Asparagine synthetase A mutant

Abstract

The invention discloses an asparagine synthetase A mutant, and belongs to the technical field of bioengineering. According to the invention, L-aspartic acid and ATP are used as raw materials, the asparagine synthetase A (EcAsnA) mutant with improved activity is used for biosynthesis of L-asparagine, and the whole catalytic process is simple and efficient. Compared with a parent capable of catalyzing L-aspartic acid to generate L-asparagine at present, the EcAsnAL109A / T44I / Q66L has higher catalytic efficiency, and the catalytic activity of the EcAsnAL109A / T44I / Q66L is improved to 3222.51 U / mg, which is 5.48 times of that of the parent (497.15 U / mg), and is improved by 23.77% compared with that of EcAsnAL109K / K58R. The invention provides a new synthesis method for rapid synthesis of L-asparagine, and provides a new idea for industrial production of L-asparagine.

Description

TECHNICAL FIELD

[0001] The present application relates to a mutant of asparagine synthetase A, belonging to the technical field of bioengineering. BACKGROUND

[0002] As one of the 20 common amino acids, asparagine is widely used in the fields of medicine, food, etc. In recent years, researches have shown that the compounds obtained by conversion of asparagine have high medicinal value and good biological activity in terms of anti-inflammatory, blood pressure reduction, hemostasis, etc. For example, captopril (ACEI) class of blood pressure lowering drugs, endomorphin-2 (EM2) class of analgesic drugs and anti-inflammatory drug N-[beta-(p-substituted benzoyl) ethyl] asparagine, etc. The main methods for synthesizing L-asparagine are chemical synthesis, plant extraction and biosynthesis. The biosynthesis has the advantages of simple process, low equipment requirement, high production efficiency, low energy consumption and small pollution, but still has problems such as low activity of key enzymes. In view of the importance of L-asparagine, it is urgent to develop a method for efficiently synthesizing L-asparagine to promote the production and application of L-Asn.

[0003] In the existing biological synthesis method, L-aspartic acid is used as the substrate, and asparagine synthetase A is used to perform an ammonia connection reaction on the side chain carboxyl group to synthesize L-asparagine. Asparagine synthetase A is a multifunctional enzyme that uses ATP as a cofactor to functionalize the C-O bond of an amino acid, and is considered to be one of the important catalysts for the amidation of amino acids. Although the existing technology has disclosed mutants of the enzyme, the catalytic efficiency and specific enzyme activity of the disclosed enzyme still need to be further improved. In view of the above problems, the present application further modifies the asparagine synthetase A mutant EcAsnA L109A / T44I to obtain asparagine synthetase A with improved activity, and completes the low-cost industrial synthesis of L-asparagine. SUMMARY

[0004] In view of the deficiencies of the prior art, the present application provides the construction and property research of asparagine synthetase A mutant for producing L-asparagine, aiming to efficiently synthesize L-asparagine from the inexpensive substrate L-aspartic acid and cofactor ATP through genetically engineered bacteria, and solve the technical problems that the activity of asparagine synthetase A is low in the existing biological synthesis method, resulting in too low yield of L-asparagine, and the production intensity still needs to be further improved.

[0005] The present application provides an asparagine synthetase A mutant, which is a mutant of the 109th leucine, the 44th threonine and the 66th glutamine of the parent asparagine synthetase A, and the amino acid sequence of the asparagine synthetase A (EcAsnA) is shown in SEQ ID NO. 1.

[0006] MKTAYIAKQRQISFVKSHFSRQLEERLGLIEVQAPILSRVGDGTQDNLSGCEKAVQVKVKALPDAQFEVVHSLAKWKRQTLGQHDFSAGEGLYTHMKALRPDEDRLSPLHSVYVDQWDWERVMGDGERQFSTLKSTVEAIWAGIKATEAAVSEEFGLAPFLPDQIHFVHSQELLSRYPDLDAKGRERAIAKDLGAVFLVGIGGKLSDGHRHDVRAPDYDDWSTPSELGHAGLNGDILVWNPVLEDAFELSSMGIRVDADTLKHQLALTGDEDRLELEWHQALLRGEMPQTIGGGIGQSRLTMLLLQLPHIGQVQCGVWPAAVRESVPSLL

[0007] In an embodiment, the nucleic acid sequence of the gene encoding the EcAsnA is set forth in SEQ ID NO. 2.

[0008] SEQ ID NO. 2:

[0009] atgaaaaccg cttacattgc caaacaacgt caaattagct tcgtgaaatc tcacttttctcgtcaactgg

[0010] aagaacgtct ggggctgatc gaagtccagg cgccgattct tagccgtgtg ggggatggcacgcaggataa

[0011] cttgtcgggc tgtgaaaaag cggtgcaggt aaaagtgaaa gctctgcctg atgcccagttcgaagtggtt

[0012] cattcactgg cgaagtggaa acgtcagacc ttagggcaac acgacttcag cgcgggcgaagggctgtaca

[0013] cgcacatgaa agcccttcgc cccgatgaag accgtctttc tccgttgcac tcggtctatgttgaccagtg

[0014] ggactgggaa cgcgtaatgg gcgacggtga gcgtcaattc tcgactctga aaagcacggtagaggcgatc

[0015] tgggcgggaa ttaaagcaac cgaagctgcg gttagcgaag agtttggcct ggcaccgttcctgccggatc

[0016] agatccactt cgtacacagc caggagttac tgtctcgtta tccggatctt gatgccaaagggcgtgagcg

[0017] ggcgatagcg aaagatcttg gcgcggtatt ccttgtcggg attggcggca agctgagcgatggtcatcgc

[0018] cacgacgtgc gcgcaccgga ttatgatgac tggagcaccc cgtcagagct gggccatgcgggtctgaacg

[0019] gcgatattct ggtgtggaac ccggtactgg aagatgcgtt tgagctttcc tccatggggatccgtgtaga

[0020] tgccgacacg ctgaagcatc aactggcgct gaccggtgac gaagatcgcc tggagctggagtggcatcag

[0021] gcgctgctgc gcggtgaaat gccgcagacc atcggcggcg gtatcggcca gtctcgtttgactatgctgc

[0022] tgctgcaact gccgcatatc ggccaggttc agtgtggagt atggccagct gctgttcgcgagagcgtccc

[0023] ttctctgctg taa

[0024] In one embodiment, the mutant is mutated from the parent as follows: the leucine L at position 109 is mutated to alanine A, the threonine T at position 44 is mutated to isoleucine I and the glutamine Q at position 66 is mutated to leucine L.

