Preparation method and application of nanocrystallization preparation for preventing and treating Chinese pumpkin leaf curl virus on muskmelon

Abstract

The invention relates to the technical field of agricultural biology, and particularly provides a preparation method and application of a nanocrystallization preparation for preventing and treating Chinese pumpkin leaf curl virus on muskmelons. Based on an RNAi interference technology, an efficient target gene region DNA-A-AV2 for inhibiting virus infection is screened, corresponding dsRNA is induced and synthesized, zinc oxide (ZnO) is used for loading and then is delivered into a plant body, the stability of the dsRNA is improved, long-acting slow release is realized, and the prevention and treatment effect of the dsRNA is enhanced. Experiments show that the nano pesticide can effectively inhibit replication and diffusion of viruses and reduce the content of the viruses. Compared with traditional chemical agents and conventional breeding, the method has irreplaceable advantages in pertinence, safety and adaptability, and meets the requirements of current agriculture for'precision 'and'green'.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of agricultural biotechnology, and relates to a preparation method and application of a nano-formulation for preventing and treating Squash leaf curl China virus on melon. BACKGROUND

[0002] Squash leaf curl China virus (SLCCNV) is a newly emerging cucurbit crop virus in Asia, belonging to the genus Begomovirus of the family Geminiviridae, and is transmitted by the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae). Bemisia tabaci The two genomic components of SLCCNV are designated DNA-A and DNA-B. DNA-A contains six open reading frames (ORFs), including two virion-sense ORFs (AV1 and AV2) and four complementary-sense ORFs (AC1, AC2, AC3 and AC4); DNA-B contains two ORFs, BV1 and BC1.

[0003] The prevention and treatment of SLCCNV currently mainly relies on integrated pest and disease management (IPM) and chemical agents, and there is no widely available disease-resistant variety. As of now, the prevention and treatment mainly uses virus-free seedlings, eliminates the introduction of infected seedlings from areas where SLCCNV or whiteflies exist, sets up mulch film or ground film, isolates whiteflies during seedling stage, removes field residues as soon as possible after harvesting, implements crop rotation, and timely changes the use of drugs during the key period of rotation to reduce the transmission of viruses in the soil. However, the limitations of the current prevention and treatment methods are that the flexibility of cultivation management is not enough, the prevention and control effect is easily disturbed by the outside world, and the labor cost is high. The use of chemical pesticides not only leads to the development of whitefly resistance to drugs, but also aggravates the harm of crop pesticide pollution to human health and disrupts the ecological balance of farmland.

[0004] As a small-molecule RNA-mediated gene silencing mechanism, RNAi technology has triggered revolutionary breakthroughs in the field of life sciences since its discovery. The core of the antiviral effect of RNAi technology is "precise silencing", which is the core advantage that distinguishes it from traditional antiviral methods. It is a truly green and environmentally friendly method for preventing and treating viruses, and has promoted the development of many fields such as agricultural antiviral research, virus mechanism research, and antiviral drug research and development. However, the poor stability and short timeliness of dsRNA in the natural environment have become the key problems restricting the wide application and development of RNAi technology in the field of agricultural antiviral research.

[0005] In view of the fact that dsRNA is easily degraded in the natural environment, using nano-carriers as the delivery medium of dsRNA has become a hot research direction. At present, various nano-carriers such as metal-organic framework materials (MOF), zinc oxide (ZnO), chitosan (CSNPs), layered double hydroxide (LDH), and lipid nanoparticles (LNP) have been confirmed to improve the stability and delivery efficiency of dsRNA. Among them, ZnO loaded with dsRNA and applied to the leaves can significantly increase the stability and timeliness of dsRNA, shield nucleases, effectively inhibit the degradation of dsRNA, and enhance the efficiency of plants absorbing dsRNA, thereby effectively enhancing the effect of plants resisting viruses. In addition, the addition of nano-carriers effectively promotes the endocytosis of endosome escape, enhances the strength of gene silencing, and also realizes the efficient delivery of dsRNA.

[0006] Based on the above, the present application develops a nano-pesticide specifically targeting the genomic sequence of SLCCNV, in order to achieve precise, green and efficient prevention and control of SLCCNV, and enhance the disease resistance of melon plants. SUMMARY

[0007] The present application develops a nano-pesticide specifically targeting the genomic sequence of SLCCNV, in order to achieve precise, green and efficient prevention and control of SLCCNV, and enhance the disease resistance of melon plants.

[0008] One of the purposes of the present application is to provide one or several target gene fragments capable of precisely and efficiently preventing and controlling viruses.

[0009] The second purpose of the present application is to transcribe the target gene fragments to obtain the corresponding dsRNA.

[0010] The third purpose of the present application is to combine the dsRNA of the transcribed target gene fragments with nano-carriers to prepare a nano-pesticide.

[0011] The above purposes of the present application are achieved by the following technical solutions: The first aspect of the present application provides a target gene segment for preventing and controlling SLCCNV, which is selected from the DNA-A-AV2 gene of the SLCCNV genome, and the nucleotide sequence is shown as SEQ ID. NO. 1.

