secondary complications and improve the patient's quality of life. Experimental results are as follows... Figure 5 A- Figure 5 As shown in C.

[0203] (3) Blood routine data were consistent with DAI data. In mice treated with Alkalobacterium myxophilus AIML-528 combined with bacterial agent (G6), the white blood cell count (...) Figure 6 A) Neutrophils ( Figure 6 The value of B) decreased more significantly, and the red blood cell count ( Figure 6 C) and hemoglobin levels ( Figure 6 D) also showed a significant rebound. The results indicated that the AIML-528 combined with the probiotic agent (G6) of *Akkermansia myxophilus* possessed stronger anti-infective capabilities and significantly alleviated hemolysis and anemia caused by enteritis. Compared to the standard strain DSM22959 combined with the probiotic agent (G7), the AIML-528 combined with the probiotic agent (G6) showed significant improvement in blood and immune indicators in the intervention and treatment of IBD. Experimental results are as follows... Figure 6 A- Figure 6 As shown in D.

[0204] The present application relates to the application of a mucinophilic Akkermansia combined bacterial agent in the treatment of inflammatory bowel disease (IBD). Studies have shown that in IBD mouse models, the AIML-528 combined bacterial agent formula can significantly improve disease indicators and alleviate disease progression. In a dextran sulfate sodium (DSS)-induced colitis model, the use of the AIML-528 combined bacterial agent significantly reduces the disease activity index (DAI), effectively treats immune-mediated colitis, reverses inflammatory conditions, delays the progression of IBD, and improves the quality of life of IBD mice, showing better effects than single strains or combinations of the same type of strains. Experiments have shown that the AIML-528 combined bacterial agent formula can effectively reduce inflammation and intestinal damage in IBD, and these synergistic effects and therapeutic advantages highlight the potential of the formula in inhibiting disease progression and provide strong support for the development of new IBD treatment drugs.

[0205] Example 5: Preparation of a mucinophilic Akkermansia combined bacterial agent product

[0206] The mucinophilic Akkermansia combined bacterial agent can be used to prepare food, for example, a lactic acid bacterial beverage:

[0207] (1) Bacterial strain culture and preparation of freeze-dried powder

[0208] Mucinophilic Akkermansia (AIML-528) and Bifidobacterium adolescentis (AIML-559) are respectively activated and subcultured to obtain high-activity bacterial solutions. The bacterial bodies are collected by centrifugation and resuspended in a freeze-drying protectant solution containing skim milk, trehalose, and gum arabic. After pre-freezing and vacuum freeze-drying, stable combined bacterial agent freeze-dried powder is obtained, with a viable bacterial count of ≥1×10 10 CFU / g, and the viable bacterial count ratio of the two bacteria being 1:1.

[0209] (2) Preparation of lactic acid bacterial beverage matrix

[0210] Skim milk or reconstituted milk is used as the raw material, and the solid content is adjusted to 8%-12%. Homogenization and pasteurization (85°C for 15 minutes) are performed. Cooling is performed to 37-40°C.

[0211] (3) Fermentation and preparation of finished product

[0212] The combined bacterial agent freeze-dried powder is inoculated into the milk matrix at an inoculation amount of 10 7 -10 8 CFU / mL. Fermentation is performed at 37°C for 6-10 hours until the pH drops to 4.2-4.5. After uniform stirring, the appropriate amount of fruit juice or sweetener is added for seasoning. Filling and packaging are performed, and the product is stored in a cold state. The viable bacterial count in the finished beverage is ≥1×10 8 CFU / mL.

[0213] The Akkermansia muciniphila combined bacterial agent can be used for preparing food, taking gummy candy as an example:

[0214] (1) Preparation of gummy candy matrix

[0215] According to the conventional process, gelatin or pectin is dissolved in a heated sugar syrup solution (containing sucrose, glucose syrup, citric acid, natural fruit juice); the sugar syrup solid content is adjusted to 70%-75%.

[0216] (2) Addition of combined bacterial agent

[0217] When the sugar syrup is cooled to below 40℃, the combined bacterial agent freeze-dried powder is added and mixed uniformly; the addition amount is controlled so that each gummy candy contains ≥1×10 8 CFU of live bacteria.

[0218] (3) Molding and packaging

[0219] The mixture is poured into a mold and cooled to form; after demolding, a small amount of starch or sugar powder is wrapped to prevent sticking; nitrogen is filled and packaged, and stored in a cool and dry place.

[0220] The Akkermansia muciniphila combined bacterial agent can be used for preparing medicine, taking freeze-dried preparation as an example:

[0221] (1) Preparation of bacterial strain

[0222] Akkermansia muciniphila and Bifidobacterium adolescentis are respectively cultured to the logarithmic phase, and the bacterial bodies are collected by centrifugation; the two bacterial bodies are mixed to prepare a bacterial suspension according to the ratio of viable bacteria (1:1 or other optimized ratio).

[0223] (2) Preparation of freeze-drying protective solution

[0224] The protective solution is composed of 10% skimmed milk, 5% trehalose and 2% gelatin (mass percentage); the bacterial suspension and the protective solution are mixed at a ratio of 1:1.

[0225] (3) Freeze-drying process

[0226] The mixed solution is filled into a test tube, pre-frozen (-40℃, 4h); vacuum freeze-dried (primary drying -20℃, sublimation stage 48h; final drying 20℃, 8h); sealed and packaged, and the obtained freeze-dried preparation contains ≥1×10 10 CFU / g of live bacteria.

[0227] (4) Application of dosage form

[0228] It can be directly prepared as an oral freeze-dried powder; or it can be mixed with pharmaceutically acceptable excipients (such as microcrystalline cellulose, lactose) and then compressed or encapsulated to prepare tablets or capsules.

