Dsrna for preventing and treating liriomyza trifolii and pesticide composite thereof

By designing dsRNA targeting LtCht2 and loading it onto SPc star-shaped cationic nanocarriers, the problems of easy degradation of dsRNA on plant leaf surfaces and inappropriate target gene selection were solved, thus achieving efficient control of clover leafminer larvae.

CN121065189BActive Publication Date: 2026-02-24CHINA AGRI UNIV SANYA RES INST
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511613210.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-06
Publication Date
2026-02-24
Estimated Expiration
2045-11-06

AI Technical Summary

Technical Problem

Existing technologies have difficulty effectively penetrating the cuticle of plant leaves and entering the mesophyll tissue, which leads to the easy degradation of dsRNA when exposed in the field. Furthermore, improper selection of target genes can result in the silencing of non-target genes, making the effectiveness of RNAi technology in controlling clover leafminer unstable.

Method used

Designing dsRNA targeting LtCht2 and loading it onto SPc star-shaped cationic nanocarriers to form a nanocomplex enhances the stability and permeability of the dsRNA, enabling it to penetrate the leaf cuticle and specifically cleave LtCht2 mRNA within the larvae, thus blocking larval pupation and emergence.

Benefits of technology

It significantly improved the stability and permeability of dsRNA, enhanced the control effect on clover leafminer larvae, and effectively controlled the population size.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121065189B_ABST
    Figure CN121065189B_ABST
Patent Text Reader

Abstract

The application provides a dsRNA for preventing and treating Liriomyza trifolii and a pesticide compound thereof, wherein the pesticide compound is formed by mixing the dsRNA and SPc star cationic nanocarriers in a mass ratio of 1:1, and a nano platform is formed by self-assembly for targeted delivery of double-stranded RNA (dsRNA). The compound provided by the application can significantly reduce the degradation rate of the dsRNA in the surface environment of the plant leaves, can penetrate the cuticle of the plant leaves and enter the mesophyll tissue, can be ingested by the larvae that feed in the interior of the leaves, and can specifically cut LtCht2 mRNA through the RNA interference pathway in the larvae, cause chitin metabolism disorder, block the normal pupation and emergence of the larvae, and finally achieve the purpose of controlling the population of Liriomyza trifolii.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of pest control technology, and in particular relates to a dsRNA and its pesticide complex for controlling clover leafminer. Background Technology

[0002] Clover leafminer (Liriomyza trifolii) Belongs to the order Diptera (Diptera) Leafminer family (Agromyzidae) This insect is an important global invasive pest. First discovered in North America, it has gradually spread with global agricultural trade and the movement of plant materials, and is now widely distributed in more than 80 countries and regions across Asia, Europe, Africa, and Oceania. Since its first record in Guangdong, China in 2005, it has rapidly spread to South and East China, significantly impacting both greenhouse agriculture and open-field crops.

[0003] The larvae of the clover leafminer primarily feed by burrowing into the leaves of their host plants. They create distinct white tunnels within the leaf tissue, weakening the leaves' photosynthetic capacity and leading to stunted growth, reduced yield, and decreased commercial value. In severe infestations, large areas of the host crop's leaves turn yellow and wither, causing significant losses. This insect has a very wide host range, damaging hundreds of crops across more than twenty plant families, including legumes, solanaceae, asteraceae, and cucurbitaceae. It is particularly harmful to vegetables, flowers, legumes, and ornamental plants, and is therefore listed as one of the key transnational quarantine pests to be controlled in agricultural production.

[0004] In agricultural production practices, chemical pesticides are currently the main means of controlling clover leafminer flies. Commonly used agents include indoxacarb. (indoxacarb) Pyrethroids (pyrethroids) avermectin (avermectins) These pesticides, through contact or stomach poison action, can effectively reduce the population of pests in the field and, to some extent, protect crops from damage. With the development of pesticide science, chemical control remains one of the important measures to ensure agricultural yields. However, while chemical pesticides can suppress pest populations in the short term, long-term, large-scale reliance on pesticides with similar mechanisms of action leads to pesticide resistance in pest populations. Simultaneously, pesticide residues accumulate in the environment and migrate through the food chain, causing poisoning of non-target organisms and pollution of the ecosystem.