[0012] The second aspect of the present application provides a carrier containing the above-mentioned target gene segment.

[0013] Further, the carrier is an RNA interference carrier, or the carrier is a gene expression carrier for transcribing the target gene segment to obtain dsRNA.

[0014] As a preferred embodiment of the present application, the RNA interference vector can be an L4440 double T7 promoter expression vector. The vector has carbenicillin resistance, has two T7 promoters, and a multiple cloning site between the two T7 promoters. The target gene fragment is inserted between the two T7 promoters to construct a recombinant vector, which is transformed into an E. coli strain HT115 (DE3) expressing T7 RNA polymerase. The strain lacks RNase III, which can avoid the degradation of dsRNA. The T7 promoter is induced by IPTG (isopropyl-beta-D-thiogalactoside) to start transcription. The left and right T7 promoters respectively transcribe the sense and antisense strands of the target gene fragment, and the two RNA strands form dsRNA through base complementary pairing. The dsRNA can be applied to melons to prevent and control viruses.

[0015] The third aspect of the present application provides a dsRNA transcribed from the target gene segment described by the nucleotide sequence of SEQ ID. NO. 1, which consists of the nucleotide sequence of SEQ ID NO. 2 and the nucleotide sequence reverse complementary to the nucleotide sequence of SEQ ID NO. 2.

[0016] The fourth aspect of the present application provides a dsRNA nano-formulation for preventing and controlling SLCCNV, which consists of the above-mentioned dsRNA and a nano-carrier; the nano-carrier is zinc oxide. The nano-carrier is used as a delivery medium and applied to the leaves of melons, which can effectively improve the stability and long-acting sustained release of the dsRNA.

[0017] As a specific and optimal embodiment of the present application, the mass ratio of dsRNA to different nano-carriers is different, and the mass ratio of dsRNA to ZnO is 1:30. The above-mentioned ratio can ensure that the nano-carrier completely loads the dsRNA, and is the best ratio in terms of cost-effectiveness.

[0018] The fifth aspect of the present application provides the use of the above-mentioned target gene segment, the above-mentioned dsRNA, or the above-mentioned dsRNA nano-formulation in preventing and controlling the Chinese pumpkin curly leaf virus on melons.

[0019] As a reference implementation method of the present application, the present application provides a specific operation method for applying the above-mentioned nano-pesticide to the leaves of melons to prevent and control SLCCNV: (1) First, the high-efficiency target gene fragment of the SLCCNV genome is screened. By consulting the literature and comparing the conserved sequences of the virus on the NCBI website, SLCCNV-DNA-A-AV2 is finally locked.

[0020] (2) using the above RNA interference vector induces the target gene fragment to transcribe the corresponding dsRNA.

[0021] (3) The dsRNA is compounded with the nano-carrier according to the optimal matching ratio, and the nano-pesticide is formed to increase the stability of the dsRNA.

[0022] (4) The nano-pesticide is applied to the melon leaves by rubbing inoculation, and the nano-pesticide is absorbed into the plant cells by the endocytosis of the plant cells, at this time, the dsRNA can play the precise targeting role, interferes with the normal expression of the SLCCNV gene, and thus the virus prevention and treatment effect is achieved.

[0023] Detailed description of the overall technical scheme of the application In order to obtain the target gene fragment with the best virus prevention and treatment effect, according to the SLCCNV genome sequence, a pair of specific primers is designed to amplify the above genomic fragments, so that the sequence of the target fragment is introduced into Hind Ⅲ and Sac Ⅰ two restriction enzyme cleavage sites, so as to be connected with the L4440 vector later, the target fragment is amplified, electrophoresed, and the gel is recovered to obtain the DNA-A-AV2 gene fragment of the SLCCNV genome, and the nucleotide sequence corresponds to SEQ ID NO. 1. After the L4440 vector is cut by Hind Ⅲ and Sac Ⅰ two restriction enzymes, the above plurality of target fragments are respectively cloned into the cut vector, and thus the RNA interference vector is constructed. The constructed vector is transferred into the competent E. coli (DH5α), and is coated on the LB solid culture plate containing carbenicillin resistance. Single colony is picked, and PCR positive detection is carried out. The positive bacteria sample is subjected to DNA sequencing, and the plasmid of the bacteria sample with correct sequencing result is extracted and transferred into HT115 (DE3) for subsequent induction and expression of dsRNA.

[0024] The application utilizes the L4440 expression vector, and the vector has two T7 promoters which can efficiently start transcription. The target gene fragment is inserted between the two T7 promoters, under the induction of IPTG (about 0.6 mmol / L), the T7 RNA polymerase drives the bidirectional transcription of the two T7 promoters, and the two single-stranded RNAs transcribed out form the dsRNA of the target gene fragment under the action of base complementary pairing. Since the E. coli HT115 (DE3) strain lacks RNase Ⅲ enzyme activity, the induced dsRNA is not degraded by the RNase enzyme, and the yield of the dsRNA is ensured.

[0025] After the RNA interference vector is transformed into E. coli HT115 (DE3), a strain with correct sequencing result is selected, inoculated into LB liquid medium containing tetracycline resistance, and large-scale cultured under the induction of IPTG. The total RNA of the strain is extracted by using the Trizol method, the RNA is treated by double enzyme digestion of DNase I and S1 Nuclease, and the integrity of the dsRNA is detected by agarose gel electrophoresis. The results show that the band of the dsRNA is clear and complete, and meets the expected size.

[0026] The indoor control effect evaluation results show that under the condition that the mass ratio of ZnO and dsRNA-AV2 is 30:1, the nano-preparation prepared by combination has the best effect of preventing and treating SLCCNV, and is better than other combination types. Under this mass ratio, the nano-carrier can completely adsorb the dsRNA, significantly enhances the stability of the dsRNA on the plant surface, solves the problem of rapid degradation of the dsRNA, realizes long-acting and slow-release of the dsRNA, and continuously acts on the plant. When the mass ratio is lower than this condition, the control effect slightly decreases.

[0027] The beneficial effects of the application are as follows: (1) Targeting precision and high efficiency: the virus core pathogenic gene DNA-A-AV2 is taken as a target, the virus gene is precisely silenced through the dsRNA, the virus replication and spread are significantly inhibited, and the control effect is better than that of naked dsRNA.

[0028] (2) Breakthrough of technical bottleneck: the ZnO nano-carrier can shield the nuclease from degrading the dsRNA, realizes long-acting and slow-release, can still inhibit the virus after spraying for 14 days, promotes the plant absorption, and improves the gene silencing efficiency, and the best 1:30 ratio balances the effect and cost.

[0029] (3) Adaptation to agricultural application: the nano-preparation can be applied by spraying and other conventional methods, does not need complex equipment, adapts to the existing cultivation process, and makes up for the deficiencies of traditional cultivation management (high cost and poor flexibility) and chemical pesticides (pesticide resistance and pollution).

[0030] (4) Green, safe and environmentally friendly: the components contain biological dsRNA, have no pesticide residue risk, do not harm human health, have strong targeting property, do not kill beneficial organisms, protect the farmland ecology, and meet the needs of green agriculture. BRIEF DESCRIPTION OF DRAWINGS

[0031] Figure 1 Different concentrations of IPTG (mmol / L) are used to induce the dsRNA; M: DL2000; 1. 0 mmol / L; 2. 0.2 mmol / L; 3. 0.4 mmol / L; 4. 0.6 mmol / L; 5. 0.8 mmol / L.

[0032] Figure 2Screening for the best ratio of dsRNA loaded on ZnO; M: DL2000; 1. dsRNA; 2. ZnO; 3-10: dsRNA and ZnO were loaded with the mass ratio of 1:1; 1:5; 1:10; 1:15; 1:20; 1:25; 1:30; 1:35, respectively.

[0033] Figure 3 Western-blot analysis of the expression of viral CP in leaves after 14 days of spraying with nano-pesticide.

[0034] Figure 4 Column chart analysis of the expression of viral CP in leaves after 14 days of spraying with nano-pesticide. DETAILED DESCRIPTION

[0035] The specific embodiments of the present application are described below to facilitate the understanding of the present application for those skilled in the art, but it should be clear that the present application is not limited to the scope of the specific embodiments, and for those skilled in the art, it is obvious that various changes are within the spirit and scope of the present application defined and determined by the appended claims, and all the inventions using the concept of the present application are within the scope of protection.

[0036] Explanation of the sequence table: SEQ ID. NO. 1: ATGAATAAAGCGGCCATTCGTATAATATTACCGAATGGCCGCGCGATTTTTTATGTGGGCCCTCGACCAATGAAATTCACGCTACATGGCTTATTTATTATGCGGGGACCATTAAATAGACTTCCGCCCCAAGTTTTGAACCACACCATGTGGGATCCACTTATGCACGAATTCCCTGAAAGTGTTCATGGTCTAAGGTGCATGCTAGCGGTGAAATATCTTCAGGAGGTGGAAAAAACATATTCTCCGGACACAGTCGGCTACGATCTTGTCCGCGATCTCATCCTAGTTCTCCGCGCAAAGAATTATGTCGAAGCGACCAGCCGATATTATCATTTCAACTCCCGCGTCGAAGGTACGCCGACGTCTCAACTTCGACAGCCCCTATGTTTCCCGTGCAGTTGTCCCCATTGCCCGCGTCACAAAGGGAAAGGCCTGGACAAACAGGCCGATGAACAGAAAACCAAAGATGTACAGGATGTATAG SEQ ID. NO. 2: AUGAAUAAAGCGGCCAUUCGUAUAAUAUUACCGAAUGGCCGCGCGAUUUUUUAUGUGGGCCCUCGACCAAUGAAAUUCACGCUACAUGGCUUAUUUAUUAUGCGGGGACCAUUAAAUAGACUUCCGCCCCAAGUUUUGAACCACACCAUGUGGGAUCCACUUAUGCACGAAUUCCCUGAAAGUGUUCAUGGUCUAAGGUGCAUGCUAGCGGUGAAAUAUCUUCAGGAGