Oligonucleotides targeting DNMT1 or LIFR and uses thereof

By interfering with the function of DNMT1 through oligonucleotides targeting DNMT1, the problem of lack of gene targeting and complexity of CRISPR/Cas9 technology in existing DNMT1 inhibitors is solved, realizing gene-targeted methylation reprogramming and simplified production, which is suitable for specific gene expression regulation.

CN121065174APending Publication Date: 2025-12-05SHENZHEN XNA BIOTECHNOLOGY CO LTD
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
CN202510745322.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-06-05
Filing Date
2025-06-05
Publication Date
2025-12-05

AI Technical Summary

Technical Problem

Existing DNMT1 inhibitors lack gene targeting, leading to side effects in some patients during methylation reprogramming. Furthermore, the CRISPR/Cas9 technology system is complex and requires viral vectors, making it difficult to mass-produce.

Method used

Develop oligonucleotides targeting DNMT1, containing specific nucleotide sequences and modified with locked nucleic acids, for the regulation of specific gene expression, and interfere with DNMT1 function through Watson-Crick base pairing.

Benefits of technology

It enables gene-targeted methylation reprogramming, simplifies operations, reduces production costs, avoids safety issues associated with viral vectors, and is suitable for the regulation of specific gene expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121065174A_ABST
    Figure CN121065174A_ABST
Patent Text Reader

Abstract

The invention provides oligonucleotide targeting DNMT1, a composition or a vector containing the oligonucleotide, a method for regulating DNMT1 expression by using the oligonucleotide, and a method for screening a target gene regulated by DNA methylation. The invention also provides a compound targeting the LIFR, a composition or a vector containing the compound and a method for regulating the expression of the LIFR by using the compound.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present invention relates to the field of biopharmaceutical chemistry. More specifically, the present invention relates to modified oligonucleotides targeting DNMT1, compositions comprising the same and methods of using the same for modulating DNMT1 expression, methods of screening target genes regulated by DNA methylation. The present invention also relates to an oligonucleotide targeting LIFR, compositions comprising the same and methods of using the same for modulating LIFR expression. BACKGROUND

[0002] In mammals, DNA methylation generally occurs on the cytosine of CpG dinucleotide. Under the action of DNA methyltransferase (DNMT), a methyl group is covalently bound to the 5th carbon of the cytosine (Jones PA, Liang G. Rethinking how DNA methylation patterns are maintained. Nat Rev Genet. 2009; 10(11): 805-811. doi: 10.1038 / nrg2651). DNA methylation is an important gene expression regulation mechanism, which is involved in various complex biological processes, including development, aging, immunity and tumorigenesis, without changing the DNA sequence (Greenberg MVC, Bourc'his D. The diverse roles of DNA methylation in mammalian development and disease. Nat Rev Mol Cell Biol. 2019; 20(10): 590-607. doi: 10.1038 / s41580-019-0159-6). The principle of methylation regulating gene expression has not been fully studied, but it is relatively clear that when methylation is located in the promoter region of the gene, it usually plays a role in inhibiting gene transcription (de Mendoza A, Nguyen TV, Ford E, et al. Large-scale manipulation of promoter DNA methylation reveals context-specific transcriptional responses and stability. Genome Biol. 2022; 23(1): 163. doi: 10.1186 / s13059-022-02728-5).For example, abnormal hypermethylation of tumor suppressor gene promoters, thus silencing tumor suppressor genes, has been found to be a key event in the process of tumorigenesis (Ando M, Saito Y, Xu G, et al. Chromatin dysregulation and DNA methylation at transcription start sites associated with transcriptional repression in cancers. Nat Commun. 2019; 10(1): 2188. doi: 10.1038 / s41467-019-09937-w; Castillo-Aguilera O, Depreux P, Halby L, Arimondo PB, Goossens L. DNA Methylation Targeting: The DNMT / HMT Crosstalk Challenge. Biomolecules. 2017; 7(1): 3. doi: 10.3390 / biom7010003). Therefore, by reprogramming DNA methylation, or intervening the function of abnormal methylation sites, restoring normal gene expression has broad prospects in both basic research and disease treatment.

[0003] The DNMT family includes DNMT1, DNMT3A, and DNMT3B. Among them, DNMT1 is responsible for maintaining methylation imprinting during DNA replication (Petryk N, Bultmann S, Bartke T, Defossez PA. Staying true to yourself: mechanisms of DNA methylation maintenance in mammals. Nucleic Acids Res. 2021; 49(6): 3020-3032. doi: 10.1093 / nar / gkaa1154). Therefore, DNMT1 inhibitors can be used to study methylation regulatory sites, and can also reprogram DNA methylation. Existing DNMT1 inhibitors are mainly cytosine nucleoside analogs, which are integrated into genomic DNA during DNA replication, and degrade DNMT1, thereby causing genome-wide demethylation (Patel K, Dickson J, Din S, Macleod K, Jodrell D, Ramsahoye B. Targeting of 5-aza-2'-deoxycytidine residues by chromatin-associated DNMT1 induces proteasomal degradation of the free enzyme. Nucleic Acids Res. 2010; 38(13): 4313-4324. doi: 10.1093 / nar / gkq187).A product case of this technology is decitabine, which can be used not only as a research reagent for epigenetic basic research (Gao F, Liang H, Lu H, et al. Global analysis of DNA methylation in hepatocellular carcinoma by a liquid hybridization capture-based bisulfite sequencing approach. Clin Epigenetics. 2015; 7(1): 86. doi: 10.1186 / s13148-015-0121-1), but also for the clinical treatment of myelodysplastic syndromes (Saba HI. Decitabine in the treatment of myelodysplastic syndromes. Ther Clin Risk Manag. 2007 Oct; 3(5): 807-17. PMID: 18473005; PMCID: PMC2376088). The disadvantage of this technology is that it not only inhibits DNMT1, but also inhibits DNMT3A and DNMT3B (Yu J, Qin B, Moyer AM, et al. DNA methyltransferase expression in triple-negative breast cancer predicts sensitivity to decitabine. J Clin Invest. 2018; 128(6): 2376-2388. doi: 10.1172 / JCI97924). More importantly, this technology lacks gene targeting when reprogramming methylation, and studies have shown that its clinical application can cause demethylation of proto-oncogenes in some patients, causing side effects of reduced survival rate (Liu YC, Kwon J, Fabiani E, et al. Demethylation and Up-Regulation of an Oncogene after Hypomethylating Therapy. N Engl J Med. 2022; 386(21): 1998-2010. doi: 10.1056 / NEJMoa2119771). In order to solve the problem of gene targeting, some recent studies use CRISPR / cas9 gene editing technology to reprogram methylation. This technology uses dCas9 fusion from scratch methylation enzyme DNMT3 or demethylation enzyme TET1, which can perform from scratch methylation or demethylation on specific sequences under the guidance of sgRNA. Jin, JK, Chen J, Pommier GC, et al. Genome-wide programmable transcriptional memory by CRISPR-based epigenome editing. Cell. 2021; 184(9): 2503-2519.e17. doi: 10.1016 / j.cell.2021.03.025). Compared with the first technology, the latter has gene targeting. However, its system is complex, and it needs the help of viral vectors or liposomes to enter cells (Behr M, Zhou J, Xu B, Zhang H. In vivo delivery of CRISPR-Cas9 therapeutics: Progress and challenges. Acta Pharm Sin B. 2021; 11(8): 2150-2171. doi: 10.1016 / j.apsb.2021.05.020), which is not conducive to production and application.

[0004] Antisense oligonucleotide (ASO) is a short single-stranded oligonucleotide that can act on its target sequence by targeting it. For example, it is known that ASO can bind to the target gene mRNA through the mechanism of base complementary pairing, and under the action of, for example, ribonuclease H1 (RNase H1), cause mRNA degradation, thereby inhibiting the expression of the target gene. For example, MG98 is an ASO targeting DNMT1 mRNA, which has been shown to effectively reduce the expression of DNMT1 (Robert MF, Morin S, Beaulieu N, et al. DNMT1 is required to maintain CpG methylation and aberrant gene silencing in human cancer cells. Nat Genet. 2003;33(1):61-65. doi:10.1038 / ng1068). In addition, studies have shown that oligonucleotides can also recognize DNA sequences, bind to the promoter site of the target gene, and may up-regulate the expression of the target gene by demethylation or interfere with the function of the methylation site (Wang J, Bai J, OuYang S, et al. Antisense oligonucleotides targeting the SMN2 promoter region enhance SMN2 expression in spinal muscular atrophy cell lines and mouse model. Hum Mol Genet. 2022;31(10):1635-1650. doi:10.1093 / hmg / ddab350). Therefore, oligonucleotides targeting DNMT1 mRNA can be used for the discovery of methylation regulatory sites, and oligonucleotides targeting specific gene DNA can reprogram the methylation of the specific gene, thereby regulating the expression of the specific gene. Oligonucleotide technology not only has gene targeting, but also can enter cells without the need for a delivery system (Crooke ST, Baker BF, Crooke RM, Liang XH. Antisense technology: an overview and prospectus. Nat Rev Drug Discov. 2019;20(6):427-453. doi:10.1038 / s41573-021-00162-z), so it is simple to operate, low in cost and easy to scale up.Furthermore, self-delivering oligonucleotides have also demonstrated drugability in the clinic, while eliminating safety concerns associated with delivery systems (Syama K, Jakubek ZJ, Chen S, Zaifman J, Tam YYC, Zou S. Development of lipid nanoparticles and liposomes reference materials (II): cytotoxic profiles. Sci Rep. 2022; 12(1): 18071. doi: 10.1038 / s41598-022-23013-2; Ertl HCJ. Immunogenicity and toxicity of AAV gene therapy. Front Immunol. 2022; 13: 975803. doi: 10.3389 / fimmu.2022.975803).

[0005] Therefore, there is an urgent need in the art to develop oligonucleotides targeting DNMT1 to modulate the expression of specific genes (e.g., tumor suppressor genes). SUMMARY

[0006] In one aspect, the present application provides an oligonucleotide targeting DNMT1, wherein the oligonucleotide comprises a nucleotide sequence as set forth in TTCATGTCAGCCAAGGCCAC (SEQ ID NO: 1) or a mutant having at least 90% sequence identity thereto, and 3 nucleotides from the 5’ end and / or 3 nucleotides from the 3’ end of the nucleotide sequence as set forth in SEQ ID NO: 1 or the mutant comprise a locked nucleic acid (LNA) modification.

[0007] In certain embodiments, the chemical structure of the oligonucleotide is as set forth in Chemical Formula 1. In certain embodiments, the oligonucleotide is in the form of a pharmaceutically acceptable salt.

[0008] In another aspect, the present application also provides a composition comprising the oligonucleotide of the present application, and a pharmaceutically acceptable carrier.

[0009] In another aspect, the present application also provides a vector comprising the oligonucleotide of the present application.

[0010] In another aspect, the present application also provides a method for modulating the expression of DNMT1 in a target cell expressing DNMT1, the method comprising exposing the target cell to the oligonucleotide, the composition, or the vector of the present application.

[0011] In another aspect, the present application also provides a method for preventing, inhibiting or reversing gene methylation, comprising administering to a subject in need thereof an effective amount of the oligonucleotide, the composition or the vector of the present application.

[0012] In another aspect, the present application also provides a method for treating or preventing a disease, comprising administering to a subject in need thereof an effective amount of the oligonucleotide, the composition or the vector of the present application.

[0013] In another aspect, the present application also provides a method for assisting cell therapy, comprising administering to a subject in need thereof an effective amount of the oligonucleotide, the composition or the vector of the present application.

[0014] In another aspect, the present application also provides a method for screening a target gene regulated by DNA methylation, comprising the steps of:

[0015] (a) preparing a DNMT1 knockdown sample using the oligonucleotide, the composition or the vector of the present application;

[0016] (b) performing methylation quantification and expression quantification on the DNMT1 knockdown sample prepared in step (a) and a control sample, respectively, and performing differential methylation analysis and differential expression analysis; and

[0017] (c) performing correlation analysis on the differential methylation analysis and the differential expression analysis in step (b), thereby determining a target gene regulated by DNA methylation; wherein when the differential methylation analysis and the differential expression analysis show that the methylation level of a CpG site of a certain gene is negatively or positively correlated with its expression level, the gene is determined as a target gene regulated by DNA methylation.

[0018] In another aspect, the present application also provides a method for reprogramming a methylation regulatory region of a target gene, comprising the steps of:

[0019] (i) selecting a methylation regulatory region of a target gene;

[0020] (ii) selecting an oligonucleotide complementary to the sense strand or the antisense strand of the methylation regulatory region of the target gene selected in step (i); and

[0021] (iii) reprogramming the methylation regulatory region of the target gene using the oligonucleotide selected in step (ii).

[0022] In another aspect, the present application also provides a kit for use in the methods of the present application.

[0023] In another aspect, the present application also provides a compound targeting any 12-50 consecutive nucleotides within the region of chr5:38595894-38596033 of LIFR gene. In some embodiments, the chemical structure of the compound is shown in Chemical Formula 2, Chemical Formula 3, Chemical Formula 4, or Chemical Formula 5.

[0024] In another aspect, the present application also provides a method of up-regulating the expression of LIFR gene in a subject, comprising administering to a subject in need thereof an effective amount of the compound, composition or vector of the present application.

[0025] In another aspect, the present application also provides a method of preventing, inhibiting or reversing the methylation of LIFR gene, comprising administering to a subject in need thereof an effective amount of the compound, composition or vector of the present application.

[0026] In another aspect, the present application also provides a method of treating or preventing a disease, comprising administering to a subject in need thereof an effective amount of the compound, composition or vector of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 An exemplary flow chart showing the technical solutions provided by the present application is shown.

[0028] Figure 2 Effects of knocking down DNMT1 using xNA-07070, xNA-07072 and negative control (NC) are shown. Among them, Figure 2 A shows the degree of knockdown of DNMT1 mRNA by xNA-07070 and xNA-07072 at the same dose (4 μM) when intervention is under non-mediated and lipofection conditions; Figure 2 B shows the effects of xNA-07070 at doses of 1 μM and 5 μM on the mRNA expression of DNMT1 and the corresponding protein expression; Figure 2 C shows the effects of xNA-07070 and xNA-07072 on the expression of DNMT3A and DNMT3B in HepG2 cells; Figure 2 D shows the effects of xNA-07070 (i.e., DNMT1 aso) at different doses (0.1 μM, 1 μM, 5 μM) on the viability of HepG2 cells using CCK8 kit (Solarbio, #CA1210). Figure 2 D shows the effects of xNA-07070 (i.e., DNMT1 aso) at different doses (0.1 μM, 1 μM, 5 μM) on the viability of HepG2 cells using CCK8 kit (Solarbio, #CA1210).

[0029] Figure 3 A-G show the results of RRBS and RNA-seq in Examples 1.3-1.5.

[0030] Figure 4The oligonucleotide targeting the LIFR promoter region was shown to increase the expression of LIFR. Among them, Figure 4 A indicates the change in methylation level and gene expression of the region near the promoter regulatory element of the LIFR gene (chr5:38595894-38596033) after the DNMT1 mRNA of HepG2 cells was knocked down using 1 μM of xNA-07070, 5 μM of xNA-07070, and a negative control (NC), respectively; Figure 4 B indicates the correlation analysis of the methylation level of the CpG site and the expression of the LIFR gene; Figure 4 C shows the effect on the expression of the LIFR gene after HepG2 cells were intervened with xNA-07070, xNA-14203, xNA-14204, xNA-14219, xNA-14220, and a negative control (NC), respectively, for 72 hours; Figure 4 D shows the effect on the methylation level of LIFR after HepG2 cells were intervened with xNA-07070, xNA-14203, xNA-14204, xNA-14219, xNA-14220, and a negative control (NC), respectively, for 72 hours; Figure 4 E shows the effect on the viability of HepG2 cells after HepG2 cells were intervened with xNA-07070, xNA-14203, xNA-14204, xNA-14219, xNA-14220, and a negative control (NC), respectively, for 72 hours; Figure 4 F indicates the effect on the expression of the LIFR gene after HepG2 cells were intervened with xNA-07070, xNA-14203, xNA-14219, xNA-14220, and a negative control (NC), respectively, for 3 hours to 72 hours; Figure 4 G indicates the effect on the viability of HepG2 cells after HepG2 cells were intervened with xNA-07070, xNA-14203, xNA-14219, xNA-14220, and a negative control (NC), respectively, for 3 hours to 72 hours; Figure 4 H indicates the cell phenotype after HepG2 cells were intervened with a negative control (NC) and xNA-14219, respectively, for 3 hours to 72 hours. DETAILED DESCRIPTION

[0031] Although various aspects and embodiments are disclosed herein, it will be apparent to those of ordinary skill in the art that many modifications, combinations, subcombinations and variations of the aspects and embodiments disclosed herein can be made, and that such modifications, combinations, subcombinations and variations are also within the scope of the disclosure. Accordingly, it is intended that the disclosure be understood as including all such modifications, combinations, subcombinations and variations as fall within the scope of the disclosure. The disclosure disclosed herein is to be considered merely illustrative of the principles of the disclosure and is not intended to limit the scope of the disclosure to be circumscribed by any such specific embodiments. All publications, patents and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

[0032] I. DEFINITIONS

[0033] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. The terms "a" (or "an"), "one or more" and "at least one" can be used interchangeably in the application.

[0034] As used herein, the term "comprising" or "including," or "having" means including but not limited to, and the meaning is to be taken in its broadest context. In the application, the terms "comprising" or "including" are used interchangeably, unless otherwise indicated. For example, when referring to "comprising" a particular sequence, it is intended to encompass both the case where the particular sequence is present and the case where the particular sequence is absent, unless otherwise indicated. It should also be noted that the terms "comprising", "including" and "having" can be used interchangeably.

[0035] In the application, the term "about" generally means within 0.5-10% above or below the indicated value, e.g., within 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below the indicated value. For example, "about 80%" means any value within the range of 72-88%.

[0036] The term "DNMT1" as used herein refers to DNA methyltransferase 1, an enzyme that catalyzes the transfer of a methyl group to DNA, and includes any variants, conformations, isoforms, and species homologs of DNMT1 expressed by a cell naturally or by a cell transfected with a DNMT1 gene. For example, DNMT1 described herein can refer to a DNA methyltransferase 1 derived from any vertebrate source, including mammals such as primates (e.g., humans, monkeys) and rodents (e.g., mice and rats). An exemplary amino acid sequence of human DNMT1 is set forth in GenBank Accession No. NP_001124295.1 (SEQ ID NO: 18), and an exemplary amino acid coding sequence (i.e., mRNA sequence) of human DNMT1 is set forth in GenBank Accession No. NM_001130823.3 (SEQ ID NO: 19). An exemplary amino acid sequence of Macaca fascicularis DNMT1 is set forth in GenBank Accession No. XP_005587986.1 (SEQ ID NO: 20), and an exemplary amino acid coding sequence (i.e., mRNA sequence) of Macaca fascicularis DNMT1 is set forth in GenBank Accession No. XM_005587929.3 (SEQ ID NO: 21). An exemplary amino acid sequence of rat DNMT1 is set forth in GenBank Accession No. NP_445806.3 (SEQ ID NO: 22), and an exemplary amino acid coding sequence (i.e., mRNA sequence) of rat DNMT1 is set forth in GenBank Accession No. NM_053354.3 (SEQ ID NO: 23). An exemplary amino acid sequence of mouse DNMT1 is set forth in GenBank Accession No. NP_001186360.2 (SEQ ID NO: 24), and an exemplary amino acid coding sequence (i.e., mRNA sequence) of mouse DNMT1 is set forth in GenBank Accession No. NM_001199431.2 (SEQ ID NO: 25). Other exemplary amino acid sequences and mRNA sequences of DNMT1 can also be obtained by a skilled artisan through public databases (e.g., GenBank, UniProt, OMIM, etc.).

[0037] The term "DNMT1" as used herein is intended to encompass any form of DNMT1, e.g., 1) a naturally unprocessed DNMT1 molecule, a "full-length" DNMT1 chain, or naturally occurring variants of DNMT1, including, e.g., splice variants or allelic variants; 2) any form of DNMT1 produced by processing in a cell; or 3) a full-length, fragment (e.g., a truncated form, an extracellular / transmembrane domain), or modified form (e.g., a mutated form, glycosylated / pegylated, His-tag / immunofluorescent fusion form) of a DNMT1 subunit produced by recombinant methods.

[0038] The term "DNMT1" as used herein also includes naturally occurring DNA sequence variants of the DNMT1 gene, e.g., Single Nucleotide Polymorphisms (SNPs) of the DNMT1 gene. Exemplary SNPs of the DNMT1 gene can be found by searching the dbSNP database (https: / / www.ncbi.nlm.nih.gov / variation / view / ). Non-limiting examples of sequence variants of the DNMT1 gene include, e.g., Reference SNP (refSNP) Cluster Report: rs16999593, rs2228611, etc. (can be queried at www.ncbi.nlm.nih.gov / SNP).

[0039] The term“LIFR” as used herein refers to the leukemia inhibitory factor receptor (also known as“LIF receptor”), which is capable of recognizing leukemia inhibitory factor, wherein the low-affinity receptor is the LIFR alpha chain, which belongs to the type I cytokine receptor superfamily; the high-affinity receptor is composed of the alpha chain and gp130 (CD130). The“LIFR” referred to in this application includes any variant, conformation, isoform, and species homolog of LIFR expressed naturally by cells or by cells transfected with a LIFR gene. For example, LIFR described herein can refer to a leukemia inhibitory factor receptor derived from any vertebrate source, including mammals such as primates (e.g., humans, monkeys) and rodents (e.g., mice and rats). An exemplary amino acid sequence of human LIFR is set forth in GenBank Accession No. NP_002301.1 (SEQ ID NO: 26), and an exemplary amino acid coding sequence (i.e., mRNA sequence) of human LIFR is set forth in GenBank Accession No. NM_002310.6 (SEQ ID NO: 27). An exemplary amino acid sequence of Macaca fascicularis LIFR is set forth in GenBank Accession No. XP_045249584.1 (SEQ ID NO: 28), and an exemplary amino acid coding sequence (i.e., mRNA sequence) of Macaca fascicularis LIFR is set forth in GenBank Accession No. XM_045393649.1 (SEQ ID NO: 29). An exemplary amino acid sequence of rat LIFR is set forth in GenBank Accession No. NP_112310.1 (SEQ ID NO: 30), and an exemplary amino acid coding sequence (i.e., mRNA sequence) of rat LIFR is set forth in GenBank Accession No. NM_031048.1 (SEQ ID NO: 31). An exemplary amino acid sequence of mouse LIFR is set forth in GenBank Accession No. NP_001345522.1 (SEQ ID NO: 32), and an exemplary amino acid coding sequence (i.e., mRNA sequence) of mouse LIFR is set forth in GenBank Accession No. NM_001358593.1 (SEQ ID NO: 33). Other exemplary amino acid sequences and mRNA sequences of LIFR can also be obtained by a person skilled in the art through public databases (e.g., GenBank, UniProt, OMIM, etc.).

[0040] The term "LIFR" as used herein is intended to encompass any form of LIFR, e.g., 1) a naturally unprocessed LIFR molecule, a "full-length" LIFR chain, or naturally occurring variants of LIFR, including, e.g., splice variants or allelic variants; 2) any form of LIFR produced by processing in the cell; or 3) a full-length, fragment (e.g., a truncated form, an extracellular / transmembrane domain), or modified form (e.g., a mutated form, glycosylated / pegylated, His-tag / immunofluorescent fusion form) of LIFR subunit produced by recombinant methods.

[0041] The term "LIFR" as used herein also includes naturally occurring DNA sequence variants of the LIFR gene, e.g., SNPs of the LIFR gene. Exemplary SNPs of the LIFR gene can be found by searching the dbSNP database (https: / / www.ncbi.nlm.nih.gov / variation / view / ). Non-limiting examples of sequence variants of the LIFR gene include, e.g., Reference SNP (refSNP) Cluster Report: rs1005017, rs1037033, etc. (can be queried at www.ncbi.nlm.nih.gov / SNP).

[0042] As used herein, "G," "C," "A," "T," and "U" generally refer to nucleotides containing guanine, cytosine, adenine, thymine, and uracil as the base, respectively. Those skilled in the art will appreciate that the terms "deoxyribonucleotide," "ribonucleotide," and "nucleotide" can refer to unmodified nucleotides or to modified nucleotides, e.g., nucleotides modified with locked nucleic acid (LNA), 2'-O-methyl (Me), 2'-O-ethyl, 2'-O-methoxyethyl (MOE), and / or 2'-F modifications, etc. Those skilled in the art will also appreciate that guanine, cytosine, adenine, thymine, and uracil can be replaced with other moieties without materially altering the base pairing properties of an oligonucleotide comprising nucleotides having such replacement moieties. For example, a nucleotide having hypoxanthine as the base can base pair with a nucleotide containing adenine, cytosine, or uracil. Thus, a nucleotide containing thymine, guanine, or adenine can be replaced with a nucleotide containing hypoxanthine in an oligonucleotide sequence provided herein. Also for example, adenine and cytosine in an oligonucleotide can be replaced with guanine and uracil, respectively, to form G-U wobble base pairing with a target mRNA.

[0043] The term "antisense oligonucleotide" used in the present application refers to an oligonucleotide having a nucleobase sequence substantially complementary to a target nucleic acid (e.g., a target gene, an mRNA molecule encoding a target protein, etc.) or a region or fragment thereof. For example, an "antisense oligonucleotide targeting DNMT1" can be substantially complementary to an mRNA molecule encoding a DNMT1 protein or a region or fragment thereof, an "antisense oligonucleotide targeting LIFR" can be substantially complementary to a LIFR gene or a region (e.g., a regulatory element or a region in the vicinity thereof, such as a promoter or a region in the vicinity thereof) or a fragment thereof, or can be substantially complementary to an mRNA molecule encoding a LIFR protein or a region or fragment thereof.

[0044] The term "sense oligonucleotide" used in the present application refers to an oligonucleotide containing a region substantially complementary to the term "antisense oligonucleotide" defined above. A sense oligonucleotide generally has a nucleobase sequence substantially identical to a target nucleic acid (e.g., a target gene, an mRNA molecule encoding a target protein, etc.) or a region or fragment thereof.

[0045] An antisense oligonucleotide can specifically hybridize to a target nucleic acid or a region or fragment thereof, thereby interfering with the normal function of the target nucleic acid, e.g., causing RNAse H-mediated cleavage of the target nucleic acid, impeding ribosomal translation of the target protein, or modulating RNA splicing, etc. Typically, most of the nucleotides in an antisense oligonucleotide are ribonucleotides, but as described herein, an antisense oligonucleotide provided herein can also include one or more nucleotides that are not ribonucleotides, e.g., can include one or more deoxyribonucleotides. Moreover, an antisense oligonucleotide provided herein can include chemically modified nucleotides (e.g., ribonucleotides or deoxyribonucleotides) and can include substantial modifications at multiple nucleotides.

[0046] The term "complementary" or "complementarity" used in the present application when used in reference to a first nucleotide sequence in relation to a second nucleotide sequence refers to the capacity of the first nucleotide sequence to hybridize to the second nucleotide sequence under certain conditions and to form a duplex structure. The conditions can be stringent conditions, i.e., under these conditions the nucleotide sequence will hybridize to its target sequence but not to other non-complementary sequences. Stringent conditions are sequence dependent and will be different under different circumstances. The conditions can be determined by the skilled person in the art according to the actual situation.

[0047] A complementary sequence includes a first nucleotide sequence that base pairs with a second nucleotide sequence over the entire length of one or both nucleotide sequences. In the present application, such two nucleotide sequences can be referred to as being "fully complementary" to each other. If a first nucleotide sequence is "substantially complementary" to a second nucleotide sequence, the two sequences can be fully complementary, or they can have one or more (but typically no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1) mismatched base pairs when hybridized to form a duplex of up to 50 base pairs, and still retain the ability to hybridize under certain conditions. Two nucleotide sequences are said to be complementary if, when the nucleotides of the first nucleotide sequence are optimally aligned and compared with the nucleotides of the second nucleotide sequence, and appropriate nucleotide insertions or deletions are made, at least about 80% (typically at least about 90% to 95%, more preferably about 98% to 100%) of the nucleotides of the second nucleotide sequence pair with the nucleotides of the first nucleotide sequence.

[0048] Complementary nucleotides are typically A and T (or A and U), or C and G. As used herein, "complementary" sequences can also include non-Watson-Crick base pairing and / or base pair formation by non-natural and modified nucleotides, so long as the above requirements regarding their hybridization ability are met. Such non-Watson-Crick base pairing includes, but is not limited to, G-U wobble base pairing or Hoogstein base pairing.

[0049] As used herein, the term "specifically hybridize" or "specifically hybridizing" refers to a sufficient degree of complementarity between the antisense oligonucleotide and the target nucleic acid to yield a desired effect, under physiological conditions in the in vivo or in vitro analysis and therapeutic treatment contexts, without substantial binding to non-target nucleic acids or regions or segments thereof, or with only minimal binding to non-target nucleic acids or regions or segments thereof.

[0050] The term "target nucleic acid" as used herein refers to a nucleic acid molecule that specifically hybridizes to an oligonucleotide (e.g., an antisense oligonucleotide) provided herein. The target nucleic acid can be 10 to 50 nucleotides in length (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nucleotides). For example, the target nucleic acid of an oligonucleotide provided herein that targets DNMT1 can be 10 to 50 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50) contiguous nucleotides in the nucleotide sequence of an mRNA molecule formed during transcription of the DNMT1 gene. Ranges and lengths intermediate to the above ranges and lengths are also intended to be part of the application.

[0051] The term "nucleoside" as used herein is a base-sugar combination. The "nucleobase" (also "base") portion of the nucleoside commonly refers to the heterocyclic moiety. A "nucleotide" is a nucleoside that further includes a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that contain a furanose sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. An "oligonucleotide," also referred to as a "polynucleotide" or "polynucleic acid," is formed by covalent linkage, through adjacent nucleosides, of a plurality of nucleosides. In polynucleotide structures, the phosphate groups are commonly referred to as internucleoside linkages.

[0052] The term "subject" or "subject" as used herein refers to a human and a non-human animal. Non-human animals include all vertebrates, e.g., mammals and non-mammals. The subject or subject can be a domesticated animal, e.g., a cow, pig, sheep, poultry, and horse, or a pet, e.g., a dog and cat. The subject or subject can be male (e.g., a man) or female (e.g., a woman), and can be elderly, adult, adolescent, child, or infant. The human can be of Caucasian, African, Asian, Semitic, or other ethnic background, or a mixture of these ethnic backgrounds.

[0053] The term "administering" as used herein refers to the delivery of a substance to a subject in need thereof. The route of administration can be topical, oral, intranasal, parenteral, enteral, rectal, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, buccal, sublingual, or ocular. In some embodiments, the substance can be administered to the subject by intravenous, intraperitoneal, or subcutaneous injection, using peripheral systemic delivery.

[0054] The term "effective amount" as used herein refers to the amount of an agent that will treat or prevent a disease, condition, or disorder in a subject by inhibiting or reducing the disease, condition, or disorder, or by preventing the onset of the disease, condition, or symptom. An effective amount can be an amount of an agent that relieves to some extent one or more of the symptoms of the disease or condition; restores partially or fully one or more physiological or biochemical parameters associated with or resulting from the disease or condition; and / or reduces the likelihood of developing the disease or condition. A skilled clinician can determine an effective amount of an agent to treat or prevent a particular disease or condition at the time of administration. The precise amount of an agent required as an effective amount will depend on many factors, such as the specific activity of the active substance, the delivery device employed, the physical characteristics of the substance, the purpose of administration, and many patient-specific considerations. Determining an amount of an agent that must be administered as an effective amount is a routine practice in the art and within the skill of the ordinary skilled clinician.

[0055] As used herein, "treatment" of a disease, condition, or disorder includes preventing or alleviating the disease, condition, or disorder, slowing the rate of onset or development of the disease, condition, or disorder, reducing the risk of developing the disease, condition, or disorder, preventing or delaying the development of symptoms associated with the disease, condition, or disorder, reducing or ending symptoms associated with the disease, condition, or disorder, causing the disease, condition, or disorder to completely or partially resolve, curing the disease, condition, or disorder, or some combination thereof.

[0056] In the present application, the term "prevention" refers to reducing the probability of a subject developing a disease, condition, or disorder, who has not yet developed the disease, condition, or disorder, but is at risk or susceptible to developing the disease, condition, or disorder.

[0057] In the present application, the term "diagnosis" refers to the identification of a pathological state, disease, or condition, such as the identification of a DNMT1 -related disease, or to the identification of a subject having a DNMT1 -related disease who can benefit from a particular treatment regimen. In some embodiments, diagnosis includes identifying an abnormal amount or activity of DNMT1. In some embodiments, diagnosis refers to identifying a cancer in a subject.

[0058] II. Oligonucleotides targeting DNMT1 and uses thereof

[0059] 1. Oligonucleotides targeting DNMT1 and modifications thereof

[0060] In one aspect, the present application provides oligonucleotides (e.g., antisense oligonucleotides) and compositions comprising the same, wherein the oligonucleotides target a nucleic acid encoding DNMT1 (e.g., at least a portion of a region in an mRNA molecule encoding DNMT1). The oligonucleotides provided herein bind to a nucleic acid encoding DNMT1, e.g., via Watson-Crick base pairing, and interfere with the normal function of the nucleic acid to which they are targeted. The use of these oligonucleotides results in the targeted inhibition of RNA expression and / or activity of the DNMT1 gene in a subject (e.g., a mammal). For example, the level of DNMT1 nucleic acid and / or the level of DNMT1 protein is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, etc., in the presence of the antisense oligonucleotide as compared to the absence of the antisense oligonucleotide.

[0061] In one aspect, the present application provides an oligonucleotide targeting DNMT1, wherein the oligonucleotide comprises a nucleotide sequence as set forth in TTCATGTCAGCCAAGGCCAC (SEQ ID NO: 1) or a mutant thereof having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity thereto, and the 3 nucleotides from the 5' end and / or the 3 nucleotides from the 3' end of the nucleotide sequence as set forth in SEQ ID NO: 1 or the mutant comprise a locked nucleic acid (LNA) modification.

[0062] In certain embodiments, the oligonucleotide targeting DNMT1 provided herein comprises a nucleotide sequence as set forth in SEQ ID NO: 1 or a mutant thereof having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity thereto, and the 3 nucleotides from the 5' end or the 3 nucleotides from the 3' end of the nucleotide sequence as set forth in SEQ ID NO: 1 or the mutant comprise a LNA modification.

[0063] In certain embodiments, the oligonucleotide targeted to DNMT1 provided herein comprises the nucleotide sequence of SEQ ID NO: 1, or a mutant thereof having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity thereto, and each of the three nucleotides from the 5' end and each of the three nucleotides from the 3' end of the nucleotide sequence of SEQ ID NO: 1 or the mutant thereof comprises a LNA modification.

[0064] In certain embodiments, the oligonucleotide targeted to DNMT1 provided herein comprises the nucleotide sequence of SEQ ID NO: 1, or a mutant thereof having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity thereto, and each of the three nucleotides from the 5' end and each of the three nucleotides from the 3' end of the nucleotide sequence of SEQ ID NO: 1 or the mutant thereof comprises a LNA modification.

[0065] In certain embodiments, the oligonucleotide targeted to DNMT1 provided herein comprises the nucleotide sequence of SEQ ID NO: 1, and the three nucleotides from the 5' end and the three nucleotides from the 3' end of the nucleotide sequence of SEQ ID NO: 1 comprise LNA modifications. In certain embodiments, the oligonucleotide targeted to DNMT1 provided herein comprises the nucleotide sequence of SEQ ID NO: 1, and each of the three nucleotides from the 5' end and each of the three nucleotides from the 3' end of the nucleotide sequence of SEQ ID NO: 1 comprise LNA modifications.

[0066] In certain embodiments, the oligonucleotide targeted to DNMT1 provided herein consists of the nucleotide sequence of SEQ ID NO: 1, and the three nucleotides from the 5' end and the three nucleotides from the 3' end of the nucleotide sequence of SEQ ID NO: 1 comprise LNA modifications. In certain embodiments, the oligonucleotide targeted to DNMT1 provided herein consists of the nucleotide sequence of SEQ ID NO: 1, and each of the three nucleotides from the 5' end and each of the three nucleotides from the 3' end of the nucleotide sequence of SEQ ID NO: 1 comprise LNA modifications.

[0067] In certain embodiments, the oligonucleotide targeting DNMT1 provided herein consists of the nucleotide sequence set forth in SEQ ID NO: 1, and the 3 nucleotides from the 5' end and the 3 nucleotides from the 3' end of the nucleotide sequence set forth in SEQ ID NO: 1 are LNA modified nucleotides. In certain embodiments, the oligonucleotide targeting DNMT1 provided herein consists of the nucleotide sequence set forth in SEQ ID NO: 1, and each of the 3 nucleotides from the 5' end and each of the 3 nucleotides from the 3' end of the nucleotide sequence set forth in SEQ ID NO: 1 is a LNA modified nucleotide.

[0068] In certain embodiments, the oligonucleotide targeting DNMT1 provided herein comprises a mutant having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to the nucleotide sequence set forth in SEQ ID NO: 1, and the 3 nucleotides from the 5' end and the 3 nucleotides from the 3' end of the mutant comprise LNA modifications. In certain embodiments, the oligonucleotide targeting DNMT1 provided herein comprises a mutant having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to the nucleotide sequence set forth in SEQ ID NO: 1, and each of the 3 nucleotides from the 5' end and each of the 3 nucleotides from the 3' end of the mutant comprises a LNA modification.

[0069] In certain embodiments, the oligonucleotide targeting DNMT1 provided herein consists of a mutant having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to the nucleotide sequence set forth in SEQ ID NO: 1, and the 3 nucleotides from the 5' end and the 3 nucleotides from the 3' end of the mutant comprise LNA modifications. In certain embodiments, the oligonucleotide targeting DNMT1 provided herein consists of a mutant having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to the nucleotide sequence set forth in SEQ ID NO: 1, and each of the 3 nucleotides from the 5' end and each of the 3 nucleotides from the 3' end of the mutant comprises a LNA modification.

[0070] In certain embodiments, the oligonucleotide targeting DNMT1 provided herein consists of a mutant having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to the nucleotide sequence of SEQ ID NO: 1, and the 3 nucleotides from the 5' end and the 3 nucleotides from the 3' end of the nucleotide sequence of the mutant are LNA-modified nucleotides. In certain embodiments, the oligonucleotide targeting DNMT1 provided herein consists of a mutant having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to the nucleotide sequence of SEQ ID NO: 1, and each of the 3 nucleotides from the 5' end and each of the 3 nucleotides from the 3' end of the nucleotide sequence of the mutant are LNA-modified nucleotides.

[0071] In certain embodiments, the mutant described herein having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to the nucleotide sequence of SEQ ID NO: 1 comprises a sequence of at least 15 (e.g., 15, 16, 17, 18, 19, or 20) consecutive nucleotides within the nucleotide sequence of SEQ ID NO: 1 that differs by no more than 3 (e.g., 0, 1, 2, or 3 nucleotides). In certain embodiments, the mutant described herein having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to the nucleotide sequence of SEQ ID NO: 1 comprises a sequence of at least 15 (e.g., 15, 16, 17, 18, 19, or 20) consecutive nucleotides within the nucleotide sequence of SEQ ID NO: 1. In certain embodiments, the mutant described herein having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to the nucleotide sequence of SEQ ID NO: 1 consists of at least 15 (e.g., 15, 16, 17, 18, 19, or 20) consecutive nucleotides within the nucleotide sequence of SEQ ID NO: 1.

[0072] The term "targeting" as used herein refers to the ability to specifically bind to a target nucleic acid (DNA or RNA, e.g., mRNA). For example, an oligonucleotide "targeting DNMT1" refers to an oligonucleotide that specifically binds to a DNMT1 gene or a region or fragment thereof, or a DNMT1 mRNA encoding a DNMT1 gene product or a region or fragment thereof. In some embodiments, the oligonucleotide targeting DNMT1 provided herein specifically hybridizes to a target nucleic acid (DNA or RNA, e.g., mRNA). In some embodiments, the oligonucleotide targeting DNMT1 provided herein specifically hybridizes to a target nucleic acid (DNA or RNA, e.g., mRNA) by means of base complementarity.

[0073] In some embodiments, the oligonucleotide provided herein specifically targets DNMT1. In some embodiments, the oligonucleotide provided herein specifically targets DNMT1 without targeting DNMT3A or DNMT3B. In some embodiments, the oligonucleotide provided herein has an affinity of binding to DNA or RNA of DNMT1 that is at least 1-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100-fold, at least 150-fold, at least 200-fold, etc. higher than the affinity of binding to DNA or RNA of DNMT3A or DNMT3B. For example, in some embodiments, the oligonucleotide provided herein down-regulates gene expression of DNMT1 only without affecting gene expression of DNMT3A or DNMT3B. "Without affecting gene expression of DNMT3A or DNMT3B" means that the level of gene expression of DNMT3A or DNMT3B does not change, or changes by no more than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% before and after treating a sample with the oligonucleotide provided herein.

[0074] The percent (%) sequence identity of a candidate sequence to a reference sequence as used herein refers to the percentage of nucleotides (or amino acids) of the candidate sequence that are identical with the nucleotides (or amino acids) of the reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. In other words, the percent (%) sequence identity of nucleic acid sequences (or amino acid sequences) can be determined by taking the number of bases (or amino acid residues) that are the same between the candidate sequence and the reference sequence, divided by the total number of bases (or amino acid residues) in the candidate sequence or the reference sequence, whichever is shorter, and multiplying the result by 100. Conservative substitutions of amino acid residues can or can not be counted as an identical residue. The percent (%) sequence identity of nucleotide (or amino acid) sequences can be determined, for example, using publicly available tools such as BLASTN, BLASTp (available on the website of the National Center for Biotechnology Information (NCBI), see also Altschul S.F. et al., J. Mol. Biol., 215:403-410 (1990); Stephen F. et al., Nucleic Acids Res., 25:3389-3402 (1997)), ClustalW2 (available on the website of the European Bioinformatics Institute, see also Higgins D.G. et al., Methods in Enzymology, 266:383-402 (1996); Larkin M.A. et al., Bioinformatics (Oxford, England), 23(21):2947-8 (2007)), and ALIGN or Megalign (DNASTAR) software. The person skilled in the art can use the default parameters provided by the tools or can customize the parameters suitable for the alignment, for example, by choosing a suitable algorithm.

[0075] The term "locked nucleic acid" or "LNA" as used herein refers to a nucleotide having a modified ribose moiety, wherein the ribose moiety comprises a bridge of two carbon atoms linked between the 4' and 2' positions of the ribose, thereby forming a nucleotide having a bicyclic sugar. This structure can effectively "lock" the ribose in the 3'-endo conformational state. Accordingly, the term "LNA modification" as used herein refers to a ribose moiety of a recited nucleoside or nucleotide comprising a bridge of two carbon atoms linked between the 4' and 2' positions of the ribose, thereby forming a nucleoside or nucleotide having a bicyclic sugar. In certain embodiments, LNA can refer to a nucleotide analog having a modified ribose moiety, wherein the 4' C and 2' O of the ribose moiety are linked by a methylene bridge, thereby forming a nucleotide analog having a bicyclic furanose structure. LNA oligonucleotides known in the art can be found in PCT Patent Application Nos. WO 9914226 A2, WO 0056746 A2, WO 0056748 A1, and the like, all of which are incorporated herein by reference.

[0076] In the present application, LNA compounds include, but are not limited to, compounds having at least one bridge between the 4' and 2' positions of the sugar, wherein each bridge independently comprises 1, 2, 3, or 4 linking groups independently selected from the group consisting of: -[C(R1)(R2)] n -,[C(R1)(R2)] n -O-, -C(R1R2)-N(R1)-O- or -C(R1R2)-O-N(R1)-, -C(R1)=C(R2)-, -C(R1)=N-, -C(=NR1)-, -C(=O)-, -C(=S)-, -O-, -Si(R1)2-, -S(=O) x - and -N(R1)-; wherein x is independently 0, 1, or 2; n is independently 1, 2, 3, or 4; each R1and R2is independently H, a protecting group, hydroxyl, C 1-12 alkyl, substituted C 1-12 alkyl, C 2-12 alkenyl, substituted C 2-12 alkenyl, C 2-12 alkynyl, substituted C 2-12 alkynyl, C 5-20 aryl, substituted C 5-20 aryl, heterocyclic group, substituted heterocyclic group, heteroaryl, substituted heteroaryl, C 5-7 alicyclic group, substituted C 5-7 alicyclic group, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and each J1and J2is independently H, C1-12 Alkyl, substituted C 1-12 Alkyl, C 2-12 alkenyl, substituted C 2-12 alkenyl, C 2-12 alkynyl, substituted C 2-12 alkynyl group, C 5-20 Aryl, substituted C 5-20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic group, substituted heterocyclic group, amino-C 1-12 Alkyl, substituted amino C 1-12 Alkyl or protecting group. In some embodiments, LNA is a nucleotide comprising a bicyclic sugar moiety containing a 4'-CH2-O-2' bridge, a 4'-CH2-ON(R)-2' bridge, or a 4'-CH2-N(R)-O-2' bridge.

[0077] In some embodiments, examples of LNA include, but are not limited to, LNAs as shown below: (A) α-L-methyleneoxy(4'-CH2-O-2')LNA, (B) β-D-methyleneoxy(4'-CH2-O-2')LNA, (C) ethyleneoxy(4'-(CH2)2-O-2')LNA, (D) methyleneoxyamino(4'-CH2-ON(R)-2')LNA, and (E) methyleneaminooxy(4'-CH2-N(R)-O-2')LNA.

[0078]

[0079] In some embodiments, the LNA modification described in this application is a 4'-CH2-O-2' LNA modification. In some embodiments, the LNA modification described in this application is an α-L-methyleneoxy(4'-CH2-O-2') LNA modification or a β-D-methyleneoxy(4'-CH2-O-2') LNA modification. In some embodiments, the LNA modification described in this application is an α-L-methyleneoxy(4'-CH2-O-2') LNA modification. In some embodiments, the LNA modification described in this application is a β-D-methyleneoxy(4'-CH2-O-2') LNA modification.

[0080] In some embodiments, the nucleotide sequence set forth as SEQ ID NO: 1 or the mutant described herein further comprises a LNA modification at any one or more of the nucleotides other than the 3 nucleotides from the 5' end and the 3 nucleotides from the 3' end. The any one or more nucleotides can be 2 to 14 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14). The any one or more nucleotides can be contiguous or non-contiguous.

[0081] In some embodiments, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 5' end and / or 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 3' end of the nucleotide sequence set forth as SEQ ID NO: 1 or the mutant described herein comprise a LNA modification. In some embodiments, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 5' end and / or 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 3' end of the nucleotide sequence set forth as SEQ ID NO: 1 or the mutant described herein are LNA modified nucleotides.

[0082] In some embodiments, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 5' end or 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 3' end of the nucleotide sequence set forth as SEQ ID NO: 1 or the mutant described herein comprise a LNA modification. In some embodiments, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 5' end or 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 3' end of the nucleotide sequence set forth as SEQ ID NO: 1 or the mutant described herein are LNA modified nucleotides.

[0083] In some embodiments, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 5' end and 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 3' end of the nucleotide sequence set forth as SEQ ID NO: 1 or the mutant described herein comprise a LNA modification. In some embodiments, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 5' end and 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 3' end of the nucleotide sequence set forth as SEQ ID NO: 1 or the mutant described herein are LNA modified nucleotides.

[0084] In some embodiments, the 1st, 2nd, and 3rd nucleotides from the 5' end of the nucleotide sequence set forth as SEQ ID NO: 1 or the mutant described herein comprise LNA modifications, and the 1st, 2nd, and 3rd nucleotides from the 3' end comprise LNA modifications. In some embodiments, the 1st, 2nd, 3rd nucleotides from the 5' end and the 1st, 2nd, and 3rd nucleotides from the 3' end of the nucleotide sequence set forth as SEQ ID NO: 1 or the mutant described herein are LNA modified nucleotides.

[0085] In some embodiments, the LNA modification described herein is one or more modifications selected from the group consisting of a methylenoxy (4'-CH2-0-2') LNA modification, an ethylenoxy (4'-(CH2)2-0-2') LNA modification, a methylenoxyamino (4'-CH2-0-N(R)-2') LNA modification, and a methyleneaminooxy (4'-CH2-N(R)-0-2') LNA modification. In some embodiments, the LNA modification described herein is an alpha-L-methylenoxy (4'-CH2-0-2') LNA modification or a beta-D-methylenoxy (4'-CH2-0-2') LNA modification. In some embodiments, the LNA modification described herein is an alpha-L-methylenoxy (4'-CH2-0-2') LNA modification. In some embodiments, the LNA modification described herein is a beta-D-methylenoxy (4'-CH2-0-2') LNA modification.

[0086] In some embodiments, any one or more (e.g., all of the remaining) nucleosides in the oligonucleotide targeting DNMT1 provided herein, other than the 3 nucleosides from the 5' end and the 3 nucleosides from the 3' end of the nucleotide sequence set forth in SEQ ID NO: 1, or a mutant thereof having at least 90% sequence identity thereto, are unmodified nucleosides. The any one or more nucleosides can be from 2 to 14 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14). The any one or more nucleosides can be contiguous or non-contiguous. A "unmodified" nucleoside refers to a nucleoside having a naturally occurring sugar moiety and a nucleobase moiety. Naturally occurring sugar moieties include, for example, ribose (e.g., beta-D-ribose) naturally occurring in RNA or deoxyribose (e.g., beta-D-deoxyribose) naturally occurring in DNA. Naturally occurring nucleobases include purine bases adenine (A) and guanine (G), and pyrimidine bases thymine (T), cytosine (C), and uracil (U). In some embodiments, the 4thto 17thnucleosides from the 5' end of the nucleotide sequence set forth in SEQ ID NO: 1 are deoxyribonucleosides. In some embodiments, the 4thto 17thnucleosides from the 5' end of the nucleotide sequence set forth in SEQ ID NO: 1 are unmodified deoxyribonucleosides.

[0087] In some embodiments, the oligonucleotide targeting DNMT1 provided herein further comprises at least one additional modification. The at least one additional modification can occur at any one or more positions of the nucleotide sequence set forth in SEQ ID NO: 1, or a mutant thereof having at least 90% sequence identity thereto. Moreover, the at least one additional modification can occur at a sugar moiety, at a nucleobase moiety, or at an internucleoside linkage.

[0088] In certain embodiments, the additional modification (e.g., a modification occurring at a sugar moiety) is selected from the group consisting of a 2'-O-methyl (Me) modification, a 2'-O-ethyl modification, a 2'-O-methoxyethyl (MOE) modification, a 2'-F modification, and a combination thereof.

[0089] In certain embodiments, the additional modification (e.g., a modification occurring at the nucleobase moiety) includes other synthetic or naturally occurring nucleobases in addition to naturally occurring A, G, T, C, and U, for example, deoxythymine (dT), 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil, 5-halocytosine, 5-propynyluracil, 5-propynylcytosine, 6-azauracil, 6-azacytosine, 6-azathymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (particularly 5-bromo, 5-trifluoromethyl) and other 5-substituted uracils and cytosines, 7-methylguanine, 7-methyladenine, 8-azaguanine, 8-azadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, or 3-deazaadenine.

[0090] In certain embodiments, the additional modification (e.g., a modification occurring at the internucleoside linkage) includes that the internucleoside linkage between at least two adjacent nucleosides or between all nucleosides is a phosphorothioate linkage. In certain embodiments, the additional modification includes that the internucleoside linkage between at least two (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) adjacent nucleosides is a phosphorothioate linkage. In certain embodiments, the additional modification includes that the internucleoside linkage between all nucleosides of the nucleotide sequence set forth in SEQ ID NO: 1 or a mutant having at least 90% sequence identity thereto is a phosphorothioate linkage. In certain embodiments, the additional modification includes that the internucleoside linkage between all nucleosides of the nucleotide sequence set forth in SEQ ID NO: 1 is a phosphorothioate linkage.

[0091] In some embodiments, the oligonucleotide targeting DNMT1 provided herein comprises the nucleotide sequence set forth in SEQ ID NO: 1, and the 3 nucleosides from the 5’ end and the 3 nucleosides from the 3’ end of the nucleotide sequence set forth in SEQ ID NO: 1 comprise LNA modification and at least one additional modification.

[0092] In some embodiments, the oligonucleotide targeting DNMT1 provided herein comprises the nucleotide sequence of SEQ ID NO: 1, and the 3 nucleotides from the 5' end and the 3 nucleotides from the 3' end of the nucleotide sequence of SEQ ID NO: 1 comprise LNA modification and at least one additional modification selected from the group consisting of 2'-0-methyl (Me) modification, 2'-0-ethyl modification, 2'-0-methoxyethyl (MOE) modification, 2'-F modification, modification in which the internucleoside linkage between at least two adjacent nucleosides or all nucleosides is a phosphorothioate linkage, and combinations thereof.

[0093] In some embodiments, the oligonucleotide targeting DNMT1 provided herein consists of the nucleotide sequence of SEQ ID NO: 1, and the 3 nucleotides from the 5' end and the 3 nucleotides from the 3' end of the nucleotide sequence of SEQ ID NO: 1 comprise LNA modification and at least one additional modification selected from the group consisting of 2'-0-methyl (Me) modification, 2'-0-ethyl modification, 2'-0-methoxyethyl (MOE) modification, 2'-F modification, modification in which the internucleoside linkage between at least two adjacent nucleosides or all nucleosides is a phosphorothioate linkage, and combinations thereof.

[0094] In some embodiments, the oligonucleotide targeting DNMT1 provided herein consists of the nucleotide sequence of SEQ ID NO: 1, and each of the 3 nucleotides from the 5' end and each of the 3 nucleotides from the 3' end of the nucleotide sequence of SEQ ID NO: 1 comprises LNA modification and at least one additional modification selected from the group consisting of 2'-0-methyl (Me) modification, 2'-0-ethyl modification, 2'-0-methoxyethyl (MOE) modification, 2'-F modification, modification in which the internucleoside linkage between at least two adjacent nucleosides or all nucleosides is a phosphorothioate linkage, and combinations thereof.

[0095] In some embodiments, the oligonucleotide targeting DNMT1 provided herein consists of the nucleotide sequence of SEQ ID NO: 1, and each of the 3 nucleotides from the 5' end and each of the 3 nucleotides from the 3' end of the nucleotide sequence of SEQ ID NO: 1 comprises LNA modification and at least one additional modification selected from the group consisting of 2'-0-methyl (Me) modification, 2'-0-ethyl modification, 2'-0-methoxyethyl (MOE) modification, 2'-F modification, modification in which the internucleoside linkage between at least two adjacent nucleosides or all nucleosides is a phosphorothioate linkage, and combinations thereof.

[0096] In some embodiments, the oligonucleotide targeting DNMT1 provided by the present application consists of the nucleotide sequence as set forth in SEQ ID NO: 1, and each of the 3 nucleotides from the 5' end and each of the 3 nucleotides from the 3' end of the nucleotide sequence as set forth in SEQ ID NO: 1 is a LNA modified nucleotide, and the internucleoside linkage between at least two adjacent nucleotides or between all nucleotides of the nucleotide sequence as set forth in SEQ ID NO: 1 is a phosphorothioate linkage.

[0097] In some embodiments, the oligonucleotide targeting DNMT1 provided by the present application consists of the nucleotide sequence as set forth in SEQ ID NO: 1, and each of the 3 nucleotides from the 5' end and each of the 3 nucleotides from the 3' end of the nucleotide sequence as set forth in SEQ ID NO: 1 is a LNA modified nucleotide, and the internucleoside linkage between at least two adjacent nucleotides or between all nucleotides of the nucleotide sequence as set forth in SEQ ID NO: 1 is a phosphorothioate linkage.

[0098] In some embodiments, the oligonucleotide targeting DNMT1 provided by the present application consists of the nucleotide sequence as set forth in SEQ ID NO: 1, and each of the 3 nucleotides from the 5' end and each of the 3 nucleotides from the 3' end of the nucleotide sequence as set forth in SEQ ID NO: 1 is a LNA modified nucleotide, and the internucleoside linkage between at least two adjacent nucleotides or between all nucleotides of the nucleotide sequence as set forth in SEQ ID NO: 1 is a phosphorothioate linkage.

[0099] In some embodiments, the oligonucleotide targeting DNMT1 provided by the present application is capable of inhibiting the DNMT1 gene. In some embodiments, the inhibition of the DNMT1 gene refers to the reduction of the expression of DNMT1. In some embodiments, the oligonucleotide targeting DNMT1 provided by the present application reduces the expression of DNMT1 by reducing the transcription of the mRNA of the DNMT1 gene and / or promoting the degradation of the mRNA of the DNMT1 gene. Therefore, in some embodiments, the oligonucleotide targeting DNMT1 provided by the present application is capable of reducing the transcription of the mRNA of the DNMT1 gene and / or promoting the degradation of the mRNA of the DNMT1 gene. In some embodiments, the oligonucleotide targeting DNMT1 provided by the present application is capable of specifically binding to the mRNA of the DNMT1 gene, thereby promoting the degradation of the mRNA of the DNMT1 gene. In some embodiments, the oligonucleotide targeting DNMT1 provided by the present application promotes the degradation of the mRNA of the DNMT1 gene at least by promoting the RNase-H1 mediated mRNA silencing.

[0100] In some embodiments, the oligonucleotide targeting DNMT1 provided by the present application causes translational repression by blocking the binding of ribosomes to the mRNA of the DNMT1 gene, thereby reducing the expression of DNMT1. Thus, in some embodiments, the oligonucleotide targeting DNMT1 provided by the present application is capable of causing translational repression by blocking the binding of ribosomes to the mRNA of the DNMT1 gene, thereby reducing the expression of DNMT1. In some embodiments, the oligonucleotide targeting DNMT1 provided by the present application reduces the expression of DNMT1 by modulating RNA splicing. Thus, in some embodiments, the oligonucleotide targeting DNMT1 provided by the present application is capable of modulating RNA splicing, thereby reducing the expression of DNMT1.

[0101] In some embodiments, the oligonucleotide targeting DNMT1 provided by the present application is single-stranded or double-stranded. In some embodiments, the oligonucleotide targeting DNMT1 provided by the present application is single-stranded. In some embodiments, the oligonucleotide targeting DNMT1 provided by the present application is an antisense oligonucleotide (ASO). In some embodiments, the oligonucleotide targeting DNMT1 provided by the present application is a single-stranded antisense oligonucleotide.

[0102] In some embodiments, the oligonucleotide targeting DNMT1 provided by the present application comprises a structure as shown in Formula 1. In some embodiments, the chemical structure of the oligonucleotide targeting DNMT1 provided by the present application is as shown in Formula 1.

[0103]

[0104] 2. Uses

[0105] In another aspect, the present application provides a method for modulating (e.g., reducing) the expression of DNMT1 in a target cell expressing DNMT1. In some embodiments, the method comprises the step of: exposing the target cell to the oligonucleotide targeting DNMT1, the composition or the vector provided by the present application (for specific description of the composition, the vector, please refer to Section VII and Section VIII of the present application).

[0106] The method can be implemented in vivo or in vitro.

[0107] Contacting a cell in vivo with the oligonucleotide targeting DNMT1, composition or vector comprising the same provided herein includes contacting a cell or population of cells in a subject (e.g., a human subject) in vivo with the oligonucleotide targeting DNMT1, composition or vector comprising the same provided herein. Further, contacting a cell in vivo can be achieved by a targeting ligand, including any ligand described herein or known in the art. In some embodiments, the targeting ligand is a carbohydrate moiety, e.g., a GalNAc3 ligand, or any other ligand that can direct the oligonucleotide targeting DNMT1 provided herein to a site of interest (e.g., the liver of a subject).

[0108] Contacting a cell in vitro with the oligonucleotide targeting DNMT1, composition or vector comprising the same provided herein can be achieved by incubating the cell with the oligonucleotide targeting DNMT1, composition or vector comprising the same provided herein. Combinations of in vitro and in vivo contacting methods are also possible. For example, a cell can also be contacted with the oligonucleotide targeting DNMT1, composition or vector comprising the same provided herein in vitro and then transplanted into a subject in vivo.

[0109] In some embodiments, after exposing a target cell expressing DNMT1 to the oligonucleotide targeting DNMT1, composition or vector comprising the same provided herein, the expression level of the DNMT1 gene in the target cell is reduced, e.g., by at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99% or more.

[0110] In some embodiments, the mRNA level of DNMT1 in a target cell expressing DNMT1 is reduced, e.g., by at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99% or more, after exposing the target cell to a DNMT1 -targeting oligonucleotide, a composition comprising the same, or a vector provided herein.

[0111] In some embodiments, the protein level of DNMT1 in a target cell expressing DNMT1 is reduced, e.g., by at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99% or more, after exposing the target cell to a DNMT1 -targeting oligonucleotide, a composition comprising the same, or a vector provided herein.

[0112] Reduction in the level of gene expression can be assessed by any method known in the art. For example, reduction in DNMT1 expression can be determined by determining the mRNA expression level of DNMT1 using routine methods to those skilled in the art, e.g., Northern blot, qRT-PCR, by determining the protein level of DNMT1 using routine methods to those skilled in the art, e.g., Western blot, immunological techniques, flow cytometry methods, ELISA, and / or by determining the biological activity of DNMT1, etc.

[0113] Reduction in the level of DNMT1 expression in the target cell can be assessed by a reduction in the absolute or relative level of one or more variables associated with DNMT1 expression compared to a control level. The control level can be any type of control level used in the art, e.g., pre-dose baseline level, or a level determined from a similar subject, cell or sample that has not been treated or treated with a control (e.g., buffer control or non-active agent control).

[0114] In some embodiments, the target cell expressing DNMT1 can be an in vivo cell or an ex vivo cell. In some embodiments, for in vivo implementation, the target cell expressing DNMT1 can be from a human and a non-human animal. In some embodiments, the non-human animal includes all vertebrates, e.g., mammals and non-mammals. In some embodiments, the non-human animal can also be a domestic animal, e.g., cattle, swine, sheep, fowl and horses, or a pet animal, e.g., dogs and cats. In some embodiments, the target cell expressing DNMT1 can be from a male (e.g., a man) or a female (e.g., a woman), can be from an elderly, an adult, a teenager, a child or an infant.

[0115] In some embodiments, the target cell expressing DNMT1 is a hematopoietic stem cell, a neural stem cell, a cancer cell, a dendritic cell, a monocyte, a macrophage, a B cell, a Treg, a neutrophil, a basophil, a platelet, a progenitor mast cell, an endothelial cell, a neuronal cell, an osteoclast or an antigen presenting cell. In some embodiments, the target cell expressing DNMT1 is a cancer cell. In some embodiments, the target cell expressing DNMT1 is a liver cancer cell (e.g., a HepG2 cell).

[0116] In another aspect, the present application also provides a method of preventing, inhibiting or reversing gene methylation, the method comprising administering to a subject in need thereof an effective amount of the oligonucleotide targeting DNMT1, the composition or the vector comprising the same provided by the present application.

[0117] "Preventing methylation of a gene" refers to a decrease in the likelihood of methylation of a gene in a subject in need thereof after administration of an effective amount of the DNMT1 -targeting oligonucleotide provided herein, a composition comprising the same, or a vector thereof, as compared to the subject's own condition before administration of the DNMT1 -targeting oligonucleotide provided herein, a composition comprising the same, or a vector thereof, or as compared to a subject not administered the DNMT1 -targeting oligonucleotide provided herein, a composition comprising the same, or a vector thereof.

[0118] "Inhibiting methylation of a gene" refers to a decrease in the rate of increase in the level of methylation of a gene in a subject in need thereof after administration of an effective amount of the DNMT1 -targeting oligonucleotide provided herein, a composition comprising the same, or a vector thereof, as compared to the subject's own condition before administration of the DNMT1 -targeting oligonucleotide provided herein, a composition comprising the same, or a vector thereof, or as compared to a subject not administered the DNMT1 -targeting oligonucleotide provided herein, a composition comprising the same, or a vector thereof.

[0119] "Reversing methylation of a gene" refers to a change from an increase to a decrease in the level of methylation of a gene in a subject in need thereof after administration of an effective amount of the DNMT1 -targeting oligonucleotide provided herein, a composition comprising the same, or a vector thereof, as compared to the subject's own condition before administration of the DNMT1 -targeting oligonucleotide provided herein, a composition comprising the same, or a vector thereof, or as compared to a subject not administered the DNMT1 -targeting oligonucleotide provided herein, a composition comprising the same, or a vector thereof.

[0120] One skilled in the art can determine the level of methylation of a gene by routine methods in the art. For example, the level of methylation of a gene can be determined by quantitatively analyzing the amount of intact DNA present after restriction digestion with a methylation-sensitive restriction enzyme. In this example, if a particular sequence in the DNA is quantitatively analyzed using quantitative PCR, and the amount of template DNA is approximately equal to that in a mock-treated control sample, then the sequence is not highly methylated; whereas, if the amount of template DNA is significantly less than that in the mock-treated control sample, then there is methylation DNA in the sequence.

[0121] In some embodiments, the gene whose methylation is prevented, inhibited, or reversed can be any gene. In some embodiments, the gene is selected from the group consisting of APC, BRCA1, CDKN2A, CDKN2B, MLH1, RASSF1A, LIFR.

[0122] In some embodiments, the method can be performed in vivo or in vitro. In some embodiments, for in vivo performance, the subject can be a human and a non-human animal. In some embodiments, the non-human animal includes all vertebrates, such as mammals and non-mammals. In some embodiments, the subject can also be a domesticated animal, such as a cow, pig, sheep, poultry, and horse, or a pet, such as a dog and cat. In some embodiments, the subject can be a male (e.g., a man) or a female (e.g., a woman), and can be an elderly, an adult, a teenager, a child, or an infant.

[0123] In another aspect, the present application also provides a method for treating or preventing a disease, which comprises administering to a subject in need thereof an effective amount of the oligonucleotide targeting DNMT1, the composition comprising the same, or the vector provided by the present application.

[0124] In another aspect, the present application also provides the use of the oligonucleotide targeting DNMT1, the composition comprising the same, or the vector provided by the present application in the preparation of a medicament for treating or preventing a disease.

[0125] In another aspect, the present application also provides the oligonucleotide targeting DNMT1, the composition comprising the same, or the vector for treating or preventing a disease.

[0126] In some embodiments, the subject is a mammal (e.g., a human), for example, the subject has a disease that has been treated or evaluated for possible benefit from a reduction in DNMT1 expression; the subject is at risk of having a disease that can benefit from a reduction in DNMT1 expression; the subject has a disease that can benefit from a reduction in DNMT1 expression.

[0127] In some embodiments, the disease is associated with an elevated level of gene methylation. In some embodiments, the disease is associated with an elevated level of DNMT1. In some embodiments, the disease is cancer. In some embodiments, the cancer is selected from the group consisting of liver cancer, breast cancer, colon cancer, rectal cancer, lung cancer, bladder cancer, leukemia, myelodysplastic syndrome (MDS), lymphoma, melanoma, kidney cancer, and gastric cancer.

[0128] In some embodiments, the subject has an improved health status after receiving a DNMT1 -targeting oligonucleotide, a composition comprising the same, or a vector provided herein. The term "improved" means that at least one indicator of a condition or disease severity is reduced, slowed, halted, or reversed. For example, a condition or disease severity can be reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%. The severity of an indicator can be determined by subjective or objective measures known to one of skill in the art. Treatment or prevention is evident when one or more parameters of a disease state are statistically significantly improved, or because of a failure to worsen or develop symptoms that would otherwise be expected. For example, at least a 10% favorable change in a measurable disease parameter, more preferably at least a 20%, 30%, 40%, 50%, or more, can indicate effective treatment. Efficacy of a given DNMT1 -targeting oligonucleotide drug or formulation of the drug can also be judged using experimental animal models of a given disease known in the art. When experimental animal models are used, efficacy of a treatment can be demonstrated when a statistically significant decrease in a marker or symptom is observed.

[0129] The oligonucleotide targeting DNMT1, the composition comprising the same, or the vector provided by the present application can be administered to a subject at a dose of 0.01 to 50 mg / kg. For example, at 0.01 mg / kg, 0.02 mg / kg, 0.03 mg / kg, 0.04 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.15 mg / kg, 0.2 mg / kg, 0.25 mg / kg, 0.3 mg / kg, 0.35 mg / kg, 0.4 mg / kg, 0.45 mg / kg, 0.5 mg / kg, 0.55 mg / kg, 0.6 mg / kg, 0.65 mg / kg, 0.7 mg / kg, 0.75 mg / kg, 0.8 mg / kg, 0.85 mg / kg, 0.9 mg / kg, 0.95 mg / kg, 1.0 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2.0 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3.0 mg / kg, 3.1 mg / kg, 3.2 mg / kg, 3.3 mg / kg, 3.4 mg / kg, 3.5 mg / kg, 3.6 mg / kg, 3.7 mg / kg, 3.8 mg / kg, 3.9 mg / kg, 4.0 mg / kg, 4.1 mg / kg, 4.2 mg / kg, 4.3 mg / kg, 4.4 mg / kg, 4.5 mg / kg, 4.6 mg / kg, 4.7 mg / kg, 4.8 mg / kg, 4.9 mg / kg, 5.0 mg / kg, 5.1 mg / kg, 5.2 mg / kg, 5.3 mg / kg, 5.4 mg / kg, 5.5 mg / kg, 5.6 mg / kg, 5.7 mg / kg, 5.8 mg / kg, 5.9 mg / kg, 6.0 mg / kg, 6.1 mg / kg, 6.2 mg / kg, 6.3 mg / kg, 6.4 mg / kg, 6.5 mg / kg, 6.6 mg / kg, 6.7 mg / kg, 6.8 mg / kg, 6.9 mg / kg, 7.0 mg / kg, 7.1 mg / kg, 7.2 mg / kg, 7.3 mg / kg, 7.4 mg / kg, 7.5 mg / kg, 7.6 mg / kg, 7.7 mg / kg, 7.8 mg / kg, 7.9 mg / kg, 8.0 mg / kg, 8.1 mg / kg, 8.2 mg / kg, 8.3 mg / kg, 8.4 mg / kg, 8.5 mg / kg, 8.6 mg / kg, 8.7 mg / kg, 8.8 mg / kg, 8.9 mg / kg, 9.The subject is administered the DNMT1 -targeting oligonucleotide, composition or vector comprising the same provided herein at a dose of 0 mg / kg, 9.1 mg / kg, 9.2 mg / kg, 9.3 mg / kg, 9.4 mg / kg, 9.5 mg / kg, 9.6 mg / kg, 9.7 mg / kg, 9.8 mg / kg, 9.9 mg / kg, 9.0 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, or 50 mg / kg. Values and ranges intermediate to the above recited values are also part of the present application.

[0130] The DNMT1 -targeting oligonucleotide, composition or vector comprising the same provided herein can be administered to a subject by a variety of routes of administration, for example, by topical, oral, intranasal, parenteral, enteral, rectal, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, buccal, sublingual, or ocular routes, etc.

[0131] In another aspect, the present application also provides a method of assisting a cell therapy, comprising administering to a subject in need thereof an effective amount of the DNMT1 -targeting oligonucleotide, composition or vector comprising the same provided herein.

[0132] In another aspect, the present application also provides a method of treating or preventing a disease, comprising administering to a subject in need thereof a cell therapy and an effective amount of the DNMT1 -targeting oligonucleotide, composition or vector comprising the same provided herein.

[0133] In another aspect, the present application also provides the use of a cell therapy and the DNMT1 -targeting oligonucleotide, composition or vector comprising the same provided herein in the treatment or prevention of a disease.

[0134] In another aspect, the present application also provides the use of an agent for cell therapy and the DNMT1 -targeting oligonucleotide, composition or vector comprising the same provided herein in the preparation of a medicament for treating or preventing a disease. The “agent for cell therapy” includes, for example, a T cell modified via a chimeric antigen receptor (CAR), an NK cell, a macrophage, a Treg cell, a T cell with a modified T cell receptor (TCR), etc.

[0135] The term "cell therapy" refers to a therapy that injects, transplants or implants live cells into a patient to achieve a therapeutic effect. Exemplary cell therapies include CAR-T therapy, CAR-NK therapy, CAR-NKT therapy, CAR-M therapy, CAR-Treg therapy or TCR-T therapy, etc. Common side effects of cell therapy are well known in the art, for example, cytokine release syndrome (also known as "cytokine storm"), neurologic toxicity, tumor lysis syndrome, cytopenia, infection, hypogammaglobulinemia, hepatitis B virus activation, etc.

[0136] In some embodiments, the DNMT1 -targeting oligonucleotide, the composition or the vector comprising the same provided by the present application can enhance the therapeutic effect of a cell therapy, for example, enhance the anti-tumor effect of a cell therapy. In some embodiments, the DNMT1 -targeting oligonucleotide, the composition or the vector comprising the same provided by the present application can reduce the side effects of a cell therapy, for example, reduce cytokine storm.

[0137] III. Method for screening target gene regulated by DNA methylation and method for reprogramming methylation regulation region of target gene

[0138] In one aspect, the present application provides a method for screening a target gene regulated by DNA methylation. The method can be implemented in vivo or in vitro. In some embodiments, the present application provides a method for screening a target gene regulated by DNA methylation, which comprises the following steps:

[0139] (a) preparing a DNMT1 knockdown sample using the DNMT1 -targeting oligonucleotide, the composition or the vector comprising the same provided by the present application;

[0140] (b) performing methylation quantification and expression quantification on the DNMT1 knockdown sample prepared in step (a) and the control sample, respectively, and performing methylation difference analysis and expression difference analysis; and

[0141] (c) performing correlation analysis on the methylation difference analysis and the expression difference analysis in step (b), thereby determining the target gene regulated by DNA methylation; wherein when the methylation difference analysis and the expression difference analysis show that the methylation level of a certain gene at CpG site is negatively or positively correlated with its expression, the gene is determined as the target gene regulated by DNA methylation.

[0142] "DNMT1 knockdown" refers to a decrease in the gene expression level of DNMT1, for example, a decrease in the level of DNMT1 mRNA, a decrease in the level of DNMT1 protein, etc. The mRNA level and the level of DNMT1 protein can be easily determined by means known in the art.

[0143] In some embodiments, the expression level of DNMT1 gene in the DNMT1 knockdown sample prepared using the oligonucleotide targeting DNMT1, the composition or the vector provided by the present application is at least 10% lower, at least 15% lower, at least 20% lower, at least 25% lower, at least 30% lower, at least 35% lower, at least 40% lower, at least 45% lower, at least 50% lower, at least 55% lower, at least 60% lower, at least 65% lower, at least 70% lower, at least 75% lower, at least 80% lower, at least 85% lower, at least 90% lower, at least 95% lower, at least 98% lower, or at least 99% lower, etc., compared to the case without using the oligonucleotide targeting DNMT1, the composition or the vector provided by the present application. In some embodiments, the expression of DNMT1 gene in the DNMT1 knockdown sample prepared using the oligonucleotide targeting DNMT1, the composition or the vector provided by the present application is completely absent, i.e., the DNMT1 gene is knocked out.

[0144] Methylation quantification can be performed by techniques known in the art, for example, by whole genome bisulfite sequencing (WGBS), precision DNA methylation and hydroxymethylation sequencing (oxBS-seq), reduced representation bisulfite sequencing (RRBS), single / microcell whole genome bisulfite sequencing (scWGBS), or methylation DNA immunoprecipitation sequencing (MeDIP-seq). In some embodiments, methylation quantification is performed by RRBS. RRBS is a method of enriching fragments rich in CCGG sites on genomic DNA by restriction enzyme digestion, bisulfite treatment and high-throughput sequencing technology to perform single-base resolution methylation sequencing in CpG-rich regions of the genome (Methods Mol Biol. 2023: 2577: 39-51. doi: 10.1007 / 978-1-0716-2724-2_3). In some embodiments, methylation quantification is performed on the prepared DNMT1 knockdown sample and the control sample according to the method described in Example 1.2 of the present application.

[0145] The expression quantification can be performed by methods known in the art. For example, the expression quantification can be performed by quantifying the mRNA of the target gene, for example, by semi-quantitative RT-PCR, Northern blot, Quantitative Real-time PCR, RNA-seq, etc. In some embodiments, the expression quantification can be performed by quantifying the protein of the target gene expression, for example, by Western blotting, ELISA (Enzyme linked immunosorbent assay), HPLC (High Performance Liquid Chromatography), immunofluorescence technology, protein activity detection, etc. In some embodiments, the expression quantification is performed by RNA-seq. In some embodiments, the expression quantification of the prepared DNMT1 knockdown samples and control samples is performed according to the method described in Example 1.2 of the present application.

[0146] In some embodiments, wherein in step (c), when the differential methylation analysis shows that the methylation level of the CpG site of a certain gene is reduced, and the differential expression analysis shows that the expression amount of the gene is increased or reduced, the gene is determined as a target gene regulated by DNA methylation. For example, when the differential methylation analysis shows that the methylation level of the CpG site of a certain gene is reduced, and the differential expression analysis shows that the expression amount of the gene is increased, the gene is determined as a target gene negatively regulated by DNA methylation. For another example, when the differential methylation analysis shows that the methylation level of the CpG site of a certain gene is reduced, and the differential expression analysis shows that the expression amount of the gene is also reduced, the gene is determined as a target gene positively regulated by DNA methylation.

[0147] In some embodiments, wherein in step (c), when the differential methylation analysis shows that the methylation level of the CpG site of a certain gene is increased, and the differential expression analysis shows that the expression amount of the gene is reduced or increased, the gene is determined as a target gene regulated by DNA methylation. For example, when the differential methylation analysis shows that the methylation level of the CpG site of a certain gene is increased, and the differential expression analysis shows that the expression amount of the gene is reduced, the gene is determined as a target gene negatively regulated by DNA methylation. For another example, when the differential methylation analysis shows that the methylation level of the CpG site of a certain gene is increased, and the differential expression analysis shows that the expression amount of the gene is increased, the gene is determined as a target gene positively regulated by DNA methylation.

[0148] Differential methylation analysis and differential expression analysis can be performed by methods known in the art. For example, in some embodiments, the differential analysis can be performed by significance test. The term "significance test" generally refers to a way to judge whether the difference between a sample and a hypothetical distribution is significant. For example, by significance test, it can be judged whether the variation of methylation level or expression level of a sample to be tested belongs to a significant difference. In some embodiments, differentially methylated regions (DMRs) are identified by the metilene tool. In some embodiments, DMRs are identified by the metilene tool, wherein the criteria for judging DMRs include: 1) the distance between adjacent CpG sites in a DMR is ≤ 300 bp, 2) the number of CpG sites contained in a DMR is ≥ 5, 3) the difference in methylation level between groups of a DMR is > 0.1, and 4) the q-value is corrected using the Benjamini-Hochberg method, and the threshold is set to 0.05. In some embodiments, differentially expressed genes (DEGs) between groups are identified by the DESeq2 tool. In some embodiments, DEGs are identified by the DESeq2 tool, and identified using the default threshold false discovery rate (FDR) < 0.1. In some embodiments, differential methylation analysis and differential expression analysis are performed on the prepared DNMT1 knockdown samples and control samples according to the method described in Example 1.3 of the present application.

[0149] Correlation analysis between differential methylation analysis and differential expression analysis can also be performed by methods known in the art. For example, the correlation analysis includes the following steps: a) determining the intersection of genes involved in DMRs and DEGs; b) performing correlation analysis on the expression of DEGs and the methylation level of each CpG site in the DMRs involved; and c) determining the correlation between the methylation level of a CpG site and its expression according to the standard of significant correlation.

[0150] In some embodiments, the correlation analysis includes the following steps: a) determining the intersection of genes involved in DMRs and DEGs; b) performing Spearman correlation analysis on the expression of DEGs and the methylation level of each CpG site in the DMRs involved; and c) determining the correlation between the methylation level of a CpG site and its expression according to the standard of significant correlation (e.g., the absolute value of the correlation coefficient rho is greater than 0.6, and the p-value is < 0.05). In some embodiments, the correlation analysis of differential methylation analysis and differential expression analysis is performed according to the method described in Example 1.4 of the present application.

[0151] In another aspect, the present application also provides a kit for performing the method of screening target genes regulated by DNA methylation described herein. In some embodiments, the kit comprises an oligonucleotide targeting DNMT1 as described in Section II herein, a composition comprising an oligonucleotide targeting DNMT1 as described in Section VII herein, or a vector comprising an oligonucleotide targeting DNMT1 as described in Section VIII herein. In some embodiments, the kit comprises an oligonucleotide targeting DNMT1, wherein the oligonucleotide comprises a nucleotide sequence as set forth in SEQ ID NO: 1, the 1st, 2nd and 3rd nucleotides from the 5' end of the nucleotide sequence as set forth in SEQ ID NO: 1 comprise LNA modification, and the 1st, 2nd and 3rd nucleotides from the 3' end comprise LNA modification. In some embodiments, the kit comprises an oligonucleotide targeting DNMT1, wherein the chemical structure of the oligonucleotide is as set forth in Chemical Formula 1.

[0152] In another aspect, the present application also provides use of an oligonucleotide targeting DNMT1, a composition comprising the same, or a vector comprising the same provided by the present application in the manufacture of a kit for screening target genes regulated by DNA methylation, the screening comprising the steps of:

[0153] (a) preparing a DNMT1 knockdown sample using an oligonucleotide targeting DNMT1, a composition comprising the same, or a vector comprising the same provided by the present application;

[0154] (b) performing methylation quantification and expression quantification on the DNMT1 knockdown sample prepared in step (a) and a control sample, respectively, and performing differential methylation analysis and differential expression analysis; and

[0155] (c) performing correlation analysis on the differential methylation analysis and the differential expression analysis in step (b), thereby determining a target gene regulated by DNA methylation; wherein when the differential methylation analysis and the differential expression analysis show that the methylation level of a CpG site of a gene is negatively or positively correlated with the expression level of the gene, the gene is determined as a target gene regulated by DNA methylation.

[0156] In some embodiments, the kit further comprises a container suitable for storing the sample. In some embodiments, the kit further comprises instructions for use and / or interpretation of the results of the kit.

[0157] In another aspect, the present application also provides a method of reprogramming a methylation regulatory region of a target gene. The method can be performed in vivo or in vitro. In some embodiments, the present application also provides a method of reprogramming a methylation regulatory region of a target gene, the method comprising the steps of:

[0158] (i). selecting a methylation regulatory region of a target gene;

[0159] (ii). selecting an oligonucleotide complementary to the sense strand or the antisense strand of the methylation regulatory region of the target gene selected in step (i); and

[0160] (iii). reprogramming the methylation regulatory region of the target gene using the oligonucleotide selected in step (ii).

[0161] In some embodiments, the "target gene" mentioned in the "method of reprogramming the methylation regulatory region of a target gene" is obtained by screening the target genes regulated by DNA methylation by the method of screening the target genes regulated by DNA methylation described in the present application. In some embodiments, the above-mentioned inferred genes regulated by DNA methylation are subjected to biological function analysis (for example, biological function analysis according to the method described in Example 1.5 of the present application), so as to screen the target genes and evaluate the feasibility of reprogramming thereof. In some embodiments, the target genes are determined according to the method described in Example 1.5 of the present application.

[0162] In some embodiments, the target gene is a tumor suppressor gene. In some embodiments, the target gene is a tumor suppressor gene that exhibits up-regulation of expression after knockdown of DNMT1. In some embodiments, the target gene is a tumor suppressor gene that exhibits up-regulation of expression after at least about 90% (for example, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%) reduction in the amount of DNMT1 mRNA expression. In some embodiments, the target gene is a tumor suppressor gene that exhibits up-regulation of expression after at least about 97.7% reduction in the amount of DNMT1 mRNA expression. In some embodiments, the target gene is a tumor suppressor gene that exhibits up-regulation of expression after about 97.7% reduction in the amount of DNMT1 mRNA expression. In some embodiments, the target gene is a tumor suppressor gene that exhibits up-regulation of expression after at least about 77% (for example, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%) reduction in the amount of DNMT1 protein expression. In some embodiments, the target gene is a tumor suppressor gene that exhibits up-regulation of expression after at least about 86.6% reduction in the amount of DNMT1 protein expression. In some embodiments, the target gene is a tumor suppressor gene that exhibits up-regulation of expression after about 86.6% reduction in the amount of DNMT1 protein expression.

[0163] In some embodiments, the DMRs involved in the target gene comprise methylation sites that are significantly associated with expression, and their DMRs are located in or near a regulatory element (e.g., a promoter, an enhancer, etc.). In some embodiments, the target gene is selected from the group consisting of FBX031, FBX032, IGF2R, LIFR, MAD1L1, PLEKHO1, RUNX3, STK10, and combinations thereof. In some embodiments, the target gene is LIFR.

[0164] In some embodiments, in the method for reprogramming the methylation regulatory region of a target gene provided in the present application, step (i) comprises selecting a target gene methylation regulatory region. In some embodiments, the target gene methylation regulatory region is selected according to the method described in Example 2.1 of the present application.

[0165] The “methylation regulatory region” refers to a region of a target gene comprising at least one CpG site, and the methylation level of the CpG site is negatively or positively correlated with the expression level of the target gene. “Negative correlation” means that the higher the methylation level of the CpG site of a certain target gene, the lower the expression level of the target gene; or the lower the methylation level of the CpG site of a certain target gene, the higher the expression level of the target gene. “Positive correlation” means that the higher the methylation level of the CpG site of a certain target gene, the higher the expression level of the target gene; or the lower the methylation level of the CpG site of a certain target gene, the lower the expression level of the target gene.

[0166] In some embodiments, the methylation regulatory region comprises 1 to 30 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) CpG sites. In some embodiments, the methylation regulatory region comprises 20 CpG sites. In some embodiments, the distance between adjacent CpG sites in the methylation regulatory region is ≤500 bp, ≤400 bp, ≤300 bp, ≤200 bp, or ≤100 bp.

[0167] In some embodiments, in the method for reprogramming the methylation regulatory region of a target gene provided in the present application, the target gene methylation regulatory region selected in step (i) is the promoter region of the LIFR gene or the region adjacent thereto. In some embodiments, the target gene methylation regulatory region selected in step (i) is the region of chr5:38595894-38596033 of the LIFR gene. In some embodiments, the nucleotide sequence of the target gene methylation regulatory region selected in step (i) is as set forth in SEQ ID NO: 2 or SEQ ID NO: 3.

[0168] In some embodiments, in the method for reprogramming the methylation regulatory region of a target gene provided in the present application, step (ii) comprises selecting an oligonucleotide complementary to the sense strand or the antisense strand of the target gene methylation regulatory region selected according to step (i).

[0169] The person skilled in the art can select or design the oligonucleotide complementary to the sense strand or the antisense strand of the target gene methylation regulatory region according to methods well known in the art. In some embodiments, the oligonucleotide complementary to the sense strand or the antisense strand of the target gene methylation regulatory region is selected or designed according to the method described in Example 2.2 of the present application. Once the sequence of the oligonucleotide complementary to the sense strand or the antisense strand of the target gene methylation regulatory region is determined, the person skilled in the art can synthesize or prepare the oligonucleotide according to methods well known in the art (e.g., by chemical synthesis method). In some embodiments, the oligonucleotide is synthesized or prepared according to the method described in Example 2.3 of the present application.

[0170] In some embodiments, the oligonucleotide is an oligonucleotide described in Part IV of the present application. In some embodiments, the oligonucleotide comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 17. In some embodiments, the oligonucleotide consists of a nucleotide sequence as set forth in SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 17. In some embodiments, the oligonucleotide consists of a nucleotide sequence as set forth in SEQ ID NO: 6. In some embodiments, the chemical structure of the oligonucleotide is as set forth in Chemical Formula 2, Chemical Formula 3, Chemical Formula 4, or Chemical Formula 5. In some embodiments, the chemical structure of the oligonucleotide is as set forth in Chemical Formula 4. In some embodiments, the chemical structure of the oligonucleotide is as set forth in Chemical Formula 5.

[0171] In some embodiments, in the method of reprogramming a methylation regulatory region of a target gene provided herein, step (iii) comprises reprogramming the methylation regulatory region of the target gene using the oligonucleotide selected in step (ii).

[0172] In another aspect, the present application also provides a kit for performing the method of reprogramming a methylation regulatory region of a target gene described herein.

[0173] In the present application, "reprogramming" a methylation regulatory region of a target gene means changing (e.g., decreasing or increasing) the DNA methylation level of the methylation regulatory region of the target gene, or interfering with the function of the methylation regulatory region, thereby modulating (e.g., up-regulating or down-regulating) the expression of the target gene. In some embodiments, the reprogramming comprises decreasing the methylation level of at least one CpG site (e.g., 1 to 30 CpG sites) in the methylation regulatory region of the target gene. In some embodiments, the reprogramming comprises decreasing the methylation level of all CpG sites in the methylation regulatory region of the target gene. In some embodiments, the reprogramming comprises increasing the methylation level of at least one CpG site (e.g., 1 to 30 CpG sites) in the methylation regulatory region of the target gene. In some embodiments, the reprogramming comprises increasing the methylation level of all CpG sites in the methylation regulatory region of the target gene.

[0174] In some embodiments, the kit comprises reagents for selecting a methylation regulatory region of a target gene. In some embodiments, the kit comprises an oligonucleotide complementary to the sense strand or the antisense strand of the selected methylation regulatory region of a target gene (e.g., an oligonucleotide as set forth in SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 17, an oligonucleotide as set forth in Chemical Formula 2, Chemical Formula 3, Chemical Formula 4, or Chemical Formula 5, etc.). In some embodiments, the kit comprises reagents for selecting a methylation regulatory region of a target gene, and further comprises an oligonucleotide complementary to the sense strand or the antisense strand of the selected methylation regulatory region of a target gene (e.g., an oligonucleotide as set forth in SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 17, an oligonucleotide as set forth in Chemical Formula 2, Chemical Formula 3, Chemical Formula 4, or Chemical Formula 5, etc.).

[0175] In another aspect, the present application also provides use of an oligonucleotide complementary to a sense strand or an antisense strand of a methylation regulatory region of a target gene in the preparation of a kit for reprogramming the methylation regulatory region of the target gene. In another aspect, the present application also provides use of (a) a reagent for selecting a methylation regulatory region of a target gene and (b) an oligonucleotide complementary to a sense strand or an antisense strand of the selected methylation regulatory region of the target gene in the preparation of a kit for reprogramming the methylation regulatory region of the target gene. In some embodiments, the oligonucleotide comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 17. In some embodiments, the oligonucleotide consists of a nucleotide sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 17. In some embodiments, the oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 6. In some embodiments, the chemical structure of the oligonucleotide is represented by Chemical Formula 2, Chemical Formula 3, Chemical Formula 4, or Chemical Formula 5. In some embodiments, the chemical structure of the oligonucleotide is represented by Chemical Formula 4.

[0176] In some embodiments, the kit further comprises a container suitable for storing the sample. In some embodiments, the kit further comprises instructions for use and / or interpretation of the results of the kit.

[0177] IV. Compounds targeting LIFR and uses thereof

[0178] Based on the results obtained by the above-mentioned methods, the inventors of the present application determined a new key methylation regulatory region of the target gene LIFR gene: the chr5:38595894-38596033 region of the LIFR gene. The inventors of the present application found that the chr5:38595894-38596033 region of the LIFR gene has 20 CpG sites in a very small range, and the methylation levels of these CpG sites are significantly correlated with the expression of the LIFR gene, which is an ideal target. After verification, the inventors of the present application confirmed that by targeting this region, the expression of the LIFR gene can be regulated.

[0179] The LIFR gene directs the synthesis of the LIFR protein. LIFR is the receptor for Leukemia Inhibitory Factor (LIF). The LIF / LIFR signaling pathway can control multiple cellular processes, including growth and division (proliferation), maturation (differentiation), and survival. The LIF / LIFR signaling pathway was originally discovered to play an important role in inhibiting the growth of leukemia cells, it is also involved in bone formation and the development of nerve cells. LIFR is considered a tumor suppressor gene, and aberrantly high methylation of the tumor suppressor gene promoter can lead to tumor suppressor gene silencing, causing cells to escape normal cell cycle. The present invention provides compounds (e.g., oligonucleotides) that target the LIFR gene promoter region or a sub-region thereof (e.g., the chr5:38595894-38596033 region), thereby reprogramming DNA methylation of the region, and in turn modulating (e.g., upregulating) expression of the LIFR gene.

[0180] 1. Compounds targeting LIFR

[0181] In one aspect, the present invention provides a compound (e.g., an antisense or sense oligonucleotide) and a composition comprising the same, wherein the compound (e.g., an antisense or sense oligonucleotide) targets the LIFR gene promoter region or a sub-region thereof (e.g., the chr5:38595894-38596033 region or a region of about 10 to 50 nucleotides in length within the region). The LIFR-targeting oligonucleotides provided by the present invention bind to the LIFR gene promoter region or a sub-region thereof (e.g., the chr5:38595894-38596033 region or a region of about 10 to 50 nucleotides in length within the region) through, for example, Watson-Crick base pairing, and interfere with the normal function of the nucleic acid to which it is targeted. The use of these LIFR-targeting compounds results in a targeted increase in RNA expression and / or activity of the LIFR gene in a subject (e.g., a mammal). For example, the LIFR nucleic acid level and / or LIFR protein level is increased by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, etc. in the presence of the LIFR-targeting compound as compared to the absence of the LIFR-targeting compound.

[0182] In one aspect, the present invention provides a compound that targets any 12-50 contiguous nucleotides within the chr5:38595894-38596033 region of the LIFR gene. The “any 12-50 contiguous nucleotides within the chr5:38595894-38596033 region of the LIFR gene” are collectively referred to as “LIFR target nucleic acids” hereinafter.

[0183] In some embodiments, the compound targets any 12 to 50 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) contiguous nucleotides within the sense strand or the anti-sense strand of the chr5:38595894-38596033 region of the LIFR gene. In some embodiments, the nucleic acid sequence of the sense strand of the chr5:38595894-38596033 region of the LIFR gene is set forth in SEQ ID NO: 2, and the nucleic acid sequence of the anti-sense strand is set forth in SEQ ID NO: 3.

[0184] In some embodiments, the compound can be any compound capable of targeting a LIFR target nucleic acid. In some embodiments, non-limiting examples of the compound can include: an oligonucleotide, an oligonucleoside, an oligonucleotide analog, an oligonucleotide mimic, a small molecule compound, a small interfering RNA (siRNA), a small hairpin RNA (shRNA), a micro RNA (miRNA), an antibody or antigen-binding fragment thereof, a fusion protein, etc. In some embodiments, the compound is an oligonucleotide, such as a single-stranded antisense oligonucleotide, a double-stranded siRNA, etc. In some embodiments, the compound comprises an oligonucleotide. In some embodiments, the compound consists of an oligonucleotide. In some embodiments, the compound comprises an oligonucleotide that enhances expression of the LIFR gene. In some embodiments, the compound consists of an oligonucleotide that enhances expression of the LIFR gene. In some embodiments, the compound comprises an antisense oligonucleotide and / or a sense oligonucleotide. In some embodiments, the compound consists of an antisense oligonucleotide. In some embodiments, the compound consists of a sense oligonucleotide.

[0185] In some embodiments, the compound targets any 10 to 50 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) contiguous nucleotides within the region of chr5:38595894-38596033 of the LIFR gene. In some embodiments, the compound targets any 10 to 50 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) contiguous nucleotides within the sense strand of the region of chr5:38595894-38596033 of the LIFR gene (e.g., the nucleic acid sequence set forth in SEQ ID NO: 2). In some embodiments, the compound targets any 10 to 50 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) contiguous nucleotides within the anti-sense strand of the region of chr5:38595894-38596033 of the LIFR gene (e.g., the nucleic acid sequence set forth in SEQ ID NO: 3).

[0186] In some embodiments, the compound is capable of up-regulating the expression of the LIFR gene. In some embodiments, the compound is capable of up-regulating the mRNA transcription level of the LIFR gene. The mRNA transcription level of the LIFR gene can be determined by techniques well known in the art, for example, by quantitative reverse transcription PCR (RT-qPCR).

[0187] In some embodiments, the oligonucleotide targeting LIFR provided herein comprises a complementary region that is complementary to at least a portion of a region within chr5:38595894-38596033 of the LIFR gene. In some embodiments, the oligonucleotide targeting LIFR provided herein comprises a complementary region that is complementary to at least a portion of a region within the sense strand (e.g., the nucleic acid sequence set forth in SEQ ID NO: 2) of chr5:38595894-38596033 of the LIFR gene. In some embodiments, the oligonucleotide targeting LIFR provided herein comprises a complementary region that is complementary to at least a portion of a region within the anti-sense strand (e.g., the nucleic acid sequence set forth in SEQ ID NO: 3) of chr5:38595894-38596033 of the LIFR gene. The complementary region can be about 50 nucleotides or fewer (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) in length.

[0188] In some embodiments, the oligonucleotide targeting LIFR targets any 10 to 50 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) contiguous nucleotides within the region chr5:38595894-38596033 of the LIFR gene, and is about 50 nucleotides or less (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) in length. In some embodiments, the oligonucleotide targeting LIFR is 23 nucleotides or less, 22 nucleotides or less, 21 nucleotides or less, 20 nucleotides or less, 19 nucleotides or less, or 18 nucleotides or less in length. In some embodiments, the oligonucleotide targeting LIFR is 20 nucleotides in length.

[0189] In some embodiments, the oligonucleotide targeting LIFR targets any 10 to 50 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) contiguous nucleotides within the sense strand (e.g., the nucleic acid sequence set forth in SEQ ID NO: 2) of the chr5:38595894-38596033 region of the LIFR gene, and is about 50 nucleotides or less (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) in length.

[0190] In some embodiments, the oligonucleotide targeting LIFR targets any 10 to 50 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) contiguous nucleotides within the antisense strand (e.g., the nucleic acid sequence set forth in SEQ ID NO: 3) of the chr5:38595894-38596033 region of the LIFR gene, and is about 50 nucleotides or less (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) in length.

[0191] In some embodiments, the oligonucleotide targeting LIFR comprises:

[0192] (a) a nucleotide sequence that is at least 80% identical or identical to any 12-50 consecutive nucleotides within the nucleotide sequence set forth as SEQ ID NO: 2 or SEQ ID NO: 3, or

[0193] (b) a nucleotide sequence that is at least 80% complementary or completely complementary to any 12-50 consecutive nucleotides within the nucleotide sequence set forth as SEQ ID NO: 2 or SEQ ID NO: 3.

[0194] In some embodiments, the oligonucleotide targeting LIFR provided herein comprises a nucleotide sequence that is at least 80% identical (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, etc.) or identical to any 12 to 50 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) consecutive nucleotides within the nucleotide sequence set forth as SEQ ID NO: 2 or SEQ ID NO: 3.

[0195] In some embodiments, the oligonucleotide targeting LIFR provided herein comprises any 12 to 50 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) contiguous nucleotides within the nucleotide sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 3. In some embodiments, the oligonucleotide targeting LIFR provided herein consists of any 12 to 50 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) contiguous nucleotides within the nucleotide sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 3.

[0196] In some embodiments, the oligonucleotide targeting LIFR provided herein comprises any 20 contiguous nucleotides within the nucleotide sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 3. In some embodiments, the oligonucleotide targeting LIFR provided herein comprises any 20 contiguous nucleotides within the nucleotide sequence set forth in SEQ ID NO: 2. In some embodiments, the oligonucleotide targeting LIFR provided herein comprises any 20 contiguous nucleotides within the nucleotide sequence set forth in SEQ ID NO: 3.

[0197] In some embodiments, the oligonucleotide targeting LIFR provided herein consists of any 20 contiguous nucleotides within the nucleotide sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 3. In some embodiments, the oligonucleotide targeting LIFR provided herein consists of any 20 contiguous nucleotides within the nucleotide sequence set forth in SEQ ID NO: 2. In some embodiments, the oligonucleotide targeting LIFR provided herein consists of any 20 contiguous nucleotides within the nucleotide sequence set forth in SEQ ID NO: 3.

[0198] In some embodiments, the oligonucleotide targeting LIFR provided herein comprises a nucleotide sequence that is at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, etc.) complementary to any 12 to 50 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) consecutive nucleotides within the nucleotide sequence set forth as SEQ ID NO: 2 or SEQ ID NO: 3.

[0199] In some embodiments, the oligonucleotide targeting LIFR provided herein comprises a nucleotide sequence that is fully complementary to any 12 to 50 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) consecutive nucleotides within the nucleotide sequence set forth as SEQ ID NO: 2 or SEQ ID NO: 3. In some embodiments, the oligonucleotide targeting LIFR provided herein consists of a nucleotide sequence that is fully complementary to any 12 to 50 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) consecutive nucleotides within the nucleotide sequence set forth as SEQ ID NO: 2 or SEQ ID NO: 3. The term “fully complementary” refers to 100% complementarity.

[0200] In some embodiments, the oligonucleotide targeting LIFR provided herein comprises a nucleotide sequence that is fully complementary to any 20 contiguous nucleotides within the nucleotide sequence set forth as SEQ ID NO: 2 or SEQ ID NO: 3. In some embodiments, the oligonucleotide targeting LIFR provided herein comprises a nucleotide sequence that is fully complementary to any 20 contiguous nucleotides within the nucleotide sequence set forth as SEQ ID NO: 2. In some embodiments, the oligonucleotide targeting LIFR provided herein comprises a nucleotide sequence that is fully complementary to any 20 contiguous nucleotides within the nucleotide sequence set forth as SEQ ID NO: 3.

[0201] In some embodiments, the oligonucleotide targeting LIFR provided herein consists of a nucleotide sequence that is fully complementary to any 20 contiguous nucleotides within the nucleotide sequence set forth as SEQ ID NO: 2 or SEQ ID NO: 3. In some embodiments, the oligonucleotide targeting LIFR provided herein consists of a nucleotide sequence that is fully complementary to any 20 contiguous nucleotides within the nucleotide sequence set forth as SEQ ID NO: 2. In some embodiments, the oligonucleotide targeting LIFR provided herein consists of a nucleotide sequence that is fully complementary to any 20 contiguous nucleotides within the nucleotide sequence set forth as SEQ ID NO: 3.

[0202] In some embodiments, the oligonucleotide targeting LIFR provided herein or the nucleotide sequence of the contiguous nucleotides comprises at least 1 CpG site, preferably 2 or more. In some embodiments, the oligonucleotide targeting LIFR provided herein or the nucleotide sequence of the contiguous nucleotides comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 CpG sites. In some embodiments, the oligonucleotide targeting LIFR provided herein or the nucleotide sequence of the contiguous nucleotides comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 CpG sites.

[0203] The term "CpG site" refers to a cytosine-phosphate-guanine (CpG) dinucleotide site. In mammals, DNA methylation typically occurs at the 5th carbon of the cytosine of a CpG site.

[0204] In some embodiments, the LIFR-targeting compound provided herein is capable of reducing the methylation level of a LIFR target nucleic acid. In some embodiments, the LIFR-targeting compound provided herein is capable of reducing the methylation level of a CpG site of a LIFR target nucleic acid.

[0205] One skilled in the art can determine the methylation level of a CpG site according to routine technical means, for example, by quantitatively analyzing the amount of intact DNA present after restriction digestion with a methylation-sensitive restriction enzyme. For another example, DNA in a sample is treated with a reagent capable of distinguishing between unmethylated sites and methylated sites in DNA, thereby obtaining treated DNA. The reagent can selectively act on unmethylated cytosine residues but not significantly on methylated cytosine residues. Or the reagent can selectively act on methylated cytosine residues without significantly acting on unmethylated cytosine residues. Thus, the original DNA is transformed into treated DNA in a manner depending on whether it is methylated, so that the treated DNA can be distinguished from the original DNA by its hybridization behavior. Exemplary reagents include a bisulfite reagent (e.g., a reagent of bisulfite, bisulfite ions, or any combination thereof).

[0206] In some embodiments, the oligonucleotide sequence targeting LIFR provided herein has at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, etc.) sequence identity to the nucleotide sequence set forth in SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 17. In some embodiments, the oligonucleotide sequence targeting LIFR provided herein has at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, etc.) sequence identity to the nucleotide sequence set forth in SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 17, and still retains similar function or activity (e.g., upregulating expression of LIFR gene) thereof. For example, the oligonucleotide sequence targeting LIFR provided herein has one or more nucleotides (e.g., no more than 3 nucleotides, no more than 2 nucleotides, no more than 1 nucleotide, etc.) added or removed from the 5’ end and / or 3’ end of the nucleotide sequence set forth in SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 17, but still retains similar function or activity (e.g., upregulating expression of LIFR gene) thereof. By “retains similar function or activity” is meant that the function or activity is no more than 30% (e.g., no more than 5%, no more than 10%, no more than 15%, no more than 20%, no more than 25%, etc.) different.

[0207] In some embodiments, the oligonucleotide targeting LIFR provided herein comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 17. In some embodiments, the oligonucleotide targeting LIFR provided herein comprises a nucleotide sequence of SEQ ID NO: 4. In some embodiments, the oligonucleotide targeting LIFR provided herein comprises a nucleotide sequence of SEQ ID NO: 5. In some embodiments, the oligonucleotide targeting LIFR provided herein comprises a nucleotide sequence of SEQ ID NO: 6. In some embodiments, the oligonucleotide targeting LIFR provided herein comprises a nucleotide sequence of SEQ ID NO: 17.

[0208] In some embodiments, the oligonucleotide targeting LIFR provided herein consists of a nucleotide sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 17. In some embodiments, the compound targeting LIFR provided herein is an oligonucleotide and consists of a nucleotide sequence of SEQ ID NO: 4. In some embodiments, the compound targeting LIFR provided herein is an oligonucleotide and consists of a nucleotide sequence of SEQ ID NO: 5. In some embodiments, the compound targeting LIFR provided herein is an oligonucleotide and consists of a nucleotide sequence of SEQ ID NO: 6. In some embodiments, the compound targeting LIFR provided herein is an oligonucleotide and consists of a nucleotide sequence of SEQ ID NO: 17.

[0209] It is understood that the nucleotides in the nucleotide sequence of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 17 can be modified, can be unmodified, or can be modified differently from the modifications described in the sequence.

[0210] 2. Modifications of oligonucleotides

[0211] The oligonucleotide targeting LIFR provided herein can comprise ribonucleotides (e.g., modified or unmodified ribonucleotides) and / or deoxyribonucleotides (e.g., modified or unmodified deoxyribonucleotides). Typically, the oligonucleotide targeting LIFR provided herein can optionally have modifications. In some embodiments, the oligonucleotide targeting LIFR provided herein can have any modification at any nucleotide.

[0212] In some embodiments, at least one nucleoside from the 5' end and / or at least one nucleoside from the 3' end of the oligonucleotide targeting LIFR comprises a modification. In some embodiments, at least one nucleoside from the 5' end or at least one nucleoside from the 3' end of the oligonucleotide targeting LIFR comprises a modification. In some embodiments, at least one nucleoside from the 5' end and at least one nucleoside from the 3' end of the oligonucleotide targeting LIFR comprises a modification.

[0213] In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides from the 5' end and / or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides from the 3' end of the oligonucleotide targeting LIFR comprise a modification. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides from the 5' end or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides from the 3' end of the oligonucleotide targeting LIFR comprise a modification. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides from the 5' end and 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides from the 3' end of the oligonucleotide targeting LIFR comprise a modification. In some embodiments, each of the 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides from the 5' end and each of the 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides from the 3' end of the oligonucleotide targeting LIFR comprise a modification.

[0214] In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleosides from the 5' end and / or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleosides from the 3' end of the oligonucleotide targeting LIFR comprise a modification. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleosides from the 5' end or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleosides from the 3' end of the oligonucleotide targeting LIFR comprise a modification. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleosides from the 5' end and 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleosides from the 3' end of the oligonucleotide targeting LIFR comprise a modification. In some embodiments, each of the 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleosides from the 5' end and each of the 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleosides from the 3' end of the oligonucleotide targeting LIFR comprise a modification.

[0215] In some embodiments, the oligonucleotide provided herein comprises a modification at the 1st, 2nd, and 3rdnucleoside from the 5' end and the 1st, 2nd, and 3rdnucleoside from the 3' end of the nucleotide sequence of SEQ ID NO: 4. In some embodiments, the oligonucleotide provided herein comprises a modification at the 1st, 2nd, and 3rdnucleoside from the 5' end and the 1st, 2nd, and 3rdnucleoside from the 3' end of the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the oligonucleotide provided herein comprises a modification at the 1st, 2nd, and 3rdnucleoside from the 5' end and the 1st, 2nd, and 3rdnucleoside from the 3' end of the nucleotide sequence of SEQ ID NO: 6. In some embodiments, the oligonucleotide provided herein comprises a modification at the 1st, 2nd, and 3rdnucleoside from the 5' end and the 1st, 2nd, and 3rdnucleoside from the 3' end of the nucleotide sequence of SEQ ID NO: 17.

[0216] In some embodiments, the oligonucleotide targeting LIFR provided herein consists of the nucleotide sequence set forth in SEQ ID NO: 4, and the 1st, 2nd, and 3rdnucleotides from the 5' end and the 1st, 2nd, and 3rdnucleotides from the 3' end of the nucleotide sequence set forth in SEQ ID NO: 4 comprise modifications. In some embodiments, the oligonucleotide targeting LIFR provided herein consists of the nucleotide sequence set forth in SEQ ID NO: 5, and the 1st, 2nd, and 3rdnucleotides from the 5' end and the 1st, 2nd, and 3rdnucleotides from the 3' end of the nucleotide sequence set forth in SEQ ID NO: 5 comprise modifications. In some embodiments, the oligonucleotide targeting LIFR provided herein consists of the nucleotide sequence set forth in SEQ ID NO: 6, and the 1st, 2nd, and 3rdnucleotides from the 5' end and the 1st, 2nd, and 3rdnucleotides from the 3' end of the nucleotide sequence set forth in SEQ ID NO: 6 comprise modifications. In some embodiments, the oligonucleotide targeting LIFR provided herein consists of the nucleotide sequence set forth in SEQ ID NO: 17, and the 1st, 2nd, and 3rdnucleotides from the 5' end and the 1st, 2nd, and 3rdnucleotides from the 3' end of the nucleotide sequence set forth in SEQ ID NO: 17 comprise modifications.

[0217] In the present application, a "modified" nucleotide can independently have a modified nucleobase moiety, a modified sugar moiety, a modified phosphate moiety, and / or a modified internucleoside linkage at any nucleotide position. A "modified" nucleotide can also independently have one or more of a modified nucleobase moiety, a modified sugar moiety, a modified phosphate moiety, and / or a modified internucleoside linkage at any nucleotide position. Thus, a "modified nucleotide" or a "modified oligonucleotide" mentioned in the present application includes the replacement, addition, or removal of a functional group or atom to the nucleobase moiety, sugar moiety, phosphate moiety, and / or internucleoside linkage of a nucleotide (e.g., a ribonucleotide or a deoxyribonucleotide). Modifications suitable for the nucleotides (e.g., antisense oligonucleotides) provided herein include any modifications known in the art.

[0218] In some embodiments, the modification of the oligonucleotide targeting LIFR provided herein comprises one or more base modifications. For example, a purine or pyrimidine is changed to a modified purine or pyrimidine (e.g., a substituted purine or a substituted pyrimidine). In some embodiments, the base modification of the oligonucleotide targeting LIFR provided herein is selected from the group consisting of isocytosine, pseudoisocytosine, 5-thiazolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, 2’thio-thymine, inosine, diamino purine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine. In some embodiments, the base modification of the oligonucleotide targeting LIFR provided herein is selected from the group consisting of pseudouracil (ψ), N1-methylpseudouracil (N1Mψ), 1-ethylpseudouracil, 2-thiouracil (s2U), 4-thiouracil, 5-methylcytosine, 5-methyluracil, 5-methoxyuracil, and combinations thereof.

[0219] In some embodiments, the modification of the oligonucleotide targeting LIFR provided herein comprises one or more ribose modifications. A variety of ribose modifications are known in the art, primarily for the purpose of improving certain properties of oligonucleotides, such as stability.

[0220] In some embodiments, the ribose moiety can have any stereochemistry, and is not limited to the stereochemistry of ribose moieties in natural DNA or RNA. For example, the ribose can be D-ribose or L-ribose. In some embodiments, the ribose moiety is modified or replaced with another ring structure, such as a morpholino oligonucleotide (PMO) in which the ribose moiety is modified or replaced with a morpholino ring.

[0221] In some embodiments, ribose modifications also include changing the substituent on the ribose ring to a group other than hydrogen, or changing the 2’-OH group that naturally occurs in DNA and RNA nucleosides. For example, a substituent can be introduced at the 2’, 3’, 4’, or 5’ position of the ribose. In some embodiments, the ribose modification is the introduction of a substituent at the 2’ position of the ribose (also referred to as a “2’ sugar modification”). 2’ sugar modified nucleosides include nucleosides having a substituent at the 2’ position other than H or -OH.

[0222] In some embodiments, the ribose modification of the oligonucleotide targeting LIFR provided herein is selected from the group consisting of LNA modification, 2'-O-methyl (Me) modification, 2'-O-ethyl modification, 2'-O-methoxyethyl (MOE) modification, 2'-F modification, and a combination thereof. In some embodiments, the ribose modification of the oligonucleotide targeting LIFR provided herein comprises a 2'-O-MOE modification. In some embodiments, the ribose modification of the oligonucleotide targeting LIFR provided herein is a 2'-O-MOE modification.

[0223] In some embodiments, the LNA modification is one or more modifications selected from the group consisting of methylenoxy (4'-CH2-O-2') LNA modification (e.g., a-L-methylenoxy (4'-CH2-O-2') LNA modification, b-D-methylenoxy (4'-CH2-O-2') LNA modification), ethylenoxy (4'-(CH2)2-O-2') LNA modification, methylenoxyamino (4'-CH2-O-N(R)-2') LNA modification, and methyleneaminooxy (4'-CH2-N(R)-O-2') LNA modification.

[0224] In some embodiments, the oligonucleotide targeting LIFR provided herein is a gapmer. In the present application, gapmer is also referred to as "gapmer". A gapmer typically comprises at least three different structural regions in the 5'-3' direction, a 5' wing, a gap, and a 3' wing, wherein the gap region comprises a stretch of contiguous nucleotides with different chemical modifications from the nucleic acids in the wing regions, which are flanked by a 5' wing region and a 3' wing region comprising one or more modified nucleosides, respectively. The nucleoside modifications of the 5' wing region and / or the 3' wing region can be ribose modifications, such as 2' sugar modifications (e.g., 2'-O-MOE modification).

[0225] In some embodiments, the oligonucleotide targeting LIFR provided herein is a mixmer. In the present application, mixmer is also referred to as "mixmer". A mixmer typically comprises nucleotide modifications in different arrangements to avoid consecutive deoxyribonucleotides in the molecule.

[0226] In some embodiments, the modification of the oligonucleotide targeting LIFR provided herein comprises one or more linkage modifications. In some embodiments, the linkage modification occurs at an internucleoside linkage.

[0227] In some embodiments, the oligonucleotide targeting LIFR provided herein comprises modified internucleoside linkages. In some embodiments, at least two (e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20) of the internucleoside linkages between adjacent nucleosides of the oligonucleotide targeting LIFR provided herein are phosphorothioate linkages. In some embodiments, all of the internucleoside linkages between nucleosides of the oligonucleotide targeting LIFR provided herein are phosphorothioate linkages.

[0228] In some embodiments, the oligonucleotide targeting LIFR provided herein comprises the nucleotide sequence of SEQ ID NO: 4, and each of the 3 nucleosides from the 5’ end and each of the 3 nucleosides from the 3’ end of the nucleotide sequence of SEQ ID NO: 4 is a MOE modification (e.g., a 2’-O-MOE modification), and all of the internucleoside linkages between nucleosides of the nucleotide sequence of SEQ ID NO: 4 are phosphorothioate linkages.

[0229] In some embodiments, the oligonucleotide targeting LIFR provided herein comprises the nucleotide sequence of SEQ ID NO: 5, and each of the 3 nucleosides from the 5’ end and each of the 3 nucleosides from the 3’ end of the nucleotide sequence of SEQ ID NO: 5 is a MOE modification (e.g., a 2’-O-MOE modification), and all of the internucleoside linkages between nucleosides of the nucleotide sequence of SEQ ID NO: 5 are phosphorothioate linkages.

[0230] In some embodiments, the oligonucleotide targeting LIFR provided herein comprises the nucleotide sequence of SEQ ID NO: 6, and each of the 3 nucleosides from the 5’ end and each of the 3 nucleosides from the 3’ end of the nucleotide sequence of SEQ ID NO: 6 is a MOE modification (e.g., a 2’-O-MOE modification), and all of the internucleoside linkages between nucleosides of the nucleotide sequence of SEQ ID NO: 6 are phosphorothioate linkages.

[0231] In some embodiments, the oligonucleotide targeting LIFR provided herein consists of the nucleotide sequence set forth in SEQ ID NO: 4, and each of the 3 nucleotides from the 5’ end and each of the 3 nucleotides from the 3’ end of the nucleotide sequence set forth in SEQ ID NO: 4 is MOE modified (e.g., 2’-O-MOE modified), and the internucleoside linkage between all nucleosides of the nucleotide sequence set forth in SEQ ID NO: 4 is a phosphorothioate linkage.

[0232] In some embodiments, the oligonucleotide targeting LIFR provided herein consists of the nucleotide sequence set forth in SEQ ID NO: 5, and each of the 3 nucleotides from the 5’ end and each of the 3 nucleotides from the 3’ end of the nucleotide sequence set forth in SEQ ID NO: 5 is MOE modified (e.g., 2’-O-MOE modified), and the internucleoside linkage between all nucleosides of the nucleotide sequence set forth in SEQ ID NO: 5 is a phosphorothioate linkage.

[0233] In some embodiments, the oligonucleotide targeting LIFR provided herein consists of the nucleotide sequence set forth in SEQ ID NO: 6, and each of the 3 nucleotides from the 5’ end and each of the 3 nucleotides from the 3’ end of the nucleotide sequence set forth in SEQ ID NO: 5 is MOE modified (e.g., 2’-O-MOE modified), and the internucleoside linkage between all nucleosides of the nucleotide sequence set forth in SEQ ID NO: 6 is a phosphorothioate linkage.

[0234] In some embodiments, the oligonucleotide targeting LIFR provided herein comprises the nucleotide sequence set forth in SEQ ID NO: 17, and each of the 3 nucleotides from the 5’ end and each of the 3 nucleotides from the 3’ end of the nucleotide sequence set forth in SEQ ID NO: 17 is LNA modified (e.g., 4’-CH2-O-2’ modified), and the internucleoside linkage between all nucleosides of the nucleotide sequence set forth in SEQ ID NO: 17 is a phosphorothioate linkage.

[0235] In some embodiments, the oligonucleotide targeting LIFR provided herein consists of the nucleotide sequence set forth in SEQ ID NO: 17, and each of the 3 nucleotides from the 5’ end and each of the 3 nucleotides from the 3’ end of the nucleotide sequence set forth in SEQ ID NO: 17 is LNA modified (e.g., 4’-CH2-O-2’ modified), and the internucleoside linkage between all nucleosides of the nucleotide sequence set forth in SEQ ID NO: 17 is a phosphorothioate linkage.

[0236] In some embodiments, the oligonucleotide targeting LIFR provided by the present application is single-stranded or double-stranded. In some embodiments, the oligonucleotide targeting LIFR provided by the present application is single-stranded. In some embodiments, the oligonucleotide targeting LIFR provided by the present application is a sense oligonucleotide or an antisense oligonucleotide (ASO). In some embodiments, the oligonucleotide targeting LIFR provided by the present application is a single-stranded antisense oligonucleotide. In some embodiments, the oligonucleotide targeting LIFR provided by the present application is a single-stranded sense oligonucleotide.

[0237] In some embodiments, the oligonucleotide targeting LIFR provided by the present application comprises a structure as shown in Chemical Formula 2. In some embodiments, the chemical structure of the oligonucleotide targeting LIFR provided by the present application is as shown in Chemical Formula 2.

[0238] In some embodiments, the oligonucleotide targeting LIFR provided by the present application comprises a structure as shown in Chemical Formula 3. In some embodiments, the chemical structure of the oligonucleotide targeting LIFR provided by the present application is as shown in Chemical Formula 3.

[0239] In some embodiments, the oligonucleotide targeting LIFR provided by the present application comprises a structure as shown in Chemical Formula 4. In some embodiments, the chemical structure of the oligonucleotide targeting LIFR provided by the present application is as shown in Chemical Formula 4.

[0240] In some embodiments, the oligonucleotide targeting LIFR provided by the present application comprises a structure as shown in Chemical Formula 5.

[0241] In some embodiments, the chemical structure of the oligonucleotide targeting LIFR provided by the present application is as shown in Chemical Formula 5.

[0242]

[0243]

[0244]

[0245]

[0246] 3. Uses

[0247] In another aspect, the present application provides a method for modulating (e.g., increasing) LIFR expression in a target cell expressing LIFR. In some embodiments, the method comprises the step of: exposing the target cell to a LIFR-targeting compound provided by the present application, a composition or a vector comprising the same (for specific description of the composition, vector, please refer to Section VII and Section VIII herein).

[0248] The method can be implemented in vivo or in vitro.

[0249] Contacting a cell in vivo with a LIFR-targeting compound provided by the present application, a composition or a vector comprising the same includes contacting a cell or a population of cells in a subject (e.g., a human subject) in vivo with a LIFR-targeting compound provided by the present application, a composition or a vector comprising the same. Further, contacting a cell in vivo can be achieved by a targeting ligand, including any ligand described herein or known in the art. In some embodiments, the targeting ligand is a carbohydrate moiety, e.g., a GalNAc3 ligand, or any other ligand that can direct a LIFR-targeting compound provided by the present application to a site of interest (e.g., the liver of a subject).

[0250] Contacting a cell in vitro with a LIFR-targeting compound provided by the present application, a composition or a vector comprising the same can be achieved by incubating the cell with a LIFR-targeting compound provided by the present application, a composition or a vector comprising the same. Combinations of in vitro and in vivo contacting methods are also possible. For example, a cell can also be contacted with a LIFR-targeting compound provided by the present application, a composition or a vector comprising the same in vitro, and then transplanted into a subject in vivo.

[0251] In some embodiments, following exposure of a target cell expressing LIFR to a compound targeting LIFR, a composition, or a vector comprising the same provided herein, the level of expression of LIFR in the target cell is increased, e.g., by at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99% or more.

[0252] In some embodiments, following exposure of a target cell expressing LIFR to a compound targeting LIFR, a composition, or a vector comprising the same provided herein, the level of mRNA of LIFR in the target cell is increased, e.g., by at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99% or more.

[0253] In some embodiments, following exposure of a target cell expressing LIFR to a compound targeting LIFR, a composition, or a vector comprising the same provided herein, the level of LIFR protein in the target cell is increased, e.g., by at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99% or more.

[0254] An increase in the level of gene expression can be assessed by any method known in the art. For example, an increase in LIFR expression can be determined by determining the mRNA expression level of LIFR using routine methods to one of skill in the art, e.g., Northern blot, qRT-PCR, by determining the protein level of LIFR using routine methods to one of skill in the art, e.g., Western blot, immunological techniques, flow cytometry methods, ELISA, and / or by determining the biological activity of LIFR, etc.

[0255] An increase in the level of LIFR expression in a target cell can be assessed by a decrease in the absolute or relative level of one or more variables associated with LIFR expression compared to a control level. The control level can be any type of control level used in the art, e.g., a pre-dosing baseline level, or a level determined from a similar subject, cell, or sample that has never been treated or treated with a control (e.g., a buffer control or non-active agent control).

[0256] In some embodiments, the target cell expressing LIFR can be an in vivo cell or an ex vivo cell. In some embodiments, for in vivo implementation, the target cell expressing LIFR can be from a human and a non-human animal. In some embodiments, the non-human animal includes all vertebrates, such as mammals and non-mammals. In some embodiments, the non-human animal can also be a domestic animal, such as a cow, a pig, a sheep, a poultry, and a horse, or a pet animal, such as a dog and a cat. In some embodiments, the target cell expressing LIFR can be from a male (e.g., a man) or a female (e.g., a woman), and can be from an elderly, an adult, a teenager, a child, or an infant.

[0257] In some embodiments, the target cell expressing LIFR is a hematopoietic stem cell, a neural stem cell, a cancer cell, a dendritic cell, a monocyte, a macrophage, a B cell, a Treg, a neutrophil, a basophil, a platelet, a mast cell progenitor, an endothelial cell, a neuronal cell, an osteoclast, or an antigen presenting cell. In some embodiments, the target cell expressing LIFR is a cancer cell. In some embodiments, the target cell expressing LIFR is a liver cancer cell (e.g., a HepG2 cell).

[0258] In another aspect, the present application provides a method of upregulating LIFR gene expression in a subject, comprising administering to a subject in need thereof an effective amount of a LIFR-targeting compound, a composition comprising the same, or a vector provided by the present application.

[0259] In another aspect, the present application also provides use of a LIFR-targeting compound, a composition comprising the same, or a vector provided by the present application in the manufacture of a medicament for upregulating LIFR gene expression in a subject.

[0260] In another aspect, the present application also provides a LIFR-targeting compound, a composition comprising the same, or a vector for upregulating LIFR gene expression in a subject.

[0261] In another aspect, the present application provides a method of preventing, inhibiting, or reversing LIFR gene methylation, comprising administering to a subject in need thereof an effective amount of a LIFR-targeting compound or a composition or a vector comprising the same provided by the present application.

[0262] In another aspect, the present application also provides a method of treating or preventing a disease, comprising administering to a subject in need thereof an effective amount of a LIFR-targeting compound or a composition or a vector comprising the same provided by the present application.

[0263] In another aspect, the present application also provides use of a LIFR-targeting compound or a composition or a vector comprising the same of the present application in the manufacture of a medicament for treating or preventing a disease.

[0264] In another aspect, the present application also provides a LIFR-targeting compound or a composition or a vector comprising the same for use in treating or preventing a disease.

[0265] In some embodiments, the disease is a LIFR-mediated disease. A “LIFR-mediated disease” refers to a disease, condition, or disorder associated with abnormal levels and / or activities of LIFR, caused or facilitated by abnormal expression of LIFR in a subject such that the levels and / or activities of LIFR are abnormally high or low. In some embodiments, the LIFR-mediated disease is associated with decreased levels and / or activities of LIFR. In some embodiments, the disease is cancer. In some embodiments, the disease is liver cancer or pancreatic cancer.

[0266] In some embodiments, the subject is a mammal (e.g., a human), e.g., the subject has a disease that has been treated or is being evaluated for possible benefit from increased expression of LIFR; the subject is at risk of having a disease that can benefit from increased expression of LIFR; the subject has a disease that can benefit from increased expression of LIFR.

[0267] In some embodiments, the subject’s health status is improved after receiving a LIFR-targeting compound, a composition or a vector comprising the same provided by the present application. The term “improved” means that at least one indicator of the severity of the condition or disease is reduced, slowed, halted, or reversed. The severity of the indicator can be determined by subjective or objective measures known to one of skill in the art. For example, the severity of the condition or disease can be reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%. The severity of the indicator can be determined by subjective or objective measures known to one of skill in the art. Treatment or prevention is evident when one or more parameters of the disease state are statistically significantly improved, or because of failure to worsen or develop symptoms that would otherwise be expected. For example, at least a 10% favorable change in a measurable disease parameter, more preferably at least 20%, 30%, 40%, 50%, or more, can indicate effective treatment. Efficacy of a given LIFR-targeting compound (e.g., an oligonucleotide) drug or formulation of the drug can also be judged using experimental animal models of the given disease known in the art. When experimental animal models are used, efficacy of treatment can be demonstrated when a statistically significant decrease in a marker or symptom is observed.

[0268] The LIFR-targeting compounds (e.g., oligonucleotides), compositions comprising them, or carriers provided by the present invention can be administered to the subject at doses ranging from 0.01 to 50 mg / kg. For example, at doses of 0.01 mg / kg, 0.02 mg / kg, 0.03 mg / kg, 0.04 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.15 mg / kg, 0.2 mg / kg, 0.25 mg / kg, 0.3 mg / kg, 0.35 mg / kg, 0.4 mg / kg, 0.45 mg / kg, 0.5 mg / kg, 0.55 mg / kg, 0.6 mg / kg, 0.65 mg / kg, 0.7 mg / kg, 0.75 mg / kg, 0.8 mg / kg, 0.85 mg / kg, 0.9 mg / kg, 0.95 mg / kg, 1.0 mg / kg, ... 1.1mg / kg, 1.2mg / kg, 1.3mg / kg, 1.4mg / kg, 1.5mg / kg, 1.6mg / kg, 1.7mg / kg, 1.8mg / kg, 1.9mg / kg, 2.0mg / kg, 2.1mg / kg, 2.2mg / kg, 2.3mg / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2.8mg / kg, 2.9mg / kg, 3.0mg / kg, 3.1mg / kg, 3.2mg / kg, 3.3mg / kg, 3.4mg / kg, 3.5mg / kg, 3.6mg / kg, 3 .7mg / kg, 3.8mg / kg, 3.9mg / kg, 4.0mg / kg, 4.1mg / kg, 4.2mg / kg, 4.3mg / kg, 4.4mg / kg, 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4.8mg / kg, 4.9mg / kg, 5 .0mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg, 5.9mg / kg, 6.0mg / kg, 6.1mg / kg, 6.2mg / kg, 6 .3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7.0mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7 .6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8.0mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9 mg / kg, 9.0 mg / kg, 9.1 mg / kg, 9.2 mg / kg, 9.3 mg / kg, 9.4 mg / kg, 9.5 mg / kg, 9.6 mg / kg, 9.7 mg / kg, 9.8 mg / kg, 9.9 mg / kg, 9.0 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, or 50 mg / kg of a compound targeting LIFR (e.g., an oligonucleotide), a composition comprising the same, or a vector provided herein to a subject. Values and ranges intermediate to the above recited values are also intended to be part of this application.

[0269] A compound targeting LIFR, a composition comprising the same, or a vector provided herein can be administered to a subject by a variety of routes of administration, for example, by topical, oral, intranasal, parenteral, enteral, rectal, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, buccal, sublingual, or ocular routes, among others.

[0270] V. Conjugates

[0271] In some embodiments, an oligonucleotide targeting DNMT1 or a compound targeting LIFR (e.g., an oligonucleotide) provided herein can be further modified to be in the form of a conjugate, to achieve one or more additional effects, such as improved tissue specificity. In some embodiments, an oligonucleotide targeting DNMT1 or a compound targeting LIFR modified to be in the form of a conjugate is a prodrug, which will be cleaved from the oligonucleotide or compound after the prodrug is delivered to a site of action, such as a target cell.

[0272] In some embodiments, an oligonucleotide targeting DNMT1 or a compound targeting LIFR (e.g., an oligonucleotide) provided herein is covalently or non-covalently linked to a conjugate moiety. In some embodiments, an oligonucleotide targeting DNMT1 or a compound targeting LIFR (e.g., an oligonucleotide) provided herein is covalently linked to a conjugate moiety.

[0273] In some embodiments, an oligonucleotide targeting DNMT1 or a compound targeting LIFR (e.g., an oligonucleotide) provided herein is conjugated to the conjugate moiety via a linker, or directly conjugated to the conjugate moiety without a linker.

[0274] The term "linker" as used herein refers to a molecule or moiety that covalently links the targeting DNMT1 oligonucleotide or the LIFR-targeting compound (e.g., oligonucleotide) provided herein to the conjugate moiety. The linker includes a functional group for linking the at least one targeting DNMT1 oligonucleotide or the LIFR-targeting compound (e.g., oligonucleotide) to the at least one conjugate moiety. In some embodiments, the functional group can contain two reactive moieties, one for linking to the targeting DNMT1 oligonucleotide or the LIFR-targeting compound (e.g., oligonucleotide) and the other for linking to the conjugate moiety. In some embodiments, the functional groups are different from each other. In some embodiments, the linker can be a cleavable linker or a non-cleavable linker. The cleavable linker can be cleaved by hydrolysis, enzymatic reaction, reduction reaction, or by a change in pH. The non-cleavable linker refers to a linker that remains substantially intact during metabolism in a cell.

[0275] In some embodiments, the conjugate moiety can be a small molecule compound, a biological macromolecule, derivatives thereof, or a combination thereof. In some embodiments, the conjugate moiety can be selected from the group consisting of an antibody or an antigen-binding fragment thereof (e.g., Fv fragment, Fab, Fab', F(ab')2, Fd, diabody, dsFv, (dsFv)2, scFv, scFv dimer, and the like), a lipid derivative, a galactose derivative, a cell-penetrating peptide, or a combination thereof. In some embodiments, the lipid derivative is selected from the group consisting of a sterol, a phospholipid, and derivatives thereof. In some embodiments, the conjugate moiety is capable of binding to an asialoglycoprotein receptor (ASGPR). In some embodiments, the conjugate moiety specifically targets an asialoglycoprotein receptor.

[0276] In some embodiments, the conjugate moiety is N-acetylgalactosamine (GalNAc). In some embodiments, the GalNAc is a multivalent GalNAc, such as GalNAc2, GalNAc3 (herein, GalNAc and multivalent GalNAc are collectively referred to as "GalNAc conjugate"). In some embodiments, the targeting DNMT1 oligonucleotide or the LIFR-targeting compound (e.g., oligonucleotide) provided herein is conjugated to one or more GalNAc via a monovalent, bivalent, or trivalent branched linker. Exemplary GalNAc structures are shown below:

[0277]

[0278]

[0279] VI. Pharmaceutically acceptable salts

[0280] In some embodiments, the DNMT1 -targeting oligonucleotide or LIFR-targeting compound (e.g., oligonucleotide) provided herein is in the form of a pharmaceutically acceptable salt.

[0281] The term "pharmaceutically acceptable" as used herein refers to being useful in contact with the cells of humans and other animals without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit / risk ratio, as would be understood by those of ordinary skill in the art.

[0282] The term "pharmaceutically acceptable salt" as used herein includes relatively non-toxic, inorganic and organic acid and base addition salts of the DNMT1 -targeting oligonucleotide or LIFR-targeting compound (e.g., oligonucleotide) provided herein.

[0283] Representative acid addition salts include the hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, oxalate, valerate, oleate, palmitate, stearate, laurate, borate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthylate, mesylate, glucoheptonate, lactobionate, sulfamatc, malonate, salicylate, propionate, methylene-bis-b-hydroxynaphthoate, gentisate, hydroxyethanesulfonate, di-p-toluoyltartrate, mesylate, esylate, besylate, p-toluenesulphonate, cyclohexylsulfamate, and quinicarboxylic acid laurylsulfonate, and the like.

[0284] Base addition salts include pharmaceutically acceptable metal and amine salts. Suitable metal salts include sodium, potassium, calcium, barium, zinc, magnesium, and aluminum salts. In some embodiments, sodium and potassium salts are preferred. Suitable inorganic base addition salts are prepared from metal bases including, for example, sodium hydride, sodium hydroxide, potassium hydroxide, calcium hydroxide, aluminum hydroxide, lithium hydroxide, magnesium hydroxide, and zinc hydroxide. Suitable amine base addition salts are prepared from amines having sufficient basicity to form stable salts, and preferably include amines commonly used in pharmaceutical chemistry because of their low toxicity and acceptability for medical use: ammonia, ethylenediamine, N-methylglucamine, lysine, arginine, ornithine, choline, N,N'-dibenzylethylenediamine, chloroprocaine, diethanolamine, procaine, N-benzylphenethylamine, diethylamine, piperazine, tris(hydroxymethyl)aminomethane, tetramethylammonium hydroxide, triethylamine, dibenzylamine, diphenylhydramine, dehydroabietylamine, N-ethylpiperidine, benzylamine, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, ethylamine, basic amino acids (e.g., lysine and arginine), and dicyclohexylamine, and the like.

[0285] VII. Compositions

[0286] In another aspect, the present application provides a composition comprising a DNMT1 -targeting oligonucleotide or a LIFR-targeting compound (e.g., oligonucleotide) described herein, and a pharmaceutically acceptable carrier.

[0287] The term "pharmaceutically acceptable carrier" as used in the present application refers to a pharmaceutically acceptable solvent, suspending agent or any other pharmaceutically inert carrier for delivering a DNMT1 -targeting oligonucleotide or a LIFR-targeting compound (e.g., oligonucleotide) provided by the present application to a subject, which does not interfere with the structure and properties of the oligonucleotide or compound. Certain such carriers are capable of formulating the oligonucleotide or compound into, for example, tablets, pills, capsules, liquids, gels, syrups, slurries, suspensions, and pastilles for oral ingestion by a subject. Certain such carriers are capable of formulating the compound into formulations for injection, infusion, or topical application.

[0288] Pharmaceutically acceptable carriers for use in the pharmaceutical compositions provided by the present application include, but are not limited to, for example, pharmaceutically acceptable liquid, gel or solid carriers, aqueous vehicles (e.g., sodium chloride injection, Ringer's injection, isotonic dextrose injection, sterile water for injection, or dextrose and lactated Ringer's injection), non-aqueous vehicles (e.g., fixed oils, cottonseed oil, corn oil, sesame oil, or peanut oil), antimicrobial agents, isotonic agents (e.g., sodium chloride or dextrose), buffers (e.g., phosphate or citrate buffers), antioxidants (e.g., sodium bisulfite), anesthetics (e.g., procine hydrochloride), suspending or dispersing agents (e.g., sodium carboxymethyl cellulose, hydropropylmethyl cellulose, or polyvinylpyrrolidone), chelating agents (e.g., EDTA (ethylenediaminetetraacetic acid) or EGTA (ethylene glycol tetraacetic acid)), emulsifying agents (e.g., polysorbate 80 (Tween-80)), diluents, adjuvants, excipients, or nontoxic auxiliary substances, other ingredients known in the art, or various combinations thereof. Suitable ingredients can include, for example, fillers, binders, buffers, preservatives, lubricants, flavoring agents, thickening agents, coloring agents, or emulsifying agents.

[0289] In some embodiments, the composition is an injectable formulation. Injectable formulations include sterile aqueous solutions or dispersions, suspensions or emulsions. In all cases, the injectable formulation should be sterile and should be fluid to the extent that easy syringability exists. The injectable formulation should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycols, and the like), and suitable mixtures of the same, and / or vegetable oils. The formulation should be in the form of a solution. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the use of surfactants, etc. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc.

[0290] In some embodiments, the composition is an oral formulation. Oral formulations include, but are not limited to, capsules, caplets, pills, tablets, troches (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or solutions or suspensions in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia), and / or as a mouth wash, etc.

[0291] In solid dosage forms for oral administration (e.g., capsules, tablets, pills, dragees, powders, granules, etc.) of the present application, a DNMT1 -targeting oligonucleotide or a LIFR -targeting compound (e.g., an oligonucleotide) is mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and / or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and / or silicic acid; (2) binders, such as carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose, and / or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) lubricants, such as acetylated monoglycerides, and sodium oleate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricating agents, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and (10) coloring agents.

[0292] In liquid dosage forms for oral administration, a DNMT1 -targeting oligonucleotide or a LIFR-targeting compound (e.g., oligonucleotide) provided herein is mixed with any of the following: a pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the DNMT1 -targeting oligonucleotide or a LIFR-targeting compound (e.g., oligonucleotide) provided herein, the liquid dosage forms can contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, isopropyl alcohol, 1,3-butanediol, oils, in particular cottonseed oil, peanut oil, corn oil, olive oil, castor oil and sesame oil, glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and sorbitan fatty acid esters, and mixtures thereof. Besides inert diluents, the oral compositions can also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring and coloring agents.

[0293] In some embodiments, the composition is an oral or nasal spray formulation. Spray formulations include, but are not limited to, aqueous aerosols, non-aqueous suspensions, liposomal formulations, or solid particulate formulations, and the like. Aqueous aerosols are prepared by mixing a solution or suspension of the agent in water with conventional pharmaceutically acceptable carriers and stabilizers. The carriers and stabilizers vary with the requirements of the particular compound but, in general, include non-ionic surfactants (Tweens or polyethylene glycols), oleic acid, lecithin, amino acids such as glycine, buffers, salts, sugars or sugar alcohols. Aerosols are generally prepared from isotonic solutions and can be delivered by spray.

[0294] Lipid moieties have been used in a variety of methods for nucleic acid therapy. In certain such methods, nucleic acids (e.g., oligonucleotides) are introduced into preformed liposomes or lipoplexes made from a mixture of cationic lipids and neutral lipids. In certain methods, DNA complexes with monocationic or polycationic lipids are formed in the absence of neutral lipids. In some embodiments, the lipid moiety is selected to increase the distribution of a DNMT1 -targeting oligonucleotide or a LIFR-targeting compound (e.g., oligonucleotide) provided herein to a particular cell or tissue. In some embodiments, the lipid moiety is selected to increase the distribution of a DNMT1 -targeting oligonucleotide or a LIFR-targeting compound (e.g., oligonucleotide) provided herein to the liver.

[0295] A DNMT1 -targeting oligonucleotide or a LIFR-targeting compound (e.g., oligonucleotide) provided herein can be encapsulated in a lipid formulation (e.g., LNP) or other nucleic acid-lipid particle.

[0296] In the present application, the term "LNP" refers to a lipid nanoparticle, a stable nucleic acid-lipid particle containing a lipid layer that encapsulates a pharmaceutically active molecule. LNPs are often comprised of a cationic lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate). LNPs are very useful in systemic administration because they exhibit a longer circulation lifetime after intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the site of administration). Various nucleic acid-lipid particles and methods of making them are disclosed in the art, for example, U.S. Patent Nos. 5,976,567, 5,981,501, 6,534,484, U.S. Publication No. 2010 / 0324120, and PCT Publication No. WO 96 / 40964, among others.

[0297] In some embodiments, the oligonucleotides targeting DNMT1 and the compounds (e.g., oligonucleotides) targeting LIFR or their respective compositions provided by the present application can be used in combination. Such combination therapy targets DNMT1 mRNA by using the oligonucleotides targeting DNMT1 provided by the present application to reduce the level of DNMT1 in a subject (e.g., by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 99%), targets the regulatory element region of the LIFR gene by using the compounds (e.g., oligonucleotides) targeting LIFR provided by the present application to increase the level of LIFR in a subject (e.g., by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 99%), and accordingly reduces the therapeutically effective amount of additional therapeutic agents required to treat the subject, and allows for simpler, more convenient use of certain drugs, or reduces the side effects of certain drugs.

[0298] In some embodiments, the compositions provided by the present application can be used in combination with one or more other drugs. In some embodiments, the other drugs are antineoplastic agents, cardiovascular agents, anti-inflammatory agents, antiviral agents, digestive system agents, nervous system agents, respiratory system agents, immune system agents, dermatological agents, metabolic agents, and the like.

[0299] VIII. Vectors

[0300] In another aspect, the present application provides a vector comprising the oligonucleotides targeting DNMT1 or the oligonucleotides targeting LIFR provided by the present application.

[0301] Examples of vectors include plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1 -derived artificial chromosomes (PACs); bacteriophages, such as lambda phage or M13 phage; and animal viruses. Classes of animal viruses that are used as vectors include retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (e.g., herpes simplex viruses), poxviruses, baculoviruses, papillomaviruses, and papovaviruses (e.g., SV40).

[0302] In some embodiments, the vector provided herein is an expression vector. In some embodiments, the vector is used to express the oligonucleotide in a cell. In some embodiments, the vector is used for the preparation of the oligonucleotide.

[0303] The nucleotide or amino acid sequences corresponding to the SEQ ID NOs mentioned in the present application, and their descriptions are shown in Table 1 below.

[0304] Table 1. Nucleotide sequences and amino acid sequences

[0305]

[0306]

[0307]

[0308]

[0309]

[0310]

[0311]

[0312]

[0313]

[0314]

[0315]

[0316]

[0317]

[0318]

[0319]

[0320]

[0321]

[0322]

[0323]

[0324]

[0325]

[0326]

[0327]

[0328]

[0329]

[0330]

[0331]

[0332]

[0333]

[0334]

[0335]

[0336]

[0337]

[0338]

[0339]

[0340]

[0341]

[0342] The present application also provides the following embodiments.

[0343] Embodiment 1: An oligonucleotide targeting DNMT1, wherein the oligonucleotide comprises a nucleotide sequence as set forth in TTCATGTCAGCCAAGGCCAC (SEQ ID NO: 1) or a mutant thereof having at least 90% sequence identity thereto, and 3 nucleotides from the 5’ end and / or 3 nucleotides from the 3’ end of the nucleotide sequence as set forth in SEQ ID NO: 1 or the mutant comprise a locked nucleic acid (LNA) modification.

[0344] Embodiment 2: The oligonucleotide of embodiment 1, wherein the nucleotide sequence as set forth in SEQ ID NO: 1 or the mutant further comprises a LNA modification at any one or more of the nucleotides other than the 3 nucleotides from the 5’ end and 3 nucleotides from the 3’ end.

[0345] Embodiment 3: The oligonucleotide of embodiment 1 or 2, wherein 3, 4, 5, 6, 7, 8, 9, or 10 consecutive nucleotides from the 5’ end and / or 3, 4, 5, 6, 7, 8, 9, or 10 consecutive nucleotides from the 3’ end of the nucleotide sequence as set forth in SEQ ID NO: 1 or the mutant comprise a LNA modification.

[0346] Embodiment 4: The oligonucleotide of any one of embodiments 1-3, wherein the 1st, 2nd, and 3rd nucleotides from the 5’ end and the 1st, 2nd, and 3rd nucleotides from the 3’ end of the nucleotide sequence as set forth in SEQ ID NO: 1 or the mutant comprise a LNA modification.

[0347] Embodiment 5: The oligonucleotide of any one of embodiments 1-4, wherein the 1st, 2nd, and 3rd nucleotides from the 5’ end and the 1st, 2nd, and 3rd nucleotides from the 3’ end of the nucleotide sequence as set forth in SEQ ID NO: 1 or the mutant are LNA-modified nucleotides.

[0348] Embodiment 6: The oligonucleotide of any one of embodiments 1-5, wherein the LNA modification is one or more modifications selected from the group consisting of a methylenoxy (4’-CH2-O-2’) LNA modification (e.g., an alpha-L-methylenoxy (4’-CH2-O-2’) LNA modification, a beta-D-methylenoxy (4’-CH2-O-2’) LNA modification), an ethylenoxy (4’-(CH2)2-O-2’) LNA modification, a methylenoxyamino (4’-CH2-O-N(R)-2’) LNA modification, and a methyleneaminooxy (4’-CH2-N(R)-O-2’) LNA modification.

[0349] Embodiment 7: The oligonucleotide of any of the preceding embodiments, wherein each of positions 4 to 17 from the 5’ end of the nucleotide sequence set forth in SEQ ID NO: 1 is a deoxyribonucleoside.

[0350] Embodiment 8: The oligonucleotide of any of the preceding embodiments, further comprising at least one additional modification.

[0351] Embodiment 9: The oligonucleotide of embodiment 8, wherein the additional modification is selected from the group consisting of a 2’-O-methyl (Me) modification, a 2’-O- ethyl modification, a 2’-O-methoxyethyl (MOE) modification, a 2’-F modification, and combinations thereof. Embodiment 10: The oligonucleotide of any of the preceding embodiments, wherein the internucleoside linkage between at least two adjacent nucleosides or between all nucleosides is a phosphorothioate linkage.

[0352] Embodiment 11: The oligonucleotide of any of the preceding embodiments, which is capable of reducing mRNA transcription and / or promoting mRNA degradation of a DNMT1 gene.

[0353] Embodiment 12: The oligonucleotide of any of the preceding embodiments, which is a single-stranded antisense oligonucleotide.

[0354] Embodiment 13: The oligonucleotide of any of the preceding embodiments, which has a chemical structure as set forth in Chemical Formula 1. Embodiment 14: The oligonucleotide of any of the preceding embodiments, which is covalently linked to a conjugate moiety. Embodiment 15: The oligonucleotide of embodiment 14, wherein the conjugate moiety is capable of binding to an asialogycoprotein receptor.

[0355] Embodiment 16: The oligonucleotide of embodiment 14 or 15, wherein the conjugate moiety is N-acetylgalactosamine (GalNAc), an antibody, or an antigen-binding fragment thereof.

[0356] Embodiment 17: The oligonucleotide of any of the preceding embodiments, in the form of a pharmaceutically acceptable salt.

[0357] Embodiment 18: A composition comprising the oligonucleotide of any of the preceding embodiments, and a pharmaceutically acceptable carrier.

[0358] Embodiment 19: A vector comprising the oligonucleotide of any of embodiments 1-17.

[0359] Embodiment 20: A method for modulating DNMT1 expression in a target cell expressing DNMT1, the method comprising exposing the target cell to the oligonucleotide of any one of embodiments 1-17, the composition of embodiment 18, or the vector of embodiment 19.

[0360] Embodiment 21: A method for preventing, inhibiting or reversing gene methylation, comprising administering to a subject in need thereof an effective amount of the oligonucleotide of any one of embodiments 1-17, the composition of embodiment 18, or the vector of embodiment 19.

[0361] Embodiment 22: A method for treating or preventing a disease, comprising administering to a subject in need thereof an effective amount of the oligonucleotide of any one of embodiments 1-17, the composition of embodiment 18, or the vector of embodiment 19.

[0362] Embodiment 23: The method of embodiment 22, wherein the disease is cancer (e.g., liver cancer, breast cancer, colon cancer, rectal cancer, lung cancer, bladder cancer, leukemia, myelodysplastic syndrome (MDS), lymphoma, melanoma, kidney cancer, gastric cancer).

[0363] Embodiment 24: A method for assisting cell therapy, comprising administering to a subject in need thereof an effective amount of the oligonucleotide of any one of embodiments 1-17, the composition of embodiment 18, or the vector of embodiment 19.

[0364] Embodiment 25: A method for screening a target gene regulated by DNA methylation, comprising the steps of:

[0365] (a) preparing a DNMT1 knockdown sample using the oligonucleotide of any one of embodiments 1-17, the composition of embodiment 18, or the vector of embodiment 19;

[0366] (b) performing methylation quantification and expression quantification on the DNMT1 knockdown sample prepared in step (a) and a control sample, respectively, and performing differential methylation analysis and differential expression analysis; and

[0367] (c) performing correlation analysis on the differential methylation analysis and the differential expression analysis in step (b), thereby determining a target gene regulated by DNA methylation; wherein when the differential methylation analysis and the differential expression analysis show that the methylation level of a CpG site of a gene is negatively or positively correlated with its expression level, the gene is determined as a target gene regulated by DNA methylation.

[0368] Embodiment 26: The screening method of embodiment 25, wherein in step (c), when the differential methylation analysis shows that the methylation level of a CpG site of a certain gene is reduced, while the differential expression analysis shows that the expression level of the gene is increased or reduced, the gene is determined as a target gene regulated by DNA methylation.

[0369] Embodiment 27: The screening method of embodiment 25, wherein in step (c), when the differential methylation analysis shows that the methylation level of a CpG site of a certain gene is increased, while the differential expression analysis shows that the expression level of the gene is reduced or increased, the gene is determined as a target gene regulated by DNA methylation.

[0370] Embodiment 28: A method of reprogramming a methylation regulatory region of a target gene, comprising the steps of: (i) selecting a methylation regulatory region of a target gene;

[0371] (ii) selecting an oligonucleotide complementary to the sense strand or the antisense strand of the methylation regulatory region of the target gene selected according to step (i); and

[0372] (iii) reprogramming the methylation regulatory region of the target gene using the oligonucleotide selected in step (ii).

[0373] Embodiment 29: The method of embodiment 28, wherein the target gene is determined by the method of embodiment 25.

[0374] Embodiment 30: The method of any one of embodiments 25-29, wherein the target gene is selected from the group consisting of FBX031, FBX032, IGF2R, LIFR, MAD1L1, PLEKHO1, RUNX3, STK10, and combinations thereof. Embodiment 31: The method of embodiment 30, wherein the target gene is LIFR.

[0375] Embodiment 32: The method of any one of embodiments 28-31, wherein the methylation regulatory region of the target gene selected in step (i) is the region of chr5:38595894-38596033 of the LIFR gene (reference genome GRCh38 / hg38).

[0376] Embodiment 33: A kit for performing the method of any one of embodiments 25-32.

[0377] Embodiment 34: A compound targeting any 12-50 consecutive nucleotides within the region of chr5:38595894-38596033 of the LIFR gene.

[0378] Embodiment 35: The compound of embodiment 34, wherein the compound comprises an oligonucleotide that enhances LIFR gene expression.

[0379] Embodiment 36: The compound of any one of embodiments 34-36, which is capable of upregulating expression of a LIFR gene.

[0380] Embodiment 37: The compound of embodiment 35 or 36, wherein the oligonucleotide comprises:

[0381] (a) a nucleotide sequence that is at least 80% identical or is identical to any 12-50 consecutive nucleotides within the nucleotide sequence set forth as SEQ ID NO: 2 or SEQ ID NO: 3, or

[0382] (b) a nucleotide sequence that is at least 80% complementary or is complementary to any 12-50 consecutive nucleotides within the nucleotide sequence set forth as SEQ ID NO: 2 or SEQ ID NO: 3.

[0383] Embodiment 38: The compound of any one of embodiments 35-37, wherein the oligonucleotide comprises a nucleotide sequence that is identical or is complementary to any 12-50 consecutive nucleotides within the nucleotide sequence set forth as SEQ ID NO: 2 or SEQ ID NO: 3.

[0384] Embodiment 39: The compound of any one of embodiments 35-37, wherein the nucleotide sequence of the oligonucleotide or the consecutive nucleotides comprises at least 1 CpG site, preferably 2 or more.

[0385] Embodiment 40: The compound of any one of embodiments 35-39, wherein the oligonucleotide comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 17.

[0386] Embodiment 41: The compound of any one of embodiments 35-40, wherein at least 1 nucleoside from the 5’ end and / or at least 1 nucleoside from the 3’ end of the oligonucleotide comprises a modification.

[0387] Embodiment 42: The compound of embodiment 41, wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides from the 5’ end and / or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides from the 3’ end of the oligonucleotide comprise a modification.

[0388] Embodiment 43: The compound of Embodiment 42, wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleosides from the 5’ end and / or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleosides from the 3’ end of the oligonucleotide comprise a modification.

[0389] Embodiment 44: The compound of Embodiment 43, wherein the 1st, 2nd, and 3rdnucleosides from the 5’ end and the 1st, 2nd, and 3rdnucleosides from the 3’ end of the oligonucleotide comprise a modification.

[0390] Embodiment 45: The compound of any one of Embodiments 35-44, wherein the modification of the oligonucleotide comprises one or more base modification, ribose modification, and / or linkage modification.

[0391] Embodiment 46: The compound of Embodiment 45, wherein the base modification of the oligonucleotide is selected from the group consisting of pseudouracil (ψ), N1-methylpseudouracil (N1Mψ), 1-ethylpseudouracil, 2-thiouracil (s2U), 4-thiouracil, 5-methylcytosine, 5-methyluracil, 5-methoxyuracil, and combinations thereof.

[0392] Embodiment 47: The compound of Embodiment 45, wherein the ribose modification of the oligonucleotide is selected from the group consisting of LNA modification, 2’-O-methyl (Me) modification, 2’-O-ethyl modification, 2’-O-methoxyethyl (MOE) modification, 2’-F modification, and combinations thereof.

[0393] Embodiment 48: The compound of Embodiment 47, wherein the LNA modification is one or more modifications selected from the group consisting of methylenoxy (4’-CH2-O-2’) LNA modification (e.g., alpha-L-methylenoxy (4’-CH2-O-2’) LNA modification, beta-D-methylenoxy (4’-CH2-O-2’) LNA modification), ethylenoxy (4’-(CH2)2-O-2’) LNA modification, methylenoxyamino (4’-CH2-O-N(R)-2’) LNA modification, and methyleneaminooxy (4’-CH2-N(R)-O-2’) LNA modification.

[0394] Embodiment 49: The compound of Embodiment 47, wherein the ribose modification of the oligonucleotide is a 2’-O-MOE modification.

[0395] Embodiment 50: The compound of any one of Embodiments 35-49, wherein the oligonucleotide is a gapmer or a mixmer.

[0396] Embodiment 51 : The compound of any one of embodiments 35-50, wherein the internucleoside linkage between at least two adjacent nucleosides or between all nucleosides of the oligonucleotide is a phosphorothioate linkage.

[0397] Embodiment 52: The compound of any one of embodiments 35-51, wherein the oligonucleotide is a single-stranded antisense oligonucleotide.

[0398] Embodiment 53: The compound of any one of embodiments 35-52, wherein the chemical structure of the oligonucleotide is according to Formula 2, Formula 3, Formula 4, or Formula 5.

[0399] Embodiment 54: The compound of embodiment 53, wherein the chemical structure of the oligonucleotide is according to Formula 4 or Formula 5.

[0400] Embodiment 55: The compound of any one of embodiments 35-54, wherein the oligonucleotide is covalently linked to a conjugate moiety.

[0401] Embodiment 56: The compound of embodiment 55, wherein the conjugate moiety is capable of binding to an asialogycoprotein receptor.

[0402] Embodiment 57: The compound of embodiment 55 or 56, wherein the conjugate moiety is N-acetylgalactosamine (GalNAc), an antibody, or an antigen-binding fragment thereof.

[0403] Embodiment 58: A compound of any one of embodiments 35-57, in the form of a pharmaceutically acceptable salt.

[0404] Embodiment 59: A composition comprising a compound of any one of embodiments 34-58, and a pharmaceutically acceptable carrier.

[0405] Embodiment 60: A vector comprising a compound of any one of embodiments 34-58.

[0406] Embodiment 61 : A method for modulating LIFR expression in a target cell expressing LIFR, the method comprising exposing the target cell to a compound of any one of embodiments 34-58, a composition of embodiment 59, or a vector of embodiment 60.

[0407] Embodiment 62: A method of upregulating LIFR gene expression in a subject, the method comprising administering to a subject in need thereof an effective amount of a compound of any one of embodiments 34-58, a composition of embodiment 59, or a vector of embodiment 60.

[0408] Embodiment 63: A method of preventing, inhibiting or reversing methylation of LIFR gene, comprising administering to a subject in need thereof an effective amount of a compound of any one of embodiments 34-58, a composition of embodiment 59, or a vector of embodiment 60.

[0409] Embodiment 64: A method of treating or preventing a disease, comprising administering to a subject in need thereof an effective amount of a compound of any one of embodiments 34-58, a composition of embodiment 59, or a vector of embodiment 60.

[0410] Embodiment 65: The method of embodiment 64, wherein the disease is cancer (e.g., liver cancer, pancreatic cancer).

[0411] Embodiment 66: The method of any one of embodiments 62-65, wherein the subject is a mammal (e.g., a human). Example

[0412] Example 1 Methylation regulatory site discovery

[0413] 1.1 Preparation of DNMT1 knockdown samples and control samples

[0414] This example used ASOs to knock down DNMT1 in cells, and the specific sequences of the ASOs used are shown in Table 2. All internucleoside linkages of all ASOs were phosphorothioate linkages, wherein lower case letters represent DNA, upper case bold letters represent LNA modifications, and upper case letters represent 2’-OMe modifications (i.e., 2’-O-methyl modifications). Bold underlined

[0415] Table 2. ASO sequences and their chemical modifications

[0416]

[0417] The samples used in this example were HepG2 cell lines, which were cultured in DMEM medium (containing 10% fetal bovine serum) under conditions of 37°C and 5% carbon dioxide. The steps for preparing the DNMT1 knockdown samples were as follows:

[0418] • One day before ASO intervention, cells were seeded into 12-well plates at 0.1 x 10 6 cells per well;

[0419] ​On the day of ASO intervention, the procedure was performed according to either a non-mediated protocol or a liposome transfection protocol. The non-mediated protocol involved replacing 1 mL of complete culture medium (DMEM containing 10% fetal bovine serum) with the specified concentration of ASO in each well. The liposome transfection protocol used Lipofectamine. TM The transfection was performed using 3000 transfection reagent (Invitrogen, #L3000008). The specific steps included preparing the liposome-ASO complex according to the reagent instructions, replacing 1 mL of complete culture medium for each well of cells and adding the complex, with the final concentration of ASO being 100 nM.

[0420] • For the preparation of control samples, the operation steps are the same as above, but ASO is replaced with an equal volume of PBS;

[0421] • Cells were collected for gene expression detection 24-72 hours after ASO or PBS intervention.

[0422] Gene mRNA expression was detected using qPCR technology. Specific steps included extracting total RNA from cells using the FastPure Cell / Tissue Total RNA Isolation Kit V2 (Vazyme, #RC112), and then... III. cDNA reverse transcription was performed using the RT SuperMix for qPCR (+gDNA wiper) kit (Vazyme, #R323), and the target gene DNMT1 was amplified using the Taq Pro Universal SYBR qPCR Master Mix kit (Vazyme, #Q712). The primer sequences for DNMT1 were obtained from publicly available information (Wang XX, Zhang H, Li Y. Preliminary study on the role of miR-148a and DNMT1 in the pathogenesis of acute myeloid leukemia. Mol Med Rep. 2019; 19(4):2943-2952. doi:10.3892 / mmr.2019.9913), with the forward primer sequence being AGACTACGCGAGATTCGAGTC (SEQ ID NO:7) and the reverse primer sequence being TTGGTGGCTGAGTAGTAGAGG (SEQ ID NO:8). Gene expression analysis employed an absolute quantification method, which involved using control group samples as standards and plotting standard curves with 5-fold serial dilutions. The copy number of the test sample relative to the control sample was then calculated based on the standard curve.

[0423] Protein expression detection of genes was performed based on Western blot technique. The specific steps include:

[0424] • Lysis of cells using RIPA buffer (Thermo, #89900) containing final concentration of 1X protease inhibitor (Lablead, #C0101) and final concentration of 1 mM PMSF (Solarbio, #P0100);

[0425] • Separation of equal amount of protein lysate (30 pg) on 4-12% Bis-Tris gel and transfer to nitrocellulose membrane;

[0426] • After blocking the membrane with 5% skim milk at room temperature for 1 hour, incubating with primary antibody (DNMT1 antibody (Abeam, #ab19905) and GAPDH antibody (Thermo, #MA515738)) for 2 hours at room temperature, and incubating with HRP conjugated anti-rabbit antibody (Abeam, #ab6721) and anti-mouse antibody (Abeam, #ab205719) for 1 hour at room temperature;

[0427] • Developing the blot bands using ECL reagent (YEASEN, #36208ES76) and quantifying the gray scale with Image J software (Image J 1.4, NIH);

[0428] • Normalizing the results using GAPDH as internal control.

[0429] The experimental results show that using xNA-07070 and xNA-07072 to intervene HepG2 cells for 24 hours under non-mediated and liposome transfection conditions, both have significant knockdown of DNMT1 mRNA. However, when intervened under non-mediated conditions, xNA-07070 with the same dose (4 mM) has a higher degree of DNMT1 mRNA knockdown than xNA-07072 (96.2% vs. 72.3%, respectively, Figure 2 A). Using xNA-07070 to intervene HepG2 cells for 72 hours under non-mediated conditions, the degree of knockdown of DNMT1 is proportional to the dose of ASO, and the IC 50 is about 0.1 mM. When the dose of xNA-07070 is 1 mM and 5 mM, the mRNA expression of DNMT1 is reduced by 87.1% and 97.7%, respectively, and the protein expression is reduced by 76.0% and 86.6%, respectively Figure 2 B). In HepG2 cells intervened by xNA-07070, only the expression of DNMT1 gene is down-regulated, while the expression of DNMT3A and DNMT3B is not affected Figure 2C). In addition, HepG2 cell viability was tested using the CCK8 kit (Solarbio, #CA1210) and the results showed that there was no significant change in cell viability when the xNA-07070 dose was 1 mM, whereas there was a clear decrease in cell viability (about 35.8%, p<0.05) when the xNA-07070 dose was 5 mM, Figure 2 D).

[0430] 1.2 Whole genome range methylation and gene expression quantification

[0431] According to the above results, the present embodiment selected DNMT1 knockdown HepG2 samples (obtained by intervention with 1 mM and 5 mM xNA-07070) and their control samples for whole genome range methylation and gene expression quantification, with 3 samples in each group, from 3 independent in vitro experiments. The detection techniques used were Reduced Representation Bisulfite Sequencing (RRBS) and RNA-seq, respectively. The sequencing library construction method is as previously described (Deng Q, Du Y, Wang Z, et al. Identification and validation of a DNA methylation-driven gene-based prognostic model for clear cell renal cell carcinoma. BMC Genomics. 2023;24(1):307. Published 2023 Jun 7. doi: 10.1186 / s12864-023-09416-z; Hu Q, Liu C, Zhang D, et al. Effects of Low-Dose Antibiotics on Gut Immunity and Antibiotic Resistomes in Weaned Piglets. Front Immunol. 2020;11:903. Published 2020 Jun 10. doi: 10.3389 / fimmu.2020.00903). The data analysis steps of RRBS include removing low-quality sequences and adapter contamination using Cutadapt (v1.9), aligning clean reads to the reference genome (hg38) using BSMAP (v2.73), and calculating methylation levels at single base resolution. The data analysis steps of RNA-seq include removing adapter contamination using Cutadapt (v1.9) and low-quality sequences using Trimmomatic (v0.39), aligning clean reads to the reference genome (hg38) using the hisat2 (v2.1.0) tool, and generating a gene count matrix using the featureCounts (v2.0.1) tool according to gene annotation information (gencode v40).

[0432] The experimental results show that based on RRBS sequencing depth of no less than 5x and all samples covering CpG sites for methylation level calculation, the whole genome range of CpG methylation rate of the control sample is 62.8%, while after knocking down DNMT1 using 1 μM and 5 μM of xNA-07070, the methylation rate is significantly reduced, respectively to 59.1% and 56.0%. Among the 61,544 annotated genes, RNA-seq shows that 34,789 genes are expressed in at least one sample.

[0433] 1.3 Differential methylation and differential gene expression analysis

[0434] Using the RRBS and RNA-seq data obtained above, this embodiment performs significance test of methylation level and gene expression of HepG2 samples with different degrees of DNMT1 knockdown and their control samples. The differentially methylated regions (DMR) between groups are identified by the metilene tool, wherein the judgment criteria of DMR include: 1) the distance between adjacent CpG sites in DMR is ≤300bp, 2) the number of CpG sites contained in DMR is ≥5, 3) the methylation level difference between groups of DMR is >0.1, and 4) the Benjamini-Hochberg method is used to correct q-value, and the threshold is set to 0.05. The differentially expressed genes (DEG) between groups are identified by the DESeq2 tool, and the default threshold false discovery rate (FDR) <0.1 is used for identification.

[0435] The statistical results show that after knocking down DNMT1 using 1 μM and 5 μM of xNA-07070, respectively, 811 and 15,358 DMRs are identified Figure 3A). These DMRs mostly showed hypomethylation, and the proportion of such hypomethylated DMRs was higher at 5 mM xNA-07070 (99.1% vs. 82.2%, Chi-squared test P<0.05). According to the gene annotation information (gencode v40), the DMRs caused by knocking down DNMT1 with 1 mM and 5 mM xNA-07070 involved 374 and 2984 genes within 1 kb upstream and downstream of the Transcription start site (TSS), 487 and 6268 genes within intron regions, 247 and 2834 genes within exon regions, and 422 and 4695 genes within 2 kb upstream and downstream, respectively. On the other hand, based on the analysis of RNA-seq data by DESeq2, the results showed that 177 and 2058 DEGs were identified after knocking down DNMT1 with 1 mM and 5 mM xNA-07070, respectively, among which DNMT1 was identified as the most significantly changed gene in both experimental conditions Figure 3 B). According to the calculation results by DESeq2, DNMT1 mRNA was down-regulated by 86.4% and 97.8%, respectively, which was consistent with the calculation results of samples based on QPCR in Example 1.1.

[0436] 1.4 Methylation and expression correlation analysis

[0437] Next, this example performed correlation analysis on the DMRs and DEGs identified above (Example 1.3), so as to infer the genes regulated by DNA methylation. First, according to the intersection of genes involved in DMRs and DEGs, the results showed that among the DEGs caused by knocking down DNMT1 with 1 mM and 5 mM xNA-07070, respectively, 5 and 855 genes were identified to have DMRs in their gene regions or within 2 kb upstream and downstream, and the former 5 DEGs were all contained in the latter 855 DEGs Figure 3C). Among these 5 DEGs, 1 DEG (ERFE) was up-regulated (1.8-2.4 fold) and its TSS upstream and downstream 1 kb were identified to be hypomethylated (13.5% to 14.4%). The other 4 DEGs (CAMK1D, RAB3IL1, RAD51B and UTRN) were all located in the gene region and were hypomethylated, while their gene expressions were up- or down-regulated. In addition, the 855 DEGs caused by 5 μΜ xNA-07070 to knock down DNMT1 involved 2276 DMRs in total, and most of the regions (2261 / 2276) were hypomethylated (13.7% on average). As for the gene expression, 374 DEGs were up-regulated (1.7 fold on average) and the rest were down-regulated to 0.6 fold on average.

[0438] To further infer the possible regulation of the above DEGs by DNA methylation, Spearman correlation analysis was performed between the expression of the DEGs and the methylation level of each CpG site in the DMRs involved. The standard for screening significant correlation was that the absolute value of the correlation coefficient rho was greater than 0.6 and the p-value was less than 0.05. Based on this standard, among the 5 common DEGs caused by 1 μΜ and 5 μΜ xNA-07070 to knock down DNMT1, the intron regions of CAMK1D and RAD51B had CpG site methylation levels positively correlated with their expression levels (average rho = 0.77), while the exon region of RAB3IL1 had CpG site methylation levels negatively correlated with its expression level (average rho = -0.74). Among the 855 DEGs caused by 5 μΜ xNA-07070 to knock down DNMT1, 488 DEGs had CpG sites significantly correlated with their expression levels. Moreover, the correlation between CpG site methylation level and gene expression was related to the location of these sites (Chi-square test, P < 0.05). Among them, the CpG sites with positive correlation between methylation level and gene expression were mainly located in the intron region, while the CpG sites with negative correlation were mainly located in the 1 kb upstream and downstream of the TSS (Chi-square test, P < 0.05). Figure 3D). Furthermore, among the 2276 DMRs involved in these 855 DEGs, 911 DMRs are located within or near the 1327 regulatory elements (distance <200 bp) currently listed in the ENCODE database (ENCODE Project Consortium, Moore JE, Purcaro MJ, et al., Expanded encyclopaedias of DNA elements in the human and mouse genomes [published correction appears in Nature. 2022 May; 605(7909):E3]. Nature. 2020; 583(7818):699-710. doi:10.1038 / s41586-020-2493-4), including 2344 methylation sites significantly associated with gene expression. The majority (72.2%) of these sites involve distal enhancers (…). Figure 3 E), and the methylation level was positively correlated with gene expression (mean rho = 0.79).

[0439] 1.5 Target gene screening and analysis

[0440] Next, this embodiment performs biological function analysis on the genes inferred to be regulated by DNA methylation to screen target genes and assess the feasibility of reprogramming them. Based on the enrichment analysis tool DAVID (Sherman BT, Hao M, Qiu J, et al., DAVID: a web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic Acids Res. 2022; 50(W1):W216-W221. doi:10.1093 / nar / gkac194), the 855 DEGs induced by knocking down DNMT1 with 5 μM xNA-07070 were mainly involved in the biological process of regulation of small GTPase-mediated signal transduction (GO:0051056), the cellular component of membrane (GO:0016020), and the molecular function of protein binding (GO:0005515).

[0441] Furthermore, based on the HepG2 cell phenotypes with varying degrees of DNMT1 knockdown, cell viability was significantly decreased only when the xNA-07070 dose was 5 μM (i.e., when DNMT1 mRNA was knocked down by 97.7%). Figure 2 D). Therefore, this embodiment aims to identify genes associated with this cell phenotype. Since reduced cell viability may be regulated by tumor suppressor genes (Chen L, Liu S, Tao Y., Regulating tumor suppressor genes: post-translational modifications. Signal Transduct Target Ther. 2020; 5(1):90. Published 2020Jun10. doi:10.1038 / s41392-020-0196-9), the inventors searched the database and confirmed that among the 855 DEGs caused by knocking down DNMT1 with 5 μM xNA-07070, 62 DEGs were already included tumor suppressor genes (Zhao M, Kim P, MitraR, Zhao J, Zhao Z. TSGene 2.0: an updated literature-based knowledgebase for tumor suppressor genes. Nucleic Acids Res. 2016; 44(D1):D1023-D1031. doi:10.1093 / nar / gkv1268; Sondka Z, Bamford S, Cole CG, Ward SA, Dunham I, Forbes SA. The COSMIC Cancer Gene Census:describing genetic dysfunction across all human cancers. Nat Rev Cancer. 2018; 18(11):696-705. doi:10.1038 / s41568-018-0060-1). Among them, 25 tumor suppressor genes showed upregulation (average 1.7-fold) after DNMT1 knockdown, while the rest were downregulated (average 0.6-fold). These 25 tumor suppressor genes were upregulated only when HepG2 was treated with xNA-07070 at a dose of 5 μM, while no significant changes were observed when HepG2 was treated with xNA-07070 at a dose of 1 μM, thus indicating a correlation with cell phenotype. All 25 upregulated tumor suppressor genes involved in DMR showed decreased methylation levels (average reduction of 13.8%). Among them, the gene with the highest correlation between gene expression and CpG site methylation levels was LIFR (average rho = -0.77). Figure 3F). Among these tumor suppressor genes, 8 genes (FBX031, FBX032, IGF2R, LIFR, MAD1L1, PLEKHO1, RUNX3, STK10) were associated with methylation sites that were significantly correlated with expression, and their DMRs were located in or near regulatory elements. Among them, the methylation site negatively correlated with LIFR expression was near the promoter regulatory element, and the methylation sites associated with other genes were near the distal or proximal enhancers Figure 3 G).

[0442] Example 2 Methylation regulatory site reprogramming

[0443] 2.1 Selection of target gene methylation regulatory region

[0444] Among the above inferred tumor suppressor genes regulated by DNA methylation, LIFR gene expression has the highest correlation with methylation. This embodiment further analyzes LIFR to select its potential methylation regulatory site for subsequent oligonucleotide intervention test. According to the results of RNA-seq and RRBS analysis, after 97.7% knockdown of DNMT1 mRNA in HepG2 cells using 5 μM of xNA-07070, the methylation level of the region near the promoter regulatory element of LIFR gene (chr5:38595894-38596033) decreased by 10.8%, and the gene expression was up-regulated by 1.54 times Figure 4 A). This region contains a total of 20 CpG sites, 18 of which are detected by RRBS in all HepG2 samples. The methylation levels of these CpG sites are negatively correlated with the expression of LIFR gene, and the closer to the promoter regulatory element (ENCODE Accession: EH38E2367108), the higher the correlation (P < 0.1, Figure 4 B).

[0445] 2.2 Oligonucleotide sequence generation and screening

[0446] Based on the above analysis, the DMR (chr5:38595894-38596033) involved in the tumor suppressor gene LIFR was selected for oligonucleotide sequence screening in this embodiment. The region is 140 bp in length, and a total of 121 pairs of 20 nt long oligonucleotide sequences can be generated (each pair of sequences is reverse complementary). Among them, 24 pairs of oligonucleotide sequences contain at least two CpG sites in the sense strand or antisense strand. Since oligonucleotides can degrade mRNA when they bind to mRNA, the inventors evaluated the possible off-target effects of these 24 pairs of oligonucleotide sequences. Using the sequence alignment tool BLAST (Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990; 215(3): 403-410. doi: 10.1016 / S0022-2836(05)80360-2), of these 24 pairs of sequences, 17 pairs were not significantly aligned to any existing annotated transcript (RefSeq assembly accession: GCF_000001405.40), suggesting no off-target risk. According to the above analysis (Example 2.1), since the degree of association between methylation sites and gene expression is related to the distance of the regulatory element, the oligonucleotide sequences closest to the regulatory element in these 17 pairs of sequences were selected for further study.

[0447] 2.3 Chemical synthesis of oligonucleotides

[0448] The LIFR oligonucleotide sequences selected in the above (Example 2.2) were chemically synthesized in this embodiment, and the specific molecular information is shown in Table 3. All the internucleoside linkages between all the nucleosides of all the oligonucleotides are phosphorothioate linkages, wherein lowercase letters represent DNA, uppercase bold letters represent 2’-O-MOE modification, Bold underlined and letters represent LNA modification.

[0449] Table 3. Oligonucleotide sequences and their chemical modifications

[0450]

[0451] The oligonucleotide preparation process includes:

[0452] (1) Chemical synthesis by solid-phase phosphoramidite chemistry: Specifically, the synthesis of the solid-phase carrier is a controlled microporous glass bead, and a phosphoramidite monomer is used, and the four steps of deprotection, coupling, capping and oxidation are used as a cycle, and a new nucleotide is generated in each cycle. An oligonucleotide single strand is synthesized from the 3' end to the 5' end direction through multiple cycles. This step is carried out in a synthesis column containing a solid-phase carrier using an automated device.

[0453] (2) Ammonolysis reaction: The synthesized oligonucleotide chain was collected from the solid phase carrier by ammonolysis reaction. Specifically, ammonia was added in the synthesis column, reacted at 80°C for 3 hours, and the ammonolysis product was collected by centrifugation at 2000 rpm for 5 minutes.

[0454] (3) Purification of synthesis product: The ammonolysis product was placed at 80°C for 30 minutes, and the deamination product was collected by centrifugation at 2000 rpm for 2 minutes. The deamination product was transferred to a glass bottle for dialysis, purified by dialysis with deionized water, and the purified product was collected by centrifugation at 2000 rpm for 5 minutes.

[0455] 2.4 Oligonucleotide intervention experiment

[0456] This example is similar to the above (Example 1.1), and the sample used is the HepG2 cell line, which is cultured in DMEM medium containing 10% fetal bovine serum, and the culture environment conditions are 37°C and 5% carbon dioxide. One day before intervention, the cells were inoculated into 12-well plates at a density of 0.1 x 10 6 cells per well. On the day of intervention, 1 mL of complete culture medium (DMEM containing 10% fetal bovine serum) was replaced for each well of cells, and the experimental group contained oligonucleotides at a final concentration of 4 μM, and the control group contained PBS of the same volume as the oligonucleotides. Cells were collected 72 hours after intervention for subsequent gene expression and methylation detection. For cell viability detection, the experimental procedure was similar, in which cells were inoculated into 96-well plates at a density of 0.01 x 10 6 cells per well and the culture medium volume was 100 uL, and the remaining conditions were unchanged. After 72 hours of intervention, cell viability was detected using a CCK8 kit (Solarbio, #CA1210).

[0457] 2.5 Target gene expression and methylation analysis

[0458] The present example is similar to the above (Example 1.1), and the mRNA expression detection of LIFR gene is based on QPCR technology. Among them, the primer sequence of LIFR is from Primer-blast (Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 2012; 13: 134. Published 2012 Jun 18. doi: 10.1186 / 1471-2105-13-134), the forward primer sequence is AATCCTAACCCTCTCTCCCA (SEQ ID NO: 9), and the reverse primer sequence is CAATGCAGTCAGTCCTGGAG (SEQ ID NO: 10). The gene expression analysis uses relative quantification method, that is, the expression amount of target gene of the sample to be tested relative to the housekeeping gene is calculated according to the deltaCt method. The housekeeping gene used in the present example is ACTB, and the primer sequence is from Harvard Primer Bank (Spandidos A, Wang X, Wang H, Seed B. PrimerBank: a resource of human and mouse PCR primer pairs for gene expression detection and quantification. Nucleic Acids Res. 2010; 38 (Database issue): D792-D799. doi: 10.1093 / nar / gkp1005), the forward primer sequence is CATGTACGTTGCTATCCAGGC (SEQ ID NO: 11), and the reverse primer sequence is CTCCTTAATGTCACGCACGAT (SEQ ID NO: 12).

[0459] The methylation level of the oligonucleotide intervention site was detected based on methylation-specific PCR (MSP). The specific steps included extracting cell DNA using FastPure Blood / Cell / Tissue / Bacteria DNA Isolation Mini Kit (Vazyme, #DC112), and bisulfite treatment of cell DNA using EpiArt DNA Methylation Bisulfite Kit (Vazyme, #EM101) to convert the unmethylated cytosine in the DNA into uracil, and then amplifying the target fragment using Taq Pro Universal SYBR qPCR Master Mix Kit (Vazyme, #Q712). Among them, the forward and reverse sequences of the specific primers for the methylation site were GGTTTATTGTAAGTTTCGTTTTTCG (SEQ ID NO: 13) and CTAACTAACACGATAAAACCCCGT (SEQ ID NO: 14), respectively, and the forward and reverse sequences of the specific primers for the non-methylation site were GTTTATTGTAAGTTTTGTTTTTTGG (SEQ ID NO: 15) and CTAACTAACACAATAAAACCCCATC (SEQ ID NO: 16), respectively. The primer sequences were from MethPrimer design (Li LC, Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinformatics. 2002; 18(11): 1427-1431. doi: 10.1093 / bioinformatics / 18.11.1427), and the methylation level of each sample was analyzed based on the deltaCt method (Lu L, Katsaros D, de la Longrais IA, Sochirca O, Yu H. Hypermethylation of let-7a-3 in epithelial ovarian cancer is associated with low insulin-like growth factor-II expression and favorable prognosis. Cancer Res. 2007; 67(21): 10117-10122. doi: 10.1158 / 0008-5472.CAN-07-2544).

[0460] The experimental results show that after DNMT1 knockdown of HepG2 using xNA-07070, the expression of LIFR gene is up-regulated by 1.68 times, and after using oligonucleotide targeting the deduced LIFR methylation regulation site, the expression of LIFR gene shows different degrees of up-regulation according to the sequence and chemical modification of the oligonucleotide. Among them, xNA-14203 and xNA-14204 are both fully modified with thio, and the sequences are reverse complementary, which are the sequences of the sense strand and the antisense strand respectively, and make LIFR up-regulate 1.59 and 1.24 times respectively. xNA-14219, xNA-14220 and xNA-14203 have the same sequence but different chemical modifications, xNA-14219 is LNA gapmer modification, and xNA-14220 is MOE gapmer modification, which make LIFR down-regulate 32% and up-regulate 2.14 times respectively at 72 hours after intervention Figure 4 C) Based on the analysis of the oligonucleotide intervention site by MSP, after the knockdown of DNMT1 by xNA-07070, the methylation level of LIFR is reduced by 20.0%. And after using oligonucleotide targeting the regulation site of LIFR, only xNA-14203 affects the methylation level of the site (reduced by 8.0%), and the rest of the molecules have no significant effect Figure 4 D) Based on the cell viability detection, after the intervention of the above molecules on HepG2 cells for 72 hours, the cell viability is reduced to different degrees. Among them, after the knockdown of DNMT1 using xNA-07070, the viability of HepG2 is reduced by 27.2%; and after using oligonucleotide targeting the methylation regulation site of LIFR, the cell viability is reduced by 12.4-80.0% Figure 4 E).

[0461] Further, the effects of different molecules on LIFR gene expression and cell viability after intervention on HepG2 cells are different, and are related to the intervention time. Among them, xNA-07070 and xNA-14203 are similar, both of which significantly up-regulate LIFR mRNA (1.4 to 2.1 times) after 24 hours of intervention on HepG2 cells, while the cell viability is reduced by 7.8% and 5.6% respectively after 72 hours; xNA-14219 up-regulates LIFR expression by 1.4 times after 9 hours of intervention, and the cell viability is reduced by 29.6%. With the extension of xNA-14219 intervention time to 24-72h, the expression of LIFR is reduced by 49.1% to 74.8% compared with the control group, and the cell viability is continuously reduced (29.0% to 78.2%, Figure 4F and G). Since the gene expression quantification results represent the average of the whole cell population, for example, assuming there are two subpopulations of cells in the population, the first subpopulation of cells has higher LIFR expression and the cells tend to undergo apoptosis, and the second subpopulation of cells has lower LIFR expression and the cells tend to survive. The inventors speculate that the phenomenon of "down-regulation" of LIFR expression after 24-72h of xNA-14219 intervention can be due to the fact that the subpopulation of cells with higher LIFR expression (i.e., the first subpopulation of cells described above) in the xNA-14219 intervention group has started to die or has all died, and most or all of the remaining surviving cells are cells with lower LIFR expression (i.e., the second subpopulation of cells described above), and the LIFR expression level of the latter is lower than the average of the population containing the two subpopulations of cells Figure 4 H). xNA-14220 up-regulates LIFR expression by 3-fold after 48-72h of intervention, while cell viability maintains a reduction of about 21% Figure 4 F and G).

Claims

1. An oligonucleotide targeting DNMT1, wherein, The oligonucleotide comprises a nucleotide sequence as set forth in TTCATGTCAGCCAAGGCCAC (SEQ ID NO: 1) or a mutant thereof having at least 90% sequence identity thereto, and 3 nucleotides from the 5’ end and / or 3 nucleotides from the 3’ end of the nucleotide sequence as set forth in SEQ ID NO: 1 or the mutant comprise a locked nucleic acid (LNA) modification.

2. The oligonucleotide of claim 1, wherein, The nucleotide sequence as set forth in SEQ ID NO: 1 or the mutant further comprises a LNA modification at any one or more of the nucleotides other than the 3 nucleotides from the 5’ end and 3 nucleotides from the 3’ end.

3. The oligonucleotide of claim 1 or 2, wherein, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive nucleotides from the 5’ end and / or 3, 4, 5, 6, 7, 8, 9, or 10 consecutive nucleotides from the 3’ end of the nucleotide sequence as set forth in SEQ ID NO: 1 or the mutant comprise a LNA modification.

4. The oligonucleotide of any one of claims 1-3, wherein, The 1st, 2nd, and 3rd nucleotides from the 5’ end and the 1st, 2nd, and 3rd nucleotides from the 3’ end of the nucleotide sequence as set forth in SEQ ID NO: 1 or the mutant comprise a LNA modification.

5. The oligonucleotide of any one of claims 1-4, wherein, The 1st, 2nd, 3rd nucleotides from the 5’ end and the 1st, 2nd, and 3rd nucleotides from the 3’ end of the nucleotide sequence as set forth in SEQ ID NO: 1 or the mutant are LNA modified nucleotides.

6. The oligonucleotide of any one of claims 1-5, wherein, The LNA modification is one or more modifications selected from the group consisting of a methylenoxy (4’-CH2-O-2’) LNA modification (e.g., an alpha-L-methylenoxy (4’-CH2-O-2’) LNA modification, a beta-D-methylenoxy (4’-CH2-O-2’) LNA modification), an ethylenoxy (4’-(CH2)2-O-2’) LNA modification, a methylenoxyamino (4’-CH2-O-N(R)-2’) LNA modification, and a methyleneaminooxy (4’-CH2-N(R)-O-2’) LNA modification.

7. The oligonucleotide of any one of the preceding claims, wherein, The 4th through 17th nucleotides from the 5’ end of the nucleotide sequence as set forth in SEQ ID NO: 1 are each a deoxyribonucleoside.

8. The oligonucleotide of any one of the preceding claims, further comprising at least one additional modification.

9. The oligonucleotide of claim 8, wherein the additional modification is selected from the group consisting of a 2’-O-methyl (Me) modification, a 2’-O-ethyl modification, a 2’-O-methoxyethyl (MOE) modification, a 2’-F modification, and combinations thereof.

10. The oligonucleotide of any one of the preceding claims, wherein the internucleoside linkage between at least two adjacent nucleosides or between all nucleosides is a phosphorothioate linkage.

Citation Information

Patent Citations

  • Lipid formulation

    US20100324120A1

  • Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer

    US5976567A

  • Methods for encapsulating plasmids in lipid bilayers

    US5981501A

  • Methods for encapsulating plasmids in lipid bilayers

    US6534484B1

  • Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer

    WO1996040964A2