[0005] With advancements in molecular biology and modern entomology, RNA interference (RNAi) technology has gradually become an important research direction in the field of molecular pest control. RNAi is a conserved gene silencing mechanism mediated by double-stranded RNA (dsRNA). By guiding the degradation of specific mRNAs, it can achieve specific silencing of target genes. In insects, RNAi can interfere with the normal physiological processes of pests and even lead to their death by inhibiting the function of genes closely related to growth, development, reproduction, and survival. RNAi technology has been applied not only in the model insect *Drosophila melanogaster*. (Drosophila melanogaster) It has been extensively studied in mosquitoes and is gradually being applied to the exploration of agricultural pest control, and is widely regarded as an important development direction for the new generation of green pesticides.

[0006] However, RNA interference (RNAi) as a molecular control method is limited in many ways in practical applications. For example, double-stranded RNA (dsRNA) is rapidly degraded in the field due to ultraviolet radiation, high temperature, microorganisms, and exogenous nucleases, making it difficult to maintain stability. Furthermore, its macromolecular structure is hindered by the plant cuticle, wax layer, and trichomes, resulting in difficulty in effectively entering the mesophyll tissue and achieving systemic transport. In particular, larvae that feed inside leaves cannot ingest it through conventional spraying. In insects, exogenous dsRNA needs to cross the body wall or intestinal epithelium. However, due to the presence of nucleases in the intestinal lumen and hemolymph and the action of intracellular somatic-lysosomal pathways, the molecules are often degraded or retained and insufficiently transported. Differences in response among different insect groups and developmental stages also make the silencing effect unstable. If the selection of target genes does not fully consider sequence specificity and population genetic differences, it can easily lead to the silencing of non-target genes. Summary of the Invention

[0007] In view of this, the purpose of this invention is to provide a dsRNA and its pesticide complex for controlling clover leafminer. The formed complex can significantly reduce the degradation rate of dsRNA on the surface of plant leaves, penetrate the cuticle of plant leaves and enter the mesophyll tissue, allowing larvae feeding inside the leaves to ingest it. Through targeted design... LtCht2 The dsRNA in larvae can specifically cleave [the target RNA] via the RNA interference pathway. LtCht2 mRNA is used to disrupt chitin metabolism, thereby blocking the normal pupation and emergence of larvae, ultimately achieving the goal of controlling the population of clover leafminer.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] The first aspect of the present invention is to provide a method for the production of clover leafminer flies. LtCht2 The dsRNA transcribed from the target gene region of the gene controls the clover leafminer. LtCht2 The dsRNA is a double-stranded RNA, consisting of a sense strand and an antisense strand. The nucleotide sequence of the sense strand is shown in SEQ ID. No. 1, and the nucleotide sequence of the antisense strand is the reverse complementary sequence of SEQ ID. No. 1.

[0010] The positive strand nucleotide sequence of the dsRNA shown in SEQ ID. No. 1 is as follows:

[0011] AACAUGAGCUGCAGGAGUUAUGAUCUGGUGUGGACACGGAUGAUUUUCGUGGGAAUUGCUUUACUCCCACGGAUACCUAUGCTGACUACAAAUAUCAGCCAACAAGUCGGCGUACAAAUUUCACCAAUUAUGUGCUGUUACGUACAGUUAAUGAAGCCACAGUGUUAGCAUUGGAGGCGAUUAGCAAUG AUUUCAAUCCGGAUACCAACUUUGAUAAUAAAUUCAGCUCAACAGAGUCUACUUCGACUGAUGGCAACCGCAUCAUGGUGAUAAUGGUGAUAAAAAUGUGAUUGAUGAUACUAUGAAUGAAAAUACCACACGGCACAAUAUACGAUAGAAAGACUUCGGCUGGUAAUAUGCUGCAAACUACGCCCAUAGCAU

[0012] A second aspect of the present invention provides a target gene segment for controlling the clover leafminer, said target gene segment being a target gene segment of the clover leafminer. Cht2 The target gene segment of the gene has the sequence of the positive strand of its double-stranded DNA as shown in SEQ ID No. 2.

[0013] The nucleotide sequence shown in SEQ ID. NO.2 is as follows:

[0014] AACATGAGCTCGCAGGAGTTATGATCTGGTCTGTGGACACGGATGATTTTCGTGGGAATTGCTTTACTCCCACGGATACCTATGCTGACTACAAATATCAGCCAACAAGTCGGCGTACAAATTTCACCAATTATGTGCTGTTACGTACAGTTAATGAAGCCACAGTGTTAGCATTGGAGGCGATTAGCAATG ATTTCAATCCGGATAACCAACTTTGATAATAAATTCAGCTCAACAGAGTCTACTTCGACTGATGGCAACCGCGATCATGGTGATAATGGTGATAAAAATGTGATTGATGATACTATGAACGAAATACCACACGGCACAATATACGATAGAAAGACTTCGGCTGGTAATATGCTGCAACTTACGCCCATAGCAT

[0015] A third aspect of the present invention is to provide an RNA pesticide complex for controlling clover leafminer, the RNA pesticide complex comprising the dsRNA.

[0016] The dsRNA is prepared by in vitro transcription or in vivo vector expression; the in vitro transcription method includes the following steps: PCR amplification using primers carrying the T7 promoter sequence. LtCht2 The gene fragment, using the amplification product as a template, is transcribed to synthesize dsCht2.

[0017] In one alternative embodiment, the RNA pesticide complex further includes a nanocarrier.

[0018] In one alternative embodiment, the nanocarrier is an SPc star-shaped cation nanocarrier.

[0019] In one alternative embodiment, the mass ratio of the dsRNA to the SPc star-shaped cationic nanocarrier is 1:1.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] This invention identifies target genes that play a crucial role in the pupation and emergence processes of clover leafminer larvae. LtCht2 (Chitinase 2), through the design and synthesis of targeted LtCht2 The dsRNA, through the RNA interference pathway in the larvae, can specifically cleave the dsRNA in the larvae of the clover leafminer. LtCht2mRNA (i.e., specifically silencing the gene) leads to chitin metabolism disorder, which can effectively block the normal pupation and emergence of larvae, ultimately achieving the goal of controlling the clover leafminer population; by loading dsRNA onto a nanocarrier to form a nanocomposite with a smaller particle size, the dsRNA can be effectively protected from field ultraviolet rays, high temperatures and nuclease degradation, which can effectively improve the stability and permeability of dsRNA in the field, allowing dsRNA to penetrate the cuticle of plant leaves and enter the mesophyll tissue, so that larvae feeding inside the leaves can ingest it, thus improving the control effect. Attached Figure Description

[0022] Figure 1 This is a particle size distribution diagram of the SPc-dsCht2 nanocomposite material of the present invention;

[0023] Figure 2 The results of gel retardation electrophoresis of the SPc-dsCht2 nanocomposite material of this invention are shown below.

[0024] Figure 3 This invention relates to the effects of the SPc-dsCht2 nanocomposite material on the silencing efficiency of target genes and development. Detailed Implementation

[0025] The present invention will be further illustrated below with reference to embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0026] Example 1 Clover leafminer LtCht2 Synthesis of dsRNA in genes

[0027] I. Clover leafminer tested

[0028] Trifoliate leafminer ( Liriomyza trifolii ) populations under controlled conditions in cowpea ( Vigna unguiculata Rearing on plants: Temperature 25 ± 1℃, relative humidity 65 ± 5%, photoperiod of 16 hours light, 8 hours darkness. Larvae, pupae, and adults were collected at specific developmental stages for subsequent experiments. Healthy cowpea plants were cultivated in a greenhouse or grow box under the same conditions, with regular watering to maintain soil moisture and ensure normal growth. Leaf spraying tests and stability experiments were conducted using plants at the 3-4 true leaf stage.

[0029] II. Synthesis of dsRNA

[0030] Total RNA was extracted from larvae of the clover leafminer using the VeZol Reagent kit (R411-01, Novizumi Biotechnology Co., Ltd., Nanjing). cDNA was synthesized using the HiScript III 1st Strand cDNA Synthesis Kit (R312-01, Novizumi Biotechnology Co., Ltd., Nanjing). Clover leafminer larvae were obtained from the Insectbase database. LtCht2 Primers containing the T7 promoter were designed based on the coding region sequence of the gene (number Ltri005460.1), and primers for dseGFP synthesis were also designed. Using these primers (primer sequences are shown in Table 1), PCR amplification was performed using *Leymus chinensis* cDNA (template for amplifying dsCht2) and a plasmid containing the eGFP gene (template for amplifying dseGFP), respectively. The PCR products were verified by agarose gel electrophoresis and then purified. Using the purified PCR products as templates, dsRNA was synthesized and purified in vitro according to the instructions of the T7 RNAiTranscription Kit (TR102-01, Nanjing Novizan Biotechnology Co., Ltd., Nanjing). dsRNA quality was assessed by 1% agarose gel electrophoresis, and dsRNA concentration was measured using a micro-UV spectrophotometer. The aliquots were then stored at -80℃.

[0031] The dsRNA synthesized using this method includes two types: one is dseGFP, which serves as a control group and targets the non-endogenous gene enhancing green fluorescent protein eGFP of the clover leafminer. This dsRNA has no interference effect on the clover leafminer's own genes and is used to compare RNAi efficiency. The other group is the dsCht2 treatment group, which targets the endogenous gene of the clover leafminer. LtCht2 The dsRNA sequence is shown in SEQ ID. No. 1. The synthesis methods for both groups of dsRNA are the same, differing only in the primers and template DNA used. The primer sequences used for the dseGFP and dsCht2 groups are detailed in Table 1. The dsRNA of the eGFP gene is double-stranded, consisting of a sense strand and an antisense strand. The nucleotide sequence of the sense strand is shown in SEQ ID. No. 3, and the nucleotide sequence of the antisense strand is the reverse complementary sequence of SEQ ID. No. 3. The target gene region of the eGFP gene has a double-stranded DNA sense strand sequence shown in SEQ ID. No. 4.

[0032] The nucleotide sequence described in SEQ ID. No. 3 is as follows:

[0033] GGCCACAAGUUCAGCGTGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAUGCUUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAAUUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAAACGCAUCGAGCUGGAGGGCAUCGACUUCAAGGAGGACGGCAAUAUCCUGGGGCACAAGCUGGAGUACAAUUACAACAGCCACAACGUCAUAUCAUGGCCGACAAGCAGAAGAACGGCGUCAAGGUGAAC

[0034] Among them, the nucleotide sequence described in SEQ ID.No.4 is as follows:

[0035] GGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAAC

[0036]

[0037] Example 2 Preparation and characterization of SPc-dsRNA (SPc-dsCht2) pesticide complex

[0038] I. Preparation of pesticide complexes

[0039] Take a 2 μg / μL dsCht2 solution and add an equal volume of 2 μg / μL SPc solution; let it stand at room temperature (25℃) for 15 min to allow dsCht2 and SPc to self-assemble into a nanocomposite SPc-dsCht2.

[0040] It should be noted that the specific preparation method of SPc star-shaped cation nanocarriers is described in patent document CN108794710B, and will not be explained in detail here.

[0041] II. Particle Size Measurement

[0042] (I) Experimental Procedure

[0043] To preliminarily characterize the physicochemical properties of SPc nanocomposites, dynamic light scattering (DLS) was used to determine the particle size variations in different treatment groups. Two treatment groups were set up using dsCht2 as a template:

[0044] (1) dsCht2 group (naked dsRNA control);

[0045] (2) dsCht2+SPc group (SPc-dsCht2 complex).

[0046] The particle size distribution of each group of samples was analyzed to evaluate the effect of SPc nanomaterials binding with dsRNA on particle properties.

[0047] (II) Experimental Results and Analysis

[0048] The results are as follows Figure 1 As shown, particle size analysis results indicate that compared with dsCht2 and unloaded SPc nanoparticles, the particle size of SPc combined with dsCht2 is significantly increased, indicating that SPc and dsCht2 have successfully combined to form nanoparticles with a particle size of approximately 238 nm.

[0049] III. Gel Retention Electrophoresis Experiment

[0050] (I) Experimental Procedure

[0051] To further verify the successful formation of the SPc nanocarrier and dsCht2 complex, gel retardation assay was used. First, dseGFP and SPc were mixed at a 1:1 mass ratio and allowed to stand at room temperature for 15 min to promote the formation of the SPc-dseGFP complex. Then, equal volumes of samples (SPc-dseGFP and SPc-dsCht2) were subjected to 1% agarose gel electrophoresis at the same voltage and using nucleic acid dyes for banding. The naked dsRNA group served as a control to observe the normal migration behavior of unbound dsRNA.

[0052] (II) Experimental Results and Analysis

[0053] The results are as follows Figure 2 As shown, naked dsRNA [dsRNA (dseGFP) and dsRNA (dsCht2)] migrates clearly in the agarose gel, with a band visible at approximately 500 bp. However, when dsRNA (dseGFP and dsCht2) are complexed with SPc respectively, their band migration is significantly weakened and they remain at the sample well, indicating that dsRNA and SPc form a stable complex structure. After complexation, the surface charge of the particles is partially neutralized, thereby reducing their migration ability in the gel.

[0054] Different dsRNA sequences [dsRNA (dseGFP) and dsRNA (dsCht2)] exhibited similar band retention after binding to SPc, indicating that the binding of SPc nanomaterials to dsRNA is universal. This result verifies the successful construction of the complex and lays the foundation for subsequent delivery and interference experiments.

[0055] Example 3 Bioactivity determination of SPc-dsCht2 nanocomposite

[0056] I. Experimental Procedure

[0057] To further verify the effects of the SPc-dsCht2 nanocomposite on the silencing effect of target genes and the developmental phenotype of insects, this experiment will target the gene... LtCht2 The dsRNA (dsCht2) was prepared in two treatment forms, with SPc-dseGFP used as a negative control group.

[0058] (1) dsRNA (dsCht2) group, that is, dsRNA dissolved in ddH2O.

[0059] (2) SPc-dsCht2 complex, which is to mix dsRNA (dsCht2) with SPc nanomaterials in a 1:1 ratio to form a stable nanocomposite.

[0060] (3) SPc-dseGFP complex, which is to mix dsRNA (dseGFP) with SPc nanomaterials in a 1:1 ratio to form a stable nanocomposite.

[0061] Subsequently, the three treatments were applied to foliar leafminer larvae via foliar spraying, with the SPc-dseGFP treatment group serving as a negative control. Samples were collected at predetermined time points after treatment, and the transcriptional level of the target gene was detected using qRT-PCR. Developmental indicators such as pupation rate, emergence rate, and emergence time were recorded to evaluate the gene silencing effect and its biological impact.

[0062] II. Experimental Results and Analysis

[0063] like Figure 3 As shown in Figure A, the expression levels of target genes in the SPc-dsCht2 group were significantly lower than those in the dsRNA (dsCht2) group and the SPc-dseGFP group. This indicates that SPc-dsCht2 nanocomposites can enhance gene silencing efficiency.

[0064] like Figure 3 As shown in Figures B and C, the pupation rate and eclosion rate of the SPc-dsCht2 group were significantly lower than those of the dsRNA (dsCht2) group and the SPc-dseGFP group. This indicates that gene silencing has a significant inhibitory effect on insect development; while the effects of the dsRNA (dsCht2) group and the SPc-dseGFP group are relatively weak.

[0065] like Figure 3 As shown in Figure D, the eclosion time of the SPc-dsCht2 group was significantly prolonged compared to the dsRNA (dsCht2) group and the SPc-dseGFP group. This further demonstrates that the SPc-dsCht2 group has stronger biological activity and a more durable interference effect.

[0066] Based on the above indicators, the SPc-dsCht2 nanocomposite can effectively improve the interference efficiency of dsRNA on the genes of the clover leafminer fly, thereby enhancing the phenotypic effect.

[0067] Although the present invention has been described using the above preferred embodiments, it is not intended to limit the scope of protection of the present invention. Any changes and modifications made by those skilled in the art to the above embodiments without departing from the spirit and scope of the present invention shall still fall within the scope of protection of the present invention.

Claims

1. A dsRNA for controlling clover leafminer, characterized in that, The dsRNA is a double-stranded RNA, consisting of a sense strand and an antisense strand. The nucleotide sequence of the sense strand is shown in SEQ ID. No. 1, and the nucleotide sequence of the antisense strand is the reverse complementary sequence of SEQ ID. No.

1.

2. An RNA pesticide complex for controlling clover leafminer, characterized in that, The RNA pesticide complex includes the dsRNA of claim 1.

3. The RNA pesticide complex for controlling clover leafminer according to claim 2, characterized in that, The RNA pesticide complex also includes a nanocarrier.

Citation Information

Patent Citations

  • A star-shaped polymer, its preparation method and application

    CN108794710B

  • Gene silencing technology-based lethal gene fragment Chitinase 7 of laodelphax striatellus and dsRNA (double-stranded RNA) thereof

    CN102220341A

  • Method for inhibiting target gene expression by soaking dsRNA (double-stranded ribonucleic acid) in pre-pupal stage of liriomyza trifoliata

    CN115992182A