[0025] In one embodiment, the mutant is mutated from the parent EcAsnA at position 109, position 44 and glutamine at position 66 to obtain mutant EcAsnA L109A / T44I / Q66L .

[0026] In one embodiment, the mutant EcAsnA L109A / T44I / Q66L has an amino acid sequence as shown in SEQ ID NO. 3 and a nucleotide sequence as shown in SEQ ID NO. 4.

[0027] SEQ ID NO. 3:

[0028] MKTAYIAKQRQISFVKSHFSRQLEERLGLIEVQAPILSRVGDGIQDNLSGCEKAVQVKVKALPDALFEVVHSLAKWKRQTLGQHDFSAGEGLYTHMKALRPDEDRLSPAHSVYVDQWDWERVMGDGERQFSTLKSTVEAIWAGIKATEAAVSEEFGLAPFLPDQIHFVHSQELLSRYPDLDAKGRERAIAKDLGAVFLVGIGGKLSDGHRHDVRAPDYDDWSTPSELGHAGLNGDILVWNPVLEDAFELSSMGIRVDADTLKHQLALTGDEDRLELEWHQALLRGEMPQTIGGGIGQSRLTMLLLQLPHIGQVQCGVWPAAVRESVPSLL

[0029] SEQ ID NO. 4:

[0030] atgaaaaccg cttacattgc caaacaacgt caaattagct tcgtgaaatc tcacttttctcgtcaactggaagaacgtct ggggctgatc gaagtccagg cgccgattct tagccgtgtg ggggatggcattcaggataacttgtcgggc tgtgaaaaag cggtgcaggt aaaggtgaaa gctctgcctg atgccctattcgaagtggttcattcactgg cgaagtggaa acgtcagacc ttagggcaac acgacttcag cgcgggcgaagggctgtacacgcacatgaa agcccttcgc cccgatgaag accgtctttc tccggcacac tcggtctatgttgaccagtgggactgggaa cgcgtaatgg gcgacggtga gcgtcaattc tcgactctga aaagcacggtagaggcgatctgggcgggaa ttaaagcaac cgaagctgcg gttagcgaag agtttggcct ggcaccgttcctgccggatcagatccactt cgtacacagc caggagttac tgtctcgtta tccggatctt gatgccaaagggcgtgagcgggcgatagcg aaagatcttg gcgcggtatt ccttgtcggg attggcggca agctgagcgatggtcatcgccacgacgtgc gcgcaccgga ttatgatgac tggagcaccc cgtcagagct gggccatgcgggtctgaacggcgatattct ggtgtggaac ccggtactgg aagatgcgtt tgagctttcc tccatggggatccgtgtagatgccgacacg ctgaagcatc aactggcgct gaccggtgac gaagatcgcc tggagctggagtggcatcaggcgctgctgc gcggtgaaat gccgcagacc atcggcggcg gtatcggcca gtctcgtttgactatgctgctgctgcaact gccgcatatcggccaggttc agtgtggagt atggccagct gctgttcgcgagagcgtcccttctctgctg taa

[0031] In one embodiment, the method for obtaining the EcAsnA mutant includes the following steps:

[0032] (1) The mutant of asparagine synthase A in Escherichia coli (EcAsnA) L109A / T44I Based on the amino acid sequence, the mutation site was determined; saturation mutation primers were designed to carry the code for EcAsnA. L109A / T44I Gene vectors are used as templates for saturation mutation; plasmid vectors containing mutants are constructed;

[0033] (2) Transform the mutant plasmid into the host cell;

[0034] (3) Select positive clones for fermentation culture and purify EcAsnA.

[0035] This invention also provides an encoding of the asparagine synthase A mutant, EcAsnA. L109A / T44I / Q66L The gene or a recombinant vector carrying the gene.

[0036] In one implementation, pET-28a(+) is used as the expression vector.

[0037] The present invention also provides expression of the above mutant EcAsnA L109A / T44I / Q66L Or recombinant cells carrying the aforementioned genes or the recombinant vector.

[0038] In one embodiment, the recombinant cells are bacteria or fungi as host cells.

[0039] The present invention also provides a mutant EcAsnA containing the above-mentioned asparagine synthase A. L109A / T44I / Q66L The recombinase catalyst is any of the following forms:

[0040] (1) Cultivate EcAsnA containing the asparagine synthase A mutant. L109A / T44I / Q66L The recombinant expression transformant was used to isolate transformant cells containing the recombinant asparagine synthase A mutant enzyme;

[0041] (2) Cultivate EcAsnA containing the aforementioned asparagine synthase A mutant. L109A / T44I / Q66L The recombinant expression transformant was obtained, and the transformant cells containing the recombinant asparagine synthase A mutant enzyme were isolated. The transformant cells containing the recombinant asparagine synthase A mutant enzyme were lysed to obtain the cell lysate.

[0042] (3) culturing the recombinant expression transformant containing the asparagine synthetase A mutant EcAsnA L109A / T44I / Q66L , isolating the transformant cell containing the recombinant asparagine synthetase A mutant enzyme, crushing the transformant cell containing the recombinant asparagine synthetase A mutant enzyme, obtaining a cell crushing solution, and freeze-drying the recombinant asparagine synthetase A mutant enzyme cell crushing solution to obtain a freeze-dried enzyme powder.

[0043] The application further provides a method for improving the catalytic activity of asparagine synthetase A on a substrate and improving specific enzyme activity, which comprises mutating leucine at position 109 of asparagine synthetase A with amino acid sequence shown in SEQ ID NO. 1 into alanine, mutating threonine at position 44 into isoleucine, and mutating glutamine at position 66 into leucine.

[0044] The application further provides a method for improving the yield of L-asparagine, which comprises using L-aspartate as a substrate and using the above-mentioned EcAsnA L109A / T44I / Q66L mutant, the above-mentioned recombinant cell, or the above-mentioned recombinant enzyme catalyst to catalyze a reaction to prepare L-asparagine.

[0045] In an embodiment, the system further contains MgCl2, ATP;

[0046] In an embodiment, the concentration of NH4Cl is 150-250 mM, the concentration of MgCl2 is 150-250 mM, the concentration of ATP is 150-250 mM, and the concentration of L-aspartate is 150-250 mM.

[0047] In an embodiment, in the system, the pH is 7.5-8.5, the temperature is 30-40℃, and the rotation speed is 200-300 rpm.

[0048] The application further provides a genetically engineered bacterium, which is an Escherichia coli as a chassis cell and expresses the above-mentioned asparagine synthetase A mutant EcAsnA L109A / T44I / Q66L .

[0049] In an embodiment, the genetically engineered bacterium takes Escherichia coli as a starting strain.

[0050] In an embodiment, Escherichia coli BL21 (DE3) is used as an expression host.

[0051] In an embodiment, an expression vector EcAsnA L109A / T44I / Q66L carrying a gene encoding EcAsnA L109A / T44I / Q66L-pET-28a, EcAsnA L109A / T44I / Q66L -pET-28a is introduced into E. coli BL21 (DE3) to form EcAsnA L109A / T44I / Q66L -pET-28a-BL21 (DE3) genetically engineered bacteria.

[0052] In an embodiment, an expression vector EcAsnA L109A / T44I / Q66L of a gene encoding EcAsnA L109A / T44I / Q66L -pET-28a, EcAsnA L109A / T44I / Q66L -pET-28a is introduced into E. coli BL21 (DE3) to form EcAsnA L109A / T44I / Q66L -pET-28a-BL21 (DE3) genetically engineered bacteria.

[0053] The application also provides a method for preparing L-asparagine, which comprises adding the recombinant asparagine synthetase A mutant enzyme prepared by the recombinant cell or the genetically engineered bacteria to a system containing L-aspartate and NH4Cl for degradation. L109A / T44I / Q66L

[0054] In an embodiment, the system further contains MgCl2, ATP;

[0055] In an embodiment, the concentration of NH4Cl is 150-250 mM; the concentration of MgCl2 is 150-250 mM, the concentration of ATP is 150-250 mM, and the concentration of L-aspartate is 150-250 mM.

[0056] In an embodiment, in the system, the pH is 7.5-8.5, the temperature is 30-40℃, the reaction time is 30-90 min, the rotation speed is 200-300 rpm, and the dosage of the catalyst is 20-30 g / L genetically engineered bacteria.

[0057] In an embodiment, the catalytic system is 10 mL, wherein the concentration of L-aspartate is 200 mM, the concentration of NH4Cl is 200 mM, the concentration of ATP is 200 mM, the concentration of MgCl2 is 200 mM, and the dosage of the catalyst is 20 g / L genetically engineered bacteria.

[0058] In an embodiment, the buffer of the catalytic system is 200 mM Tris-HCl.

[0059] In an embodiment, the pH of the catalytic system is 8.0, the catalytic reaction temperature is 37℃, and the catalytic reaction time is 0.5 h.

[0060] ​The present invention also provides the above-mentioned asparagine synthase A mutant, or the above-mentioned gene or recombinant vector, or the above-mentioned recombinant cell, or the above-mentioned recombinant enzyme catalyst, or the above-mentioned use in the preparation of L-asparagine or products containing L-asparagine.

[0061] Beneficial effects

[0062] This invention designs a whole-cell biosynthesis of L-asparagine using L-aspartic acid and ATP as raw materials and an enhanced-activity asparagine synthase A (EcAsnA) mutant. The overall catalytic process is simple and efficient. Compared to existing EcAsnA enzymes capable of catalyzing the conversion of L-aspartic acid to L-asparagine, the EcAsnA in this invention... L109A / T44I / Q66L The catalytic efficiency was further improved, reaching [a higher level]. 3222.5 1 U / mg Compared with wild-type enzymes and currently reported EcAsnA L109K / K58R Compared to the previous methods, the yields were improved by 5.48 times and 23.77%, respectively. This invention provides a new synthetic method for the rapid synthesis of L-asparagine and offers new ideas for the industrial production of L-asparagine. Attached Figure Description

[0063] Figure 1 The results of the initial screening for half-saturation mutations of enzyme EcAsnA at amino acid (Q) at position 66.

[0064] Figure 2 The results of the initial screening for half-saturation mutations of enzyme EcAsnA at amino acid (K) at position 58.

[0065] Figure 3 The results of the initial screening for half-saturation mutations of enzyme EcAsnA at amino acid (R) position 105.

[0066] Figure 4 The results of the initial screening for half-saturation mutation of enzyme EcAsnA at amino acid (D) at position 104.

[0067] Figure 5 The results of the initial screening for half-saturation mutations of enzyme EcAsnA at amino acid (K) position 53 are shown.

[0068] Figure 6 The results of the initial screening for half-saturation mutations of enzyme EcAsnA at amino acid (R) position 210.

[0069] Figure 7 EcAsnA wild-type, mutant EcAsnA L109A EcAsnA L109K EcAsnA L109A / T44I EcAsnA L109K / K58R and, EcAsnA L109A / T44I / Q66L EcAsnAL109A / T44I / D104K EcAsnA L109A / T44I / K58R EcAsnA L109A / T44I / R105P EcAsnA L109A / T44I / K53N and EcAsnA L109A / T44I / R210P The yield of L-asparagine produced by catalysis for 0.5 h at a 10 mL preparation scale is shown in the figure.

[0070] Figure 8 EcAsnA wild-type, mutant EcAsnA L109A EcAsnA L109K EcAsnA L109A / T44I EcAsnA L109K / K58R and, EcAsnA L109A / T44I / Q66L EcAsnA L109A / T44I / D104K EcAsnA L109A / T44I / K58R EcAsnA L109A / T44I / R105P EcAsnA L109A / T44I / K53N and EcAsnA L109A / T44I / R210P The enzyme activity.

[0071] Figure 9 The mutant EcAsnA L109A / T44I / Q66L Thermal stability diagram.

[0072] Figure 10 The mutant EcAsnA L109A / T44I / Q66L pH stability graph. Detailed Implementation

[0073] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0074] Gene source: The EcAsnA gene involved in this invention is derived from Escherichia coli. The pET-28a(+) plasmid was purchased from Novagen (Madison, WI, USA). The ClonExpress II One Step Cloning Kit, Primer Star Max, DpnI, etc., were purchased from TaKaRa (Dalian, China). All EcAsnA mutants were obtained through molecular modification.

[0075] The host used was E. coli BL21(DE3), the vector was pET-28a(+), and the resistance was kanamycin. The following procedures involved mutagenesis of the parental genetically engineered strain E. coli-EcAsnA-pET-28a to screen for high-yielding strains.

[0076] The culture media involved in the following examples are as follows:

[0077] LB medium: Yeast extract 5 g / L, Tryptone 10 g / L, NaCl 10 g / L, sterilized at 121 °C for 20 min.

[0078] TB fermentation medium: Tryptone 12 g / L, Angel Yeast powder FM 802 24 g / L, Glycerol 4 g / L, KH2PO4 2.31 g / L and K2HPO4 12.31 g / L.

[0079] The detection methods involved in the following examples are as follows:

[0080] HPLC method for determining L-aspartate and L-asparagine: see the literature Anal. Biochem., 1984, 136(1): 195-201 (A high-performance liquid chromatography assay for asparagine synthetase) for specific steps.

[0081] Product L-asparagine content determination: the reaction product is determined by high performance liquid chromatography (HPLC). See the HPLC method for determining L-aspartate and L-asparagine described above for liquid phase detection conditions.

[0082] Method for detecting asparagine synthetase A enzyme activity:

[0083] Mix 200 mM L-aspartate, 200 mM NH4Cl, 200 mM MgCl2, 200 mM ATP, and then adjust the pH to 8.0 with ammonia water. Add EcA snA pure enzyme with a final concentration of 0.5 mg / ml, and react at 37 °C for 30 min at a speed of 220 rpm. After the reaction is completed, terminate the reaction with 50 mM HCl, and then detect the L-asparagine content by OPA derivatization method. HPLC method for determining L-aspartate and L-asparagine: see the literature Anal. Biochem., 1984, 136(1): 195-201 (A high-performance liquid chromatography assay for asparagine synthetase) for specific steps.

[0084] Definition of asparagine synthetase A enzyme activity: 1 μmol·L -1 Enzyme amount of L-asparagine.

[0085] The following examples involve the transformation of competent cells:

[0086] Transformation: the digestion product is introduced into E. coli BL21 (DE3) competent cells by heat shock method, and the transformation specific steps are:

[0087] (1) Introduce 10 μL PCR product into 100 μL E. coli BL21(DE3) competent cells;

[0088] (2) Ice bath for 30 min;

[0089] (3) 42°C water bath heat shock for 60 s, and then quickly put into ice and stand for 3-5 min;

[0090] (4) Add 600 μL LB medium without resistance, mix, and culture at 37°C, 220 rpm for 1 h;

[0091] (5) Centrifuge at 4000 rpm for 2 min;

[0092] (6) Discard the supernatant, use the remaining 100-200 μL LB medium to mix and blow the bacteria, and then spread on a plate containing 0.05 mg / mL kanamycin resistance, and culture at 37°C for 12 h or so.

[0093] Example 1: Construction of Mutant

[0094] 1. Construction of recombinant vector containing wild type

[0095] (1) Obtaining of recombinant vector

[0096] The primer AsnA-F (ATGGGTCGCGGATCCATGAAAACCGCTTACATTGCCA) and AsnA-R (ACGGAGCTCGAATTCTTACAGCAGAGAAGGGACGCT) are used to amplify the target protein sequence AsnA from the genome of Escherichia coli (as shown in SEQ ID NO. 2) and connect it to the pET-28a(+) vector.

[0097] SEQ ID NO. 2:

[0098] atgaaaaccg cttacattgc caaacaacgt caaattagct tcgtgaaatc tcacttttctcgtcaactgg

[0099] aagaacgtct ggggctgatc gaagtccagg cgccgattct tagccgtgtg ggggatggcacgcaggataa

[0100] cttgtcgggc tgtgaaaaag cggtgcaggt aaaagtgaaa gctctgcctg atgcccagtt cgaagtggtt

[0101] cattcactgg cgaagtggaa acgtcagacc ttagggcaac acgacttcag cgcgggcgaagggctgtaca

[0102] cgcacatgaa agcccttcgc cccgatgaag accgtctttc tccgttgcac tcggtctatgttgaccagtg

[0103] ggactgggaa cgcgtaatgg gcgacggtga gcgtcaattc tcgactctga aaagcacggtagaggcgatc

[0104] tgggcgggaa ttaaagcaac cgaagctgcg gttagcgaag agtttggcct ggcaccgttcctgccggatc

[0105] agatccactt cgtacacagc caggagttac tgtctcgtta tccggatctt gatgccaaagggcgtgagcg

[0106] ggcgatagcg aaagatcttg gcgcggtatt ccttgtcggg attggcggca agctgagcgatggtcatcgc

[0107] cacgacgtgc gcgcaccgga ttatgatgac tggagcaccc cgtcagagct gggccatgcgggtctgaacg

[0108] gcgatattct ggtgtggaac ccggtactgg aagatgcgtt tgagctttcc tccatggggatccgtgtaga

[0109] tgccgacacg ctgaagcatc aactggcgct gaccggtgac gaagatcgcc tggagctggagtggcatcag

[0110] gcgctgctgc gcggtgaaat gccgcagacc atcggcggcg gtatcggcca gtctcgtttgactatgctgc

[0111] tgctgcaact gccgcatatc ggccaggttc agtgtggagt atggccagct gctgttcgcgagagcgtccc

[0112] ttctctgctg taa

[0113] EcAsnA-pET-28a was prepared.

[0114] (2) Obtaining of the recombinant bacteria

[0115] After obtaining the recombinant expression plasmid EcAsnA-pET-28a, it was transformed into E. coli BL21(DE3), and the positive engineering bacteria was named EcAsnA-pET-28a-BL21(DE3).

[0116] The recombinant expression plasmid EcAsnA-pET-28a was used as a template, and PCR amplification was performed using primers L109A-F (gtctttctccgGCAcactcggtct at) and L109A-R (caacatagaccgagtgTGCcggagaa), and then the PCR product was transformed into E. coli BL21(DE3), and the positive engineering bacteria was named EcAsnA-pET-28a-BL21(DE3). The plasmid EcAsnA-pET-28a-BL21(DE3) was used as a template, and PCR amplification was performed using primers T44I-F (gtgtgggggatggcATTcaggataact) and T44I-R (cgacaagttatcctgAATgccatccccc), and then the PCR product was transformed into E. coli BL21(DE3), and the positive engineering bacteria was named EcAsnA-pET-28a-BL21(DE3). L109A L109A L109A / T44I

[0117] The recombinant vectors EcAsnA-pET-28a and EcAsnA-pET-28a were prepared, respectively. L109A / T44I

[0118] 2. Construction of the mutant:

[0119] ​​​​The primers for designing the single mutation site and the three mutation sites of EcAsnA were designed as shown in Table 1. The recombinant vector EcAsnA-pET-28a constructed in step 1 was used as a template for the mutation construction by whole plasmid PCR.

[0120] Table 1: Mutation primer sequences

[0121]

[0122] The PCR amplification system was prepared using the Prime Star Max system. The recombinant plasmid EcAsnA-pET-28a was used as a template, and the primers shown in Table 1 were used for PCR. The Prime Star Max system is shown in Table 2. The PCR reaction conditions were as follows: ① 98℃ for 30s; ② 98℃ for 10s; ③ 55℃ for 30s; ④ 72℃ for 1min 20s; ⑤ the three steps of ②-④ were cycled for 34 times; ⑥ 72℃ for 10min; and ⑦ 12℃ for incubation.

[0123] Table 2: Prime Star Max system table

[0124]

[0125] The above PCR reaction system was incubated at 37℃ in a metal bath for 30min to digest the plasmid template (the digestion system was: DpnI quick 0.3μL, the above reaction PCR product 8.7μL, 10×T Buffer 1μL). The digestion product was obtained after the digestion was completed.

[0126] Transformation: The above digestion product was introduced into the E. coli BL21(DE3) competent cells by heat shock method.

[0127] The recombinant strains containing different mutants were prepared, respectively.

[0128] Example 2: Screening of single mutation site

[0129] The strains expressing different site mutants obtained in Example 1 were screened, respectively

[0130] 1. Screening of Q66 mutant strain

[0131] The single colonies with correct sequencing were picked and inoculated in 0.05mg / mL kanamycin-containing LB liquid medium, and incubated at 220rpm and 37℃ for 12h. The seed liquid was prepared, respectively.

[0132] The prepared seed culture was transferred into TB liquid medium at an inoculation rate of 2% and cultured at 220 rpm and 37°C. After culturing for 2-3 hours, IPTG was added to a final concentration of 0.2 mM and induced at 25°C for 16 hours. Then, the cells were collected by centrifugation at 10,000 rpm for 30 minutes.

[0133] A 10 ml reaction mixture (pH 8.0) was prepared, containing 200 mM L-aspartic acid, 200 mM NH4Cl, 200 mM MgCl2, and 200 mM ATP. Bacterial cells were added to a final concentration of 20 g / L, and the mixture was reacted at 37 °C for 30 min at 220 rpm. After the reaction, the mixture was centrifuged at 10,000 rpm for 60 min. The supernatant was diluted 50-fold and filtered through a 0.22 μm microfiltration membrane. The L-aspartic acid yield was determined by HPLC. The results are shown below. Figure 1 As shown.

[0134] The results showed that L-asparagine was successfully prepared by whole-cell catalysis using recombinant strains expressing AsnA mutants (Q66 mutated to Ile, Asn, Ala, Phe, Thr, Ser, Gly, Pro, Val, Arg, Leu, Lys, Tyr, Cys, and His, respectively). The yields of L-asparagine were 6.16 g / L, 6.47 g / L, 6.86 g / L, 6.11 g / L, 6.78 g / L, 6.12 g / L, 7.31 g / L, 7.41 g / L, 7.70 g / L, 7.73 g / L, 8.14 g / L, 6.74 g / L, 7.10 g / L, 7.29 g / L, and 7.12 g / L, respectively.

[0135] L-Asparagine was prepared using a recombinant strain expressing wild-type AsnA, with a yield of 4.98 g / L.

[0136] 2. Screening of K58 mutant strains

[0137] Following the method in Example 1, Lys at position 58 was mutated to another amino acid, and whole-cell catalysis was performed according to step 1. The results are as follows: Figure 2 As shown, L-asparagine was prepared by whole-cell catalysis using recombinant strains expressing AsnA mutants of Lys mutated to Phe, Ile, His, Tyr, Cys, Asn, Gln, Arg, Ser, Ala, and Leu, respectively. The yields of L-asparagine were 10.31 g / L, 9.59 g / L, 9.34 g / L, 9.25 g / L, 10.38 g / L, 9.24 g / L, 12.31 g / L, 9.46 g / L, 9.76 g / L, 9.80 g / L, 8.79 g / L, and 9.25 g / L, respectively.

[0138] 3. Screening of R105 mutant strains

[0139] The Arg at position 105 was mutated to other amino acids according to the method of Example 1, and whole-cell catalysis was performed according to the method of Step 1, and the results are shown in Table 2. Using the recombinant strains expressing AsnA mutants in which Arg was mutated to Leu, Val, Tyr, Pro, Glu, Cys, Gly, Gin, Phe and lie, respectively, whole-cell catalysis was performed to produce L-asparagine, and the yields of L-asparagine were 9.06 g / L, 7.93 g / L, 7.70 g / L, 8.86 g / L, 7.07 g / L, 6.96 g / L, 7.66 g / L, 8.46 g / L, 8.53 g / L and 11.33 g / L, respectively. Figure 3

[0140] 4. Screening of D104 mutant strains

[0141] The Asp at position 104 was mutated to other amino acids according to the method of Example 1, and whole-cell catalysis was performed according to the method of Step 1, and the results are shown in Table 3. Using the recombinant strains expressing AsnA mutants in which Asp was mutated to Thr, lie, Val, Ala, Pro, Glu, Leu, Lys and Arg, respectively, whole-cell catalysis was performed to produce L-asparagine, and the yields of L-asparagine were 7.76 g / L, 7.48 g / L, 7.23 g / L, 7.52 g / L, 7.71 g / L, 7.93 g / L, 7.49 g / L, 7.50 g / L and 7.47 g / L, respectively. Figure 4

[0142] 5. Screening of K53 mutant strains

[0143] The Lys at position 53 was mutated to other amino acids according to the method of Example 1, and whole-cell catalysis was performed according to the method of Step 1, and the results are shown in Table 4. Using the recombinant strains expressing AsnA mutants in which Lys was mutated to Phe, lie, His, Asn, Gin, Arg and Ser, respectively, whole-cell catalysis was performed to produce L-asparagine, and the yields of L-asparagine were 10.31 g / L, 9.59 g / L, 9.34 g / L, 12.31 g / L, 9.46 g / L, 9.76 g / L, 9.80 g / L and 9.76 g / L, respectively. Figure 5

[0144] 6. Screening of R210 mutant strains

[0145] The Arg at position 210 was mutated to other amino acids according to the method of Example 1, and whole-cell catalysis was performed according to the method of Step 1, and the results are shown in Table 5. Using the recombinant strains expressing AsnA mutants in which Arg was mutated to Leu, Val, Tyr, Pro, Glu, Cys, Gly, Gin, Phe and lie, respectively, whole-cell catalysis was performed to produce L-asparagine, and the yields of L-asparagine were 9.06 g / L, 7.93 g / L, 7.70 g / L, 8.86 g / L, 7.07 g / L, 6.96 g / L, 7.66 g / L, 8.46 g / L, 8.53 g / L and 11.33 g / L, respectively. Figure 6 ​​​As shown, the recombinant strains expressing AsnA mutants with Arg mutated to Ala and Pro, respectively, were used to catalyze the preparation of L-asparagine with the whole cells, and the yield of L-asparagine was 6.39 g / L and 7.95 g / L, respectively. When Arg was mutated to other amino acids, the yield of L-asparagine decreased to different degrees.

[0146] Example 3: Screening of combined mutant strains

[0147] Primers for EcAsnA were designed, as shown in Table 1, and full-plasmid PCR was performed on the recombinant vector EcAsnA constructed in Example 1 L109A / T44I -pET-28a was used as a template for mutant construction.

[0148] According to the method of Example 1, recombinant strains containing three mutants were prepared, respectively:

[0149] EcAsnA L109A / T44I / Q66L -pET-28a-BL21(DE3), EcAsnA L109A / T44I / R105I -pET-28a-BL21(DE3), EcAsnA L109A / T44I / R105P -pET-28a-BL21(DE3), EcAsnA L109A / T44I / D104K -pET-28a-BL21(DE3), EcAsnA L 109A / T44I / K53N -pET-28a-BL21(DE3), EcAsnA L109A / T44I / R210P -pET-28a-BL21(DE3), EcAsnA L109A / T44I / K58R -pET-28a-BL21(DE3).

[0150] Meanwhile, according to the method disclosed in CN118460485A, a strain expressing L109K / K58R mutant, EcAsnA, was prepared L109K / K58R -pET-28a-BL21(DE3), EcAsnA L109K -pET-28a-BL21(DE3), as a control.

[0151] Example 4: Study on the enzymatic properties of mutant enzymes

[0152] 1. Enzyme activity detection of mutant and wild-type enzymes

[0153] (1) Preparation of pure enzyme solution:

[0154] EcAsnA-pET28a-BL21(DE3), EcAsnA L109A -pET28a-BL21(DE3), EcAsnA L109K-pET28a-BL21(DE3), EcAsnA L109A / T44I -pET28a-BL21(DE3), EcAsnA L109K / K58R -pET28a-BL21(DE3), EcAsnA L109A / T44I / Q66L -pET28a-BL21(DE3), EcAsnA L109A / T44I / D104K -pET28a-BL21(DE3), EcAsnA L 109A / T44I / K58R -pET28a-BL21(DE3), EcAsnA L109A / T44I / R105P -pET28a-BL21(DE3), EcAsnA L109A / T44I / K53N -pET28a-BL21(DE3), EcAsnA L109A / T44I / R210P -pET28a-BL21(DE3) strains were inoculated into 3 mL LB liquid medium respectively, and incubated at 37 °C overnight.

[0155] Subsequently, 2% inoculation was transferred to 150 mL TB liquid medium, and incubated at 220 rpm, 37 °C. When the OD 600 value was between 0.4-0.8, 0.4 mM IPTG was added, and the culture was induced at 25 °C for 16 h. The bacterial cells were collected by centrifugation.

[0156] The bacterial cells were resuspended by adding 10 mL binding buffer A (25 mM Tris-HCl, 250 mM NaCl, 20 mM imidazole, pH 8.0 adjusted with HC1), and then the centrifuge tube was placed in an ice bath and put into an ultrasonic cell disruptor. The ultrasonic disruption conditions were as follows: working time 3.5 s, interval time 2.5 s, and a total of 10 min. The obtained cell disruption solution was subjected to low-temperature high-speed centrifugation, and after centrifugation at 4 °C, 10000 rpm for 30 min, a nickel column (5 mL) equilibrated with 25 mL binding buffer A was added. After the cell disruption solution was completely drained, 50 mL binding buffer A was added to wash the nickel column, and then 10 mL binding buffer B (25 mM Tris-HCl, 250 mM NaCl, 500 mM imidazole, pH 8.0 adjusted with HC1) was added to elute the target protein EcAsnA from the nickel column. Finally, the protein eluate was concentrated using a 30 kDa ultrafiltration tube, and 0.2 M Tris-HCl (pH 8.0) was used to replace 3-5 times to remove high-concentration imidazole.

[0157] The following pure enzymes were prepared respectively: EcAsnA wild type, mutant EcAsnA L109A , EcAsnA L109K , EcAsnA L 109A / T44I , EcAsnAL109K / K58R and EcAsnA L109A / T44I / Q66L , EcAsnA L109A / T44I / D104K , EcAsnA L109A / T44I / K58R , EcAsnA L109A / T44I / R105P , EcAsnA L109A / T44I / K53N and EcAsnA L109A / T44I / R210P .

[0158] (2) Detection of specific enzyme activity

[0159] After mixing 200 mM L-aspartate, 200 mM NH4Cl, 200 mM MgCl2, 200 mM ATP, adjusting the pH to 8.0 with ammonia water, the enzyme was added at a concentration of 0.5 mg / ml, and the reaction was carried out at 37°C for 30 min at a rotation speed of 220 rpm. After the reaction was terminated with 50 mM HCl, the content of L-asparagine was detected by OPA derivatization method, and the contents of L-aspartate and L-asparagine were determined by HPLC method. The specific steps are described in the literature Anal. Biochem., 1984, 136(1): 195-201 (A high-performance liquid chromatography assay for asparagine synthetase). The enzyme activity of asparagine synthetase A is defined as 1 μmol of L-asparagine produced per minute. -1 L-asparagine.

[0160] The results are shown in Figure 8 , EcAsnA wild type , mutant EcAsnA L109A , EcAsnA L109K , EcAsnA L109A / T44I , EcAsnA L109K / K58R , EcAsnA L109A / T44I / Q66L , EcAsnA L109A / T44I / D104K , EcAsnA L109A / T44I / K58R , EcAsnA L109A / T44I / R105P , EcAsnA L109A / T44I / K53N and EcAsnA L109A / T44I / R210P The specific enzyme activities of EcAsnA 497.15 , 1785.14 U / mg, 2079.51 U / mg, 1969.88 U / mg, 2603.64 U / mg, 3222.5 1 U / mg , 1469.98 U / mg, 2447.38 U / mg, 1383.21 U / mg, 2069.13 U / mg and 1738.55 U / mg.

[0161] The optimal mutant EcAsnA L109A / T44I / Q66L is EcAsnAL109K / K58R These figures represent increases of 5.48 times and 23.77%, respectively.

[0162] 2. Thermal stability study

[0163] The mutant EcAsnA L109A / T44I / Q66L The purified enzyme, following the method in step 1, was incubated at 20, 25, 30, 37, and 45°C for 30 min, 60 min, 120 min, 300 min, and 600 min, respectively, and its activity was measured. The results are as follows: Figure 9 As shown, the mutant EcAsnA L109A / T44I / Q66L It is rapidly inactivated after incubation at 45℃ for 120 min. When the incubation temperature does not exceed 37℃, the activity remains essentially unchanged within 300 min, and decreases by 10-20% after 600 min.

[0164] Therefore, it can be concluded that when the reaction temperature does not exceed 37℃, the mutant EcAsnA L109A / T44I / Q66L Its reactivity is relatively stable.

[0165] 3. pH stability study

[0166] The mutant EcAsnA L109A / T44I / Q66L The purified enzyme, following the method in step 1, was incubated in buffer solutions with pH values ​​of 4, 5, 6, 7.4, 8, 9, 10, and 11 for 60 min, 120 min, 180 min, 300 min, and 600 min, respectively, and the enzyme activity was measured. The results are as follows: Figure 10 As shown, the mutant EcAsnA L109A / T44I / Q66L The mutant EcAsnA rapidly inactivated after incubation for 60 min in buffer solutions with pH 4 and 5; when the buffer solution pH was 11, the activity decreased by approximately 10% after 600 min of incubation; and the mutant EcAsnA showed increased activity at pH values ​​between 6 and 10. L109A / T44I / Q66L The activity remains essentially unchanged. Therefore, it can be concluded that the mutant EcAsnA... L109A / T44I / Q66L It exhibits good reaction stability at pH values ​​of 6-10.

[0167] Example 5: Whole-cell catalytic preparation of L-asparagine

[0168] The specific steps are as follows:

[0169] EcAsnA-pET28a-BL21(DE3) and EcAsnA were respectively... L109A -pET28a-BL21(DE3),EcAsnA L109K -pE T28a-BL21(DE3),EcAsnA L109A / T44I -pET28a-BL21(DE3),EcAsnA L109K / K58R-pET28a-BL21(DE3), EcAsnA L109A / T44I / Q66L -pET28a-BL21(DE3), EcAsnA L109A / T44I / D104K -pET28a-BL21(DE3), EcAsnA L 109A / T44I / K58R -pET28a-BL21(DE3), EcAsnA L109A / T44I / R105P -pET28a-BL21(DE3), EcAsnA L109A / T44I / K53N -pET28a-BL21(DE3), EcAsnA L109A / T44I / R210P -pET28a-BL21(DE3) strains were inoculated in LB liquid medium containing 0.05 mg / mL kanamycin, and incubated at 220 rpm and 37°C for 12 h, and then seed liquid was prepared;

[0170] The prepared seed liquid was inoculated into TB liquid medium at a ratio of 2% (v / v), and incubated at 220 rpm and 37°C; after 2-3 h, 0.2 mM IPTG was added, and the mixture was induced at 25°C for 16 h, and then centrifuged at 10,000 rpm for 30 min to collect bacterial cells.

[0171] A reaction system (pH 8.0) containing 200 mM L-aspartate, 200 mM NH4Cl, 200 mM MgCl2, 200 mM ATP was prepared, and 20 g / L bacterial cells were added to the reaction system, and the mixture was incubated at 37°C for 30 min at a rotation speed of 220 rpm. After the reaction, the mixture was centrifuged at 10,000 rpm for 60 min, and the supernatant was diluted 50 times, filtered through a 0.22 μm microfiltration membrane, and then the L-asparagine yield was determined by HPLC.

[0172] The results show that EcAsnA L109A / T44I / Q66L The production intensity of -pET28a-BL21(DE3) is significantly higher than that of EcAsnA L109K / K58R The production intensity of -pET28a-BL21(DE3) is significantly higher than that of EcAsnA Figure 7 .

[0173] Although the present application has been disclosed with reference to the preferred embodiments above, it is not intended to limit the present application, and any person skilled in the art can make various modifications and modifications without departing from the spirit and scope of the present application, and therefore the protection scope of the present application should be defined by the claims.

Claims

1. A mutant of asparagine synthetase A, characterized in that, The asparagine synthetase A mutant is obtained by mutating the leucine at position 109 to alanine, mutating the threonine at position 44 to isoleucine, and mutating the glutamine at position 66 to leucine of the asparagine synthetase A with the amino acid sequence shown in SEQ ID NO.

1.

2. A gene encoding the asparagine synthetase A mutant of claim 1 or a recombinant vector carrying the gene.

3. A recombinant cell expressing the mutant of claim 1 or carrying the gene of claim 2 or the recombinant vector, preferably, the recombinant cell is a bacterial or fungal host cell.

4. A recombinant enzyme catalyst comprising the asparagine synthetase A mutant of claim 1, wherein, is any one of the following forms: (1) culturing the recombinant expression transformant containing the asparagine synthetase A mutant, and isolating the transformant cell containing the recombinant asparagine synthetase A mutant enzyme; (2) culturing the recombinant expression transformant containing the asparagine synthetase A mutant, isolating the transformant cell containing the recombinant asparagine synthetase A mutant enzyme, and obtaining the cell disruption solution by disrupting the transformant cell containing the recombinant asparagine synthetase A mutant enzyme; (3) culturing the recombinant expression transformant containing the asparagine synthetase A mutant, isolating the transformant cell containing the recombinant asparagine synthetase A mutant enzyme, obtaining the cell disruption solution by disrupting the transformant cell containing the recombinant asparagine synthetase A mutant enzyme, and obtaining the freeze-dried enzyme powder by freeze-drying the recombinant asparagine synthetase A mutant enzyme cell disruption solution.

5. A method for increasing the catalytic activity of asparagine synthetase A on a substrate and increasing the specific enzyme activity, characterized in that, The method is to mutate the leucine at position 109 to alanine, mutate the threonine at position 44 to isoleucine, and mutate the glutamine at position 66 to leucine of the asparagine synthetase A with the amino acid sequence shown in SEQ ID NO.

1.

6. A method for increasing the production of L-asparagine, characterized in that, The method is to react to prepare L-asparagine using the mutant of claim 1, the recombinant cell of claim 3, or the recombinant enzyme catalyst of claim 4 as a catalyst, with L-aspartic acid and NH4Cl as substrates.

7. A genetically engineered bacterium, characterized by, The genetically engineered bacteria are Escherichia coli as a chassis cell, The genetically engineered bacteria express the asparagine synthetase A mutant of claim 1.

8. A process for the preparation of L-asparagine, characterized in that, The method is to add the asparagine synthetase A mutant of claim 1, the recombinant cell of claim 3, the genetically engineered bacteria of claim 7, the recombinant asparagine synthetase A mutant enzyme prepared using the genetically engineered bacteria of claim 7, or the recombinant enzyme catalyst of claim 4 into a system containing L-aspartic acid and NH4Cl for degradation.

9. The method according to claim 6 or 8, characterized in that, The system also contains MgCl2, ATP; Preferably, the concentration of NH4Cl is 150-250 mM; the concentration of MgCl2 is 150-250 mM, the concentration of ATP is 150-250 mM, and the concentration of L-aspartic acid is 150-250 mM. Preferably, in the system, the reaction conditions are as follows: pH is 7.5-8.5, temperature is 30-40℃, reaction time is 30-90 min, and rotation speed is 200-300 rpm.

10. Use of the asparagine synthetase A mutant of claim 1, or the gene or recombinant carrier of claim 2, or the recombinant cell of claim 3, or the recombinant enzyme catalyst of claim 4, or the genetically engineered bacterium of claim 7 in the preparation of L-asparagine or a product containing L-asparagine.

Images