Phloem specific expression promoter and application thereof
By using the rice OsMT3a promoter to drive gene expression in plants, the problems of precision of gene expression and the influence of transporter localization in plants were solved, achieving efficient constitutive expression in the phloem and ensuring the safety of transgenic plants.
Patent Information
- Application Number
- CN202410712726.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-04
- Publication Date
- 2025-12-05
AI Technical Summary
The technical challenges that have not yet been effectively addressed in the existing technology are how to maintain high expression in various plant tissues and throughout the entire developmental stage, how to ensure the precision of specific regulatory gene expression, and how the polar localization of transport proteins affects the correct functional execution.
Using the OsMT3a promoter derived from rice, a recombinant plasmid containing the OsMT3a promoter and a recombinant Agrobacterium engineered strain were constructed. The Agrobacterium-mediated transformation was then used to transform the plasmid into plants, achieving efficient constitutive expression of the target gene in the phloem.
This technology enables efficient expression of exogenous genes in the phloem of plants, improving the safety and accuracy of gene expression in transgenic plants and avoiding abnormal growth phenotypes.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of plant genetic engineering, and particularly relates to a phloem-specific expression promoter and application thereof in promoting plant expression of a target gene or in cultivating a transgenic plant variety. BACKGROUND
[0002] The promoter of a gene is an important cis-element for regulating gene expression, a DNA sequence located on the upstream of the 5' end of a gene, which can activate RNA polymerase to accurately bind with a template DNA and initiate transcription, and is also regulated by other transcription factor proteins to realize accurate spatiotemporal transcription of proteins. According to functions and transcription modes, promoters can be divided into constitutive promoters (widely expressed promoters), tissue-specific promoters and inducible promoters. At present, constitutive promoters (such as CaMV35S, ZmUbiquitin) are widely used in plant genetic engineering to drive key genes of excellent traits to cultivate ideal rice varieties. Although constitutive promoters can drive a target gene to be continuously highly expressed in various tissues of a plant and at all development stages, sometimes, the constitutive promoters will change the polar localization of transport proteins to affect correct function execution.
[0003] With the increasingly wide application of transgenic plants, it is of great value to cultivate high-yield, high-quality, disease-resistant, stress-resistant and nutrition-efficient rice varieties by exploring more promoters for accurately regulating gene expression. SUMMARY
[0004] In rice research, we have found an OsMT3 promoter derived from rice, which can drive a target gene to be highly expressed in the phloem of a plant, and has the potential to provide a molecular element for accurately designing an ideal rice, and can improve the safety of a transgenic plant. Therefore, the present application comprises the following technical solutions.
[0005] A first aspect of the present application provides a promoter capable of improving the expression level of a target gene in a plant, which is a polynucleotide selected from the following group:
[0006] (a) a polynucleotide with a nucleotide sequence as shown in SEQ ID NO: 1, which is a promoter capable of regulating gene expression in the phloem of rice. Since the promoter was initially found to drive the expression of a gene OsMT3a in rice, it is still named as "OsMT3a promoter" herein;
[0007] (b) a polynucleotide with a nucleotide sequence having a homology of ≥95%, preferably ≥96%, preferably ≥97%, preferably ≥98%, more preferably ≥99% to the nucleotide sequence shown in SEQ ID NO: 1, which has the function of SEQ ID NO: 1, i.e. the function of driving a target gene to be highly expressed in the phloem of a plant;
[0008] (c) a nucleotide sequence complementary to the nucleotide sequence described in (a) or (b).
[0009] The above-mentioned plant can be a crop, preferably a Poaceae crop. The crop includes but is not limited to rice, wheat, corn, soybean, barley, oat, rye, sorghum, cotton, vegetable, cruciferous plant (e.g. Arabidopsis thaliana).
[0010] In one embodiment, the above-mentioned gene of interest is expressed in phloem of plant tissue.
[0011] Preferably, the expression of the above-mentioned gene of interest is constitutively high.
[0012] The second aspect of the present application provides a gene expression cassette / expression frame comprising the above-mentioned promoter and a gene of interest downstream of the promoter, which is placed under the regulation of the promoter.
[0013] The third aspect of the present application provides a recombinant plasmid comprising the above-mentioned gene expression cassette / expression frame, which is formed by cloning the gene expression cassette / expression frame in a plasmid vector suitable for expression in Agrobacterium, such as a plant transgene vector or a modified vector, for example, pHB-YFP, pHB-FLAG, pBin19, fluorescent reporter vector pGreenII0800-LUC, pCAMBIA3300, pCAMBIA1301, pCAMBIA2301, pBI121, pTF102, etc.
[0014] The fourth aspect of the present application provides a microbial engineering bacterium comprising the above-mentioned recombinant plasmid, which is used to mediate the transfer of the above-mentioned recombinant plasmid into a plant, such as rice, corn or tobacco, etc. Preferably, the microbial engineering bacterium is Agrobacterium, such as Agrobacterium tumefaciens, Agrobacterium EHA105, Agrobacterium GV3101. For example, the above-mentioned recombinant plasmid is transferred into Agrobacterium strain by heat shock method or freeze-thaw method to form the microbial engineering bacterium.
[0015] The fifth aspect of the present application provides the use of the above-mentioned promoter, gene expression cassette / expression frame, the above-mentioned recombinant plasmid, the above-mentioned microbial engineering bacterium in promoting the expression of a gene of interest in a plant, or in cultivating a transgenic plant variety.
[0016] In one embodiment, the above-mentioned use is achieved by the following method for promoting the expression of a gene of interest in a plant:
[0017] (i) placing an endogenous gene of interest in the plant chromosome under the regulation of the above-mentioned promoter, such as OsMT3a promoter, and screening to obtain a positive transgenic plant; and / or
[0018] (ii) integrating the above-mentioned gene expression cassette / expression frame as an exogenous gene into the plant chromosome genome, and screening to obtain positive transgenic plants.
[0019] Alternatively, the above-mentioned method (i) is implemented by the following steps:
[0020] (i-1) transforming a plant plant with a recombinant plasmid comprising the above-mentioned promoter, such as the OsMT3a promoter, by Agrobacterium-mediated method to obtain a transgenic plant expressing the promoter; or integrating the above-mentioned promoter, such as the OsMT3a promoter, into the plant cell genome by gene editing technology to obtain a transgenic plant expressing the promoter;
[0021] Method (ii) is implemented by the following steps:
[0022] (ii-1) transforming a plant plant with a recombinant plasmid comprising the above-mentioned gene expression cassette / expression frame by Agrobacterium-mediated method to obtain a transgenic plant expressing the promoter and the exogenous target gene; or integrating the above-mentioned gene expression cassette / expression frame into the plant cell genome by gene editing technology to obtain a transgenic plant expressing the promoter and the exogenous target gene
[0023] The above-mentioned gene editing technology can be selected from the group consisting of homologous double exchange, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system or CRISPR-Cas12 system, CRISPR-BEST system, MuGENT.
[0024] The sixth aspect of the present application provides a kit for identifying a transgenic plant comprising a nucleotide sequence of the OsMT3a promoter as shown in SEQ ID NO: 1 in the genome, which comprises the following PCR primer pairs:
[0025] Forward primer proOsMT3a-F: 5'-GAATCCATTTGGCCTCCCTCAA-3' (SEQ ID NO: 2);
[0026] Reverse primer proOsMT3a-R: 5'-GGTCGAAGATTTAATTAGCTAA-3' (SEQ ID NO: 3).
[0027] Preferably, the above-mentioned kit further comprises a nucleic acid extraction system for extracting total RNA or DNA from a plant plant or grain, and / or a reverse transcription system for reverse transcription into cDNA.
[0028] Further, the above-mentioned kit further comprises an instruction manual, which records the operation steps of extracting plant RNA or DNA, the steps of detecting the nucleotide sequence of the OsMT3a promoter shown in SEQ ID NO: 1, and the identification criteria.
[0029] For example, the above-mentioned instruction manual can be written on the bottle, test tube and the like, plate, or on a separate paper, or on the outside or inside of the container, for example, a paper with an operation demonstration video APP download window such as a two-dimensional code, and the instruction manual can also be in the form of multimedia, such as a CD, a U disk, a network disk, etc.
[0030] The present application finds that the nucleotide sequence of the OsMT3a promoter shown in SEQ ID NO: 1 can efficiently drive the constitutive high expression of an exogenous protein gene in rice tissues, especially in the phloem, and the exogenous protein gene is not limited to the endogenous transport protein OsMT3a of rice itself, for example, it can drive the expression of the reporter gene GUS (β-glucuronidase gene) in rice leaves to reach 20 times the level of Histone H3, and is highly expressed in the phloem. The OsMT3a promoter can be used to precisely modify the transport protein to regulate nutrient distribution and heavy metal control in the phloem, and to create new varieties of plants. BRIEF DESCRIPTION OF DRAWINGS
[0031] Figure 1 The expression levels of the OsMT3a gene in each tissue part of the transgenic rice at 3 weeks and 14 weeks are shown. These tissues include the root, basal stem, leaf sheath, leaf blade, lower leaf blade, lower leaf sheath, second node from the bottom (Node II), internode I, first node from the bottom (Node I), flag leaf blade, flag leaf sheath, rachis, and spikelet.