[0229] The Akkermansia muciniphila combined bacterial agent can be used for preparing health products, taking solid beverage as an example:

[0230] (1)Auxiliary preparation

[0231] Select fructo-oligosaccharides, lactulose and resistant dextrin as prebiotic carriers; pre-mix the auxiliary materials and uniformly pulverize them.

[0232] (2) Bacterial powder addition and mixing

[0233] Add the freeze-dried powder of the combined bacterial agent into the auxiliary materials in proportion (≥1×10 9 CFU per bag); uniformly mix them and avoid high-temperature treatment.

[0234] (3) Sub-packing

[0235] Sub-pack the mixture into small bags with a net content of 2-5 g per bag; seal the outer package to prevent moisture.

[0236] (4) Taking method

[0237] It can be directly taken by drinking water or by adding milk or fruit juice.

[0238] Obviously, the above examples are merely examples for the sake of clarity and are not limitations on the embodiments. Based on the above description, other different forms of changes or variations can also be made by those of ordinary skill in the art. Here, it is not necessary and impossible to exhaust all the embodiments. The obvious changes or variations derived therefrom are still within the protection scope of the present application.

Claims

1. An Akkermansia muciniphila, characterized in that, For any one of the following (1)-(3): (1) a strain having at least 85%, 90%, 95%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% identity to the sequence set forth in SEQ ID NO: 1 of 16S rRNA; (2) Akkermansia muciniphila deposited with China General Microbiological Culture Collection Center, having a deposit number of CGMCC No. 34246; (3) a strain having at least 85%, 90%, 95%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% identity to the 16S rRNA of the strain of (2).

2. A Bifidobacterium adolescentis characterized in that, For any one of the following (1)-(3): (1) a strain having at least 85%, 90%, 95%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% identity to the sequence set forth in SEQ ID NO: 2 of 16S rRNA; (2) Bifidobacterium adolescentis deposited with China General Microbiological Culture Collection Center, having a deposit number of CGMCC No. 34300; (3) a strain having at least 85%, 90%, 95%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% identity to the 16S rRNA of the strain of (2).

3. A microbial inoculant, characterized in that, comprising: the Akkermansia muciniphila of claim 1, or a bacterial suspension thereof, or a fermentation broth thereof, or a fermentation supernatant thereof, or inactivated bacteria and fragments thereof, or metabolites thereof, or a mixture of bacterial cells and filtrate thereof; and / or, the Bifidobacterium adolescentis of claim 2, or a bacterial suspension thereof, or a fermentation broth thereof, or a fermentation supernatant thereof, or inactivated bacteria and fragments thereof, or metabolites thereof, or a mixture of bacterial cells and filtrate thereof.

4. The microbial inoculant of claim 3, wherein, a microbial inoculant containing the Akkermansia muciniphila and the Bifidobacterium adolescentis, wherein the ratio of viable counts of the Akkermansia muciniphila to the Bifidobacterium adolescentis is 1:10-10:

1.

5. The microbial inoculant of claim 3 or 4, wherein The total number of viable bacteria of each of the Akkermansia muciniphila and Bifidobacterium adolescentis is not less than 1×10 8 CFU / mL or 1×10 8 CFU / g.

6. A method for producing the microbial inoculant according to any one of claims 3 to 5, characterized in that, activating and culturing the Akkermansia muciniphila and / or the Bifidobacterium adolescentis.

7. The method for producing the microbial inoculant according to any one of claims 3 to 6, characterized in that, comprising the following steps: activating and culturing the Akkermansia muciniphila and the Bifidobacterium adolescentis separately, and mixing them uniformly according to the ratio of viable counts.

8. Use of the microbial inoculant prepared by the method of any one of claims 1-7 in the preparation of a product for relieving symptoms of inflammatory bowel disease or treating inflammatory bowel disease.

9. Use according to claim 8, characterized in that, the inflammatory bowel disease (IBD) comprises ulcerative colitis (UC) or Crohn's disease (CD); The symptoms of the inflammatory bowel disease include, but are not limited to, weight loss, hemolysis, anemia, diarrhea or intestinal hemorrhage symptoms.

10. A product for use in alleviating the symptoms of, or treating, an inflammatory bowel disease, characterised in that, The product includes the Akkermansia muciniphila of claim 1, the Bifidobacterium adolescentis of claim 2, the microbial inoculum of any one of claims 3-5, the microbial inoculum prepared by the method of any one of claims 6-7; the product includes food, medicine or health care product; And / or, the food includes fermented milk, lactic acid bacteria beverage, soft candy, biscuit, solid beverage or lozenge; And / or, the medicine or health care product further includes a pharmaceutically acceptable carrier or excipient; The dosage form of the medicine includes a lyophilized preparation or a liquid preparation; Optionally, the dosage form of the medicine includes, but is not limited to, tablets, granules, capsules, pills, solutions, emulsions, suspensions, injections, aerosols, powder sprays, lotions, ointments, patches, eye drops, nose drops, gargle, sublingual tablets or suppositories; Optionally, the lyophilization protectant used for preparing the lyophilized bacterial powder and the excipient used for preparing other dosage forms are selected from any one or a combination of at least two of skim milk, gelatin, dextrin, resistant dextrin, acacia gum, sodium alginate, sucrose, lactose, trehalose, oligomeric lactose, oligomeric fructose, oligomeric maltose, sorbitol, xylitol, sodium carboxymethyl cellulose, microcrystalline cellulose, cysteine, carbomer, polyethylene glycol and vitamin C.

Images