[0032] Figure 2The photos of the spatio-temporal expression activity analysis of OsMT3a promoter are shown. Among them, A-B: GUS staining of seedling stage seedlings (Fig. A) and leaves (Fig. B) of OsMT3a promoter driven GUS transgenic plants, Fig. A is the transgenic plant, and the lower edge is the negative control wild type ZH11; C-D: cross section (Fig. C) and its enlarged view (Fig. D) of the leaf of the OsMT3a pro:GUS transgenic plant after GUS staining; E-G: distribution characteristics of red fluorescent protein in the leaf (E) and its cross section (F and G) of the OsMT3a pro:RFP transgenic plant; the red arrow indicates the phloem, X indicates the xylem, and the yellow circle indicates the vascular sheath cell. DETAILED DESCRIPTION
[0033] The purpose of the present application is to provide an OsMT3a promoter derived from rice and its application, which can drive the high expression of a target gene in the phloem of a plant, provide a molecular element for precisely designing an ideal rice, and improve the safety of a transgenic plant.
[0034] We first found that a promoter derived from rice (OsMT3a promoter, nucleotide sequence is SEQ ID NO: 1) can drive the constitutive high expression of an exogenous target gene, which shows a broad adaptability, and is suitable for the overexpression of an exogenous target gene in a plant such as rice, especially the overexpression of an exogenous gene in the phloem of a plant such as rice.
[0035] Although the overexpression of an exogenous protein gene in a plant often leads to genetic instability of plant biological traits and growth phenotypes, we found that the overexpression of an exogenous gene such as the OsMT3a gene driven by the OsMT3a promoter in rice does not observe abnormal growth phenotypes, i.e., the constitutive high expression of an exogenous gene in rice is regulated.
[0036] The mode of using the OsMT3a promoter to regulate the expression of a target gene in a transgenic plant includes (i) placing an endogenous target gene in the plant chromosome under the regulation of the above-mentioned promoter such as the OsMT3a promoter; and / or
[0037] (ii) integrating an expression cassette / expression frame comprising the OsMT3a promoter and the target gene into the plant chromosome genome.
[0038] In the description of the technical solutions of the present application, the term "and / or" used in terms such as "A and / or B", "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).
[0039] It is easy for those skilled in the art to understand that when the OsMT3a promoter is applied to express foreign genes in plants, it can be introduced into plants by Agrobacterium-mediated method, for which a recombinant plasmid expressing the OsMT3a promoter and the foreign gene and a recombinant Agrobacterium engineering strain need to be constructed, and the plant plants are transformed by Agrobacterium-mediated method.
[0040] The present application will be further described in detail below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present application and are not used to limit the scope of the present application.
[0041] Examples
[0042] In the examples, the addition amount, content and concentration of various substances are involved, wherein the percentage content refers to the mass percentage content unless otherwise specified.
[0043] In the examples herein, if no specific description is made for the reaction temperature or operating temperature, the temperature generally refers to room temperature (15-30℃).
[0044] The molecular biology experiments in the examples include plasmid construction, enzyme digestion, preparation of competent cells, transformation, etc., which are mainly carried out according to Molecular Cloning: A Laboratory Manual (3rd Edition), J. Sambrook, D. W. Russell (USA) editors, Huang Peitang et al. translation, Science Press, Beijing, 2002). For example, the competent cell transformation method and the preparation method of competent cells are carried out according to Molecular Cloning: A Laboratory Manual (3rd Edition) Chapter 1 page 96. If necessary, the specific experimental conditions can be determined by simple tests.
[0045] The PCR amplification experiment is carried out according to the reaction conditions or kit instructions provided by the plasmid or DNA template supplier. If necessary, it can be adjusted by simple tests.
[0046] The primer synthesis and gene sequencing in the examples are completed by Shengong Bioengineering (Shanghai) Co., Ltd.
[0047] Example 1: Analysis of OsMT3a gene expression characteristics
[0048] 1. RNA extraction and synthesis of its cDNA:
[0049] RNA extraction:
[0050] 1) Take rice tissue samples stored in an ultra-low temperature freezer at -80℃ or freshly taken and soaked in liquid nitrogen. For mature samples such as nodes, rachis, and internodes, which are relatively hard, weigh them and quickly transfer them to a mortar pre-cooled with liquid nitrogen. Add liquid nitrogen at least 5 times and grind them thoroughly until they are powdery. For tender tissues such as roots and leaves in the seedling stage, weigh them and put them into a 1.5mL centrifuge tube. Add 2 1mm steel balls that have been burned with ethanol and grind them thoroughly with the metal module of the shaker.
[0051] 2) Transfer the ground powder to a 1.5 mL centrifuge tube, add 1 mL of RNAiso Plus directly to the shaken sample, let stand at room temperature for 5 min, and centrifuge at 12000 rpm and 4℃ for 5 min.
[0052] 3) Transfer 800 μL of supernatant to a new 1.5 mL centrifuge tube, add 200 μL of chloroform, mix by inverting the tube until the solution is milky white, let stand at room temperature for 5 min; centrifuge at 12000 rpm and 4℃ for 15 min. The homogenate after centrifugation will separate into three layers: a colorless supernatant (containing RNA), a middle white protein layer, and a colored lower organic phase.
[0053] 4) Transfer 400 μL of supernatant to another new 1.5 mL centrifuge tube, add 400 μL of isopropanol to the supernatant, mix thoroughly by inverting the tube, and let stand at room temperature for 10 min; centrifuge at 12000 rpm and 4℃ for 10 min.
[0054] 5) Discard the supernatant, add 1 mL of 75% ethanol, invert the centrifuge tube to wash the wall thoroughly, centrifuge at 7500 rpm and 4℃ for 5 min; discard the supernatant, centrifuge briefly for 30 s to wash away excess ethanol, place it in a clean bench to dry at room temperature for several minutes, and add an appropriate amount of RNase-free water to dissolve the precipitate.
[0055] cDNA synthesis:
[0056] 1) Removal of genomic DNA from RNA
[0057] Using Takara's PrimeScript TM The RT reagent kit with gDNA Eraser method involves preparing the reaction premix on ice according to the following proportions, then incubating in a 42°C water bath for 2-5 minutes.
[0058]
[0059] 2) cDNA reverse transcription reaction
[0060] PrimeScript RT reagent Kit with gDNA Eraser from Takara TM The reaction premix was prepared according to the following table on ice, and the cDNA was obtained after 37°C water bath for 15 min and 85°C water bath for 10 s, and stored in -20°C ultra-low temperature refrigerator for standby.
[0061]
[0062] 2. PCR amplification detection of OsMT3a gene expression level: the cDNA obtained in step 1 was used as a PCR template, and specific primers OsMT3a-F and OsMT3a-R were used to detect the expression of OsMT3a gene SEQ ID NO: 1 in rice ZH11 plants by Real-Time PCR.
[0063] Forward primer OsMT3a-RT-F: 5'-ATGTCGGACAAGTGCGGCAA-3';
[0064] Reverse primer OsMT3a-RT-R: 5'-TCACTTGCCGCACTTGCAGT-3'.
[0065] Figure 1 The relative expression level of OsMT3a gene in each tissue of rice ZH11 plant is shown.
[0066] It was found that OsMT3a gene was constitutively highly expressed in other tissues such as young leaves, young leaf sheaths, leaf blades, leaf sheaths, nodes, internodes, ear axes and young panicles, except for low expression in roots and stem base nodes; the expression in flag leaves was the highest, which was 20 times the level of Histone H3.
[0067] Example 2: Construction of transgenic rice plants with OsMT3a promoter driving GUS expression
[0068] 1. Construction of plasmid containing OsMT3a promoter and downstream GUS gene
[0069] Extraction of rice CJ06 genomic DNA:
[0070] 1) Take about 1 cm long CJ06 young leaves into a 2 mL centrifuge tube, add an appropriate amount of DNA extraction solution TPS, add a 5 mm diameter zirconium bead, and use a mixed type grinding instrument to crush, 56 Hz, 60 s;
[0071] 2) Then put the centrifuge tube in a 75°C oven for 1 h, then take it out, centrifuge at 12000 rpm for 10 min;
[0072] 3) Take 120 μL supernatant to 96-well plate, add equal volume of isopropyl alcohol, mix well, precipitate for 30 min, then centrifuge at 12000 rpm for 10 min, discard supernatant;
[0073] 4) Add 200 μL 75% ethanol, mix well, centrifuge at 12000 rpm for 5 min, discard supernatant;
[0074] 5) Dry the 96-well plate in a 75℃ oven for 10 min, then add 60 μL ddH2O to dissolve.
[0075] The TPS buffer formula is: 100 mM Tris-HCl (pH 8.0); 10 mM EDTA (pH 8.0); 1 M KCl.
[0076] OsMT3a promoter was amplified from the genome DNA of rice CJ06:
[0077] The reaction solution was prepared on ice according to the following components, and the other reagents except enzyme solution were mixed well. The reaction was performed by PCR System 9700 of GeneAmp Company. The commonly used two-step method is as follows: 94℃ pre-denaturation, 2 min; 98℃ denaturation for 10 s, 68℃ extension for 1 min / kb, 34 cycles; final extension at 68℃ for 7 min. Or three-step method: 94℃ pre-denaturation, 2 min; 98℃ denaturation for 10 s, 60℃ annealing for 30 s, 68℃ extension for 1 min / kb, 33 cycles; final extension at 68℃ for 7 min. After the reaction was completed, electrophoresis was performed, and the target fragment was recovered according to the size of the amplified fragment.
[0078]
[0079]
[0080] Primer proOsMT3a-GUS F:
[0081] CGACGGCCAGTGCCAAGCTTAAGCTTGAATCCATTTGGCCTCCCTCAA,
[0082] Primer proOsMT3a-GUS R:
[0083] AAGGGACTGACCACCCGGGGGATCCGGTCGAAGATTTAATTAGCTAA.
[0084] OsMT3a promoter fragment gel recovery:
[0085] 1) Cut the agarose gel containing the target DNA fragment under UV light and place it in a 1.5 mL centrifuge tube, add 400 μL Buffer DE-A, heat in a 65 °C water bath (the temperature of the water bath should not be too high, otherwise the lid of the centrifuge tube will directly collapse), until the gel block is completely melted;
[0086] 2) Add 200 μL Buffer DE-B and mix well; transfer to a 1 mL preparation tube, centrifuge at 12000 rpm for 1 min, and discard the filtrate;
[0087] 3) Put the 1 mL preparation tube back into a 2 mL centrifuge tube, add 600 μL Buffer W1, centrifuge at 12000 rpm for 30 s, and discard the filtrate;
[0088] 4) Put the 1 mL preparation tube back into a 2 mL centrifuge tube, add 700 μL Buffer W2 with anhydrous ethanol added, centrifuge at 12000 rpm for 30 s, discard the filtrate, repeat once, and then put the 1 mL preparation tube back into a 2 mL centrifuge tube, centrifuge at 12000 rpm for 2 min;
[0089] 5) Place the 1 mL preparation tube in a new 1.5 mL centrifuge tube, add 25-30 μL preheated deionized water to the center of the membrane at the bottom of the 1 mL preparation tube, stand at room temperature for a few minutes, centrifuge at 12000 rpm for 2 min to elute the DNA.
[0090] Vector digestion:
[0091] Using the NEB restriction enzyme method, prepare the reaction solution as follows: on ice, use a pipette to mix the components, place in a 37 °C incubator or water bath, 90 min, after the reaction is complete, run the gel, and according to the desired gel, recover the linearized vector fragment or insert fragment.
[0092]
[0093]
[0094] Homologous recombination
[0095] According to the method of ClonExpress II One Step Cloning Kit, prepare the following reaction system on ice, the molar ratio of vector to insert fragment is 1:2, use a pipette to mix gently, centrifuge, 37 °C for 30 min.
[0096]
[0097] E. coli transformation
[0098] Refrigerate the prepared super-competent cells DH5a on ice, take 10 μL of the recombination product or the ligation product and mix with 50-100 μL of the competent cells, shake the tube gently to mix, and incubate on ice for 10 min. Then, heat shock at 42°C for 90 s, and immediately cool on ice for 2-3 min. Spread the mixture evenly on a plate with the correct resistance using a sterile spreader, and incubate in a 37°C incubator for 12-16 h. The positive clones identified by colony PCR are sent to a sequencing company for sequencing. Shake the correct clones identified by sequencing, and store the bacterial strains at -80°C. 菌液 50%甘油 = 1:1, and store in a -80°C ultra-low temperature refrigerator.
[0099] After the above steps, the OsMT3a promoter-driven GUS gene expression plasmid is obtained.
[0100] 2. Construction of recombinant Agrobacterium EHA105 engineering bacteria
[0101] The above OsMT3a pro:GUS plasmid is transformed into the Agrobacterium strain EHA105 competent cells by electroporation, and spread on YEP solid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin. After incubation in a 28°C incubator for 48 h, single colonies are picked and subjected to PCR identification. The positive clones are inoculated into 3 mL of YEP liquid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and incubated at 28°C on a shaker for 16 h. Then, the culture is transferred into 30 mL of YEP liquid medium containing 50 mg / L kanamycin, 25 mg / L rifampicin, and 19.6 mg / L acetosyringone. After incubation at 28°C for 3 h, the bacteria are collected by centrifugation at 3500 rpm, and resuspended in infiltration solution to obtain the recombinant Agrobacterium EHA105 engineering bacteria overexpressing OsTLA1, which are used to transform rice calli.
[0102] 3. Agrobacterium-mediated transformation of rice calli
[0103] (1) Induction of rice calli: After the rice seeds are shelled, they are sterilized with 75% ethanol for 1 min, then with 2.5% sodium hypochlorite solution for 45 min, and rinsed with sterilized water for 6 times. Then, the seeds are sowed on NB medium, and incubated at 28°C in the dark to induce calli. After about 15 days, the calli are peeled off from the mature embryo shield and transferred to NB medium for subculture. The dense, smooth-surfaced, and light yellow embryogenic calli are selected for subculture every 7 days.
[0104] (2) Co-cultivation of recombinant Agrobacterium with rice callus: The well-grown callus was transferred into 100 mL sterilized Erlenmeyer flask, and then the callus was immersed with the recombinant Agrobacterium EHA105 liquid for 10 minutes at room temperature, during which the Erlenmeyer flask was shaken twice, and then the liquid was discarded. The callus was placed on sterile filter paper. After the excess liquid was absorbed, the callus was transferred to a culture dish with two layers of sterile filter paper, and co-cultivated at 26°C for 48 to 60 hours.
[0105] (3) Screening, differentiation and plant regeneration of resistant callus: The rice callus after completion of the co-cultivation stage was transferred to a selection medium containing 50 mg / L hygromycin and 100 mg / L carbenicillin for the first screening culture. After 7 days, the surviving callus was transferred to a selection medium containing 50 mg / L hygromycin and 50 mg / L carbenicillin for the second round of screening, and then the screening was performed every 7 days, for a total of 4 times. Then, the well-grown resistant callus was selected and transferred to a differentiation culture for 30 to 40 days of differentiation. The differentiated rice seedlings were cut off the roots and transferred to a rooting medium, and cultured at 26°C under light. When the seedlings grew to the mouth of the rooting medium, the sealing film was opened, and the seedlings were watered for 3 to 5 days, and then the seedlings were transplanted to the field.
[0106] Example 3: Investigation of the expression distribution of GUS in transgenic rice
[0107] 1. The ZH11 transgenic seedlings cultured in water for 7 days were sampled, and 2 mm-sized materials were taken at a distance of 3.5 cm from the root tip, embedded with 0.5% agarose, and the samples were trimmed well, and then sliced with a thickness of 50 μm using a shaking slicer.
[0108] 2. Preparation of GUS staining solution: X-Gluc (5-bromo-4-chloro-3-indolyl-β-D-glucuronide cyclohexylamine salt) powder was dissolved in DFM to prepare a 20 mM stock solution, and then diluted with GUS buffer to a final concentration of 1 mM working solution. The GUS buffer was prepared as follows: sodium phosphate monobasic 50 mM, sodium phosphate dibasic 50 mM, GUS 1 mM, EDTA 10 mM, potassium ferricyanide 2 mM, potassium ferrocyanide 2 mM, Triton X-100 0.1%, and the pH was adjusted to 8.0.
[0109] 3. The slices were placed in the GUS staining solution, and vacuumed for 30 minutes in a vacuum pump, and then continued to be stained in the dark at 37°C for 5 hours. After the staining was completed, the staining solution was discarded, and the slices were washed three times to remove the floating color. The slices were observed under a light microscope, and the results are shown in Figure 2 .
[0110] Figure 2The mid-AD pattern revealed the spatiotemporal distribution of GUS activity driven by the OsMT3a promoter in the leaf. Further analysis of the distribution of GUS staining in various leaf tissues using semi-thin sections revealed that the GUS fusion reporter gene was specifically distributed in the phloem structure.
[0111] Example 4: Construction of transgenic rice plants expressing RFP driven by the OsMT3a promoter
[0112] 1. Construction of plasmids containing the OsMT3a promoter and downstream RFP gene
[0113] The transgenic rice with OsMT3a promoter-driven RFP expression was constructed according to the method in Example 2, including the following steps:
[0114] Amplification of the OsMT3a promoter from rice CJ06 genomic DNA:
[0115] The Toyobo KOD FX Neo method was used. The reaction solution was prepared on ice with the following components, ensuring thorough mixing of all reagents except the enzyme solution. The reaction was performed using a GeneAmp PCR System 9700. A common two-step method is used: 94℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 68℃ extension for 1 min / kb, for a total of 34 cycles; final extension at 68℃ for 7 min. Alternatively, a three-step method can be used: 94℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 60℃ annealing for 30 s, 68℃ extension for 1 min / kb, for a total of 33 cycles; final extension at 68℃ for 7 min. After the reaction, electrophoresis was performed on a gel, and the target fragment was recovered from the gel according to the amplified fragment size.
[0116]
[0117] Primer proOsMT3a-RFP F: 5'-AAGCTTGAATCCATTTGGCCTCCCTCAA-3',
[0118] Primer proOsMT3a-RFP R: 5'-GGATCCGGTCGAAGATTTAATTAGCTAA-3'.
[0119] OsMT3a promoter fragment glue recovery:
[0120] 1) Under UV light, cut the agarose gel containing the target DNA fragment and place it in a 1.5 mL centrifuge tube. Add 400 μL of Buffer DE-A and heat in a 65 °C water bath (too high a water bath temperature will cause the centrifuge tube lid to burst open) until the gel block is completely melted.
[0121] 2) Add 200 μL Buffer DE-B, mix well; transfer to 1 mL prep tube, 12000 rpm, centrifuge 1 min, discard the filtrate;
[0122] 3) Put 1 mL prep tube back to 2 mL centrifuge tube, add 600 μl Buffer W1, 12000 rpm, 30 s, discard the filtrate;
[0123] 4) Put 1 mL prep tube back to 2 mL centrifuge tube, add 700 μl Buffer W2 with anhydrous ethanol, 12000 rpm centrifuge 30 s, discard the filtrate; repeat once; put 1 mL prep tube back to 2 mL centrifuge tube, 12000 rpm, centrifuge 2 min;
[0124] 5) Put 1 mL prep tube in a new 1.5 mL centrifuge tube, add 25-30 μL preheated deionized water in the center of the membrane at the bottom of 1 mL prep tube, stand at room temperature for several minutes, 12000 rpm, centrifuge 2 min to elute DNA.
[0125] Vector enzyme digestion:
[0126] Using the method of NEB restriction endonuclease, prepare the reaction solution as follows: on ice, use pipette to mix the components, place in 37℃ incubator or water bath, 90 min, after reaction, run electrophoresis, according to the required gel to recover linearized vector fragment or insert fragment.
[0127]
[0128] Homologous recombination
[0129] According to the method of Takara T4 DNA Ligase Cloning Kit, prepare the following reaction system on ice, the molar ratio of vector to insert fragment is 1:2, use pipette to mix gently, instant separation, 37℃ reaction for 30 min.
[0130]
[0131] E. coli transformation
[0132] Thaw the self-prepared super-competent cells DH5α on ice, take 10 μL recombination product or ligation product to 50-100 μL competent cells, mix gently by tapping the tube wall, stand on ice for 10 min; after 42℃ water bath heat shock for 90 s, immediately place on ice to cool for 2-3 min; use sterile spreader to evenly spread on the plate containing correct resistance, invert culture in 37℃ incubator for 12-16 h. The positive clones identified by colony PCR are sent to the sequencing company for sequencing. The correct clones are shaken and the strain is saved, V 菌液 :V50%甘油 = 1:1, and stored in -80℃ ultra-low temperature refrigerator.
[0133] After the above steps, the OsMT3a promoter-driven RFP gene expression plasmid is obtained.
[0134] 2. Construction of recombinant Agrobacterium EHA105 engineering bacteria:
[0135] The above OsMT3a pro:RFP plasmid is transformed into Agrobacterium strain EHA105 competent cells by electroporation, and is coated on YEP solid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin. After the plate is inverted in a 28℃ incubator for 48 hours, single colonies are picked and subjected to PCR identification. The positive clones are inoculated into 3 mL of YEP liquid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and are cultured at 28℃ on a shaker for 16 hours, and then are transferred to 30 mL of YEP liquid medium containing 50 mg / L kanamycin, 25 mg / L rifampicin, and 19.6 mg / L acetyl syringone. After being cultured at 28℃ for 3 hours, the bacteria are collected by centrifugation at 3500 rpm, and are suspended in the infiltration solution to obtain the recombinant Agrobacterium EHA105 engineering bacteria overexpressing OsTLA1, which are used to transform rice callus.
[0136] 3. Agrobacterium-mediated transformation of rice callus
[0137] (1) Induction of rice callus: After the full rice seeds are shelled, they are sterilized with 75% ethanol for 1 minute, then with 2.5% sodium hypochlorite solution for 45 minutes, and then are rinsed with sterilized water for 6 times, and then are sowed on NB medium, and are cultured in the dark at 28℃ to induce callus. After about 15 days, the callus is peeled off from the mature embryo shield and is transferred to NB medium for subculture. In the future, the embryonic callus with dense, smooth surface, and light yellow color is selected for subculture every 7 days.
[0138] (2) Co-culture of recombinant Agrobacterium and rice callus: the well-grown callus is transferred to a 100 mL sterilized Erlenmeyer flask, and is immersed in an appropriate amount of recombinant Agrobacterium EHA105 infiltration solution to immerse the material, and is placed at room temperature for 10 minutes, during which the Erlenmeyer flask is shaken twice, and then the liquid is discarded, and the callus is placed on sterile filter paper. After the excess bacterial solution is fully absorbed, the callus is transferred to a culture dish coated with two layers of sterile filter paper, and is co-cultured at 26℃ for 48 to 60 hours.
[0139] (3) Screening, differentiation, and plant regeneration of resistant callus: Rice callus that had completed the co-culture stage was transferred to a selective medium containing 50 mg / L hygromycin and 100 mg / L carbenicillin for the first screening culture. After 7 days, the surviving callus was transferred to a selective medium containing 50 mg / L hygromycin and 50 mg / L carbenicillin for the second round of screening. Screening was then carried out every 7 days thereafter, for a total of 4 screenings. Afterward, the vigorous resistant callus was selected and transferred to a differentiation culture for differentiation for 30 to 40 days. The differentiated rice seedlings were then cut off and transferred to a rooting medium and cultured under 26°C light. After about 3-4 weeks, when the seedlings grew to the mouth of the rooting medium tube, the sealing film was opened and an appropriate amount of sterile water was injected to harden the seedlings for about 3-5 days. These seedlings were then considered transgenic and could be used for subsequent planting and transgenic identification. After one week of hardening, the seedlings were transplanted to the field.
[0140] Example 5: Investigating the expression distribution of RFP in transgenic rice
[0141] The expression distribution of OsMT3a promoter-driven RFP in transgenic rice was investigated according to the method in Example 3. The results are shown in [Figure 3]. Figure 2 EG.
[0142] Consistent with the histochemical analysis results of GUS transgenic materials, the mRFP fluorescence signal driven by the OsMT3a promoter was also found to be distributed in the leaf vascular bundles in OsMT3apro:RFP transgenic materials. Figure 2 Fluorescence microscopy of leaf cross sections further demonstrated that OsMT3apro:RFP is specifically distributed in the phloem. In summary, the OsMT3a promoter is highly expressed in rice leaves and highly specifically expressed in the phloem.
[0143] The embodiments described above are merely preferred embodiments for fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention.
Claims
1. A promoter for increasing the expression level of a gene of interest in a plant, which is a polynucleotide selected from the group consisting of: (a) a polynucleotide whose nucleotide sequence is as set forth in SEQ ID NO: 1; (b) a polynucleotide whose nucleotide sequence has a homology of > 95%, preferably > 96%, preferably > 97%, preferably > 98%, more preferably > 99% to the nucleotide sequence as set forth in SEQ ID NO: 1, and which has the function of SEQ ID NO: 1; and (c) a polynucleotide whose nucleotide sequence is complementary to the nucleotide sequence as set forth in (a) or (b). The plant is a crop selected from the group consisting of rice, wheat, corn, soybean, barley, oat, rye, sorghum, cotton, vegetables, and cruciferous plants. The gene of interest is expressed in the phloem of the plant tissue. A gene expression cassette comprising the promoter as claimed in claim 1 and a gene of interest downstream of and under the control of the promoter.
2. The promoter of claim 1, wherein A gene expression cassette as claimed in claim 4.
3. The promoter of claim 1, wherein A transformant comprising the recombinant plasmid as claimed in claim 5.
4. A gene expression cassette, characterized in that, 7. Use of the promoter as claimed in claim 1, the gene expression cassette as claimed in claim 4, or the recombinant plasmid as claimed in claim 5, or the microbial engineering bacteria as claimed in claim 6, for promoting the expression of a gene of interest in a plant, or for cultivating a transgenic plant variety.
5. A recombinant plasmid, characterized in that, Promotion of the expression of a gene of interest in a plant is achieved by the following method:
6. A microbially engineered bacterium, characterized in that, (i) placing an endogenous gene of interest in the plant chromosome under the control of the promoter as claimed in claim 1; and / or (ii) integrating the gene expression cassette as claimed in claim 4 into the plant chromosome genome.
8. Use according to claim 7, wherein the compound is ###0002### 9. The use as claimed in claim 8, wherein: Method (i) is implemented by the following steps: (i-1) transforming a plant plantlet with a recombinant plasmid comprising the promoter as claimed in claim 1 by Agrobacterium-mediated transformation to obtain a transgenic plant expressing the promoter; or using gene editing technology to integrate the promoter as claimed in claim 1 into the plant cell genome to obtain a transgenic plant expressing the promoter; Method (ii) is implemented by the following steps: (ii-1) transforming a plant plantlet with a recombinant plasmid comprising the gene expression cassette as claimed in claim 3 by Agrobacterium-mediated transformation to obtain a transgenic plant expressing the promoter and the exogenous gene of interest; or using gene editing technology to integrate the gene expression cassette as claimed in claim 3 into the plant cell genome to obtain a transgenic plant expressing the promoter and the exogenous gene of interest. The following pairs of PCR primers are included: Forward primer proOsMT3a-F: 5'-GAATCCATTTGGCCTCCCTCAA-3' (SEQ ID NO: 2); Reverse primer proOsMT3a-R: 5'-GGTCGAAGATTTAATTAGCTAA-3' (SEQ ID NO: 3). 10. A kit for identifying a transgenic plant comprising a nucleotide sequence of a promoter as set forth in SEQ ID NO: 1 in a genome, characterized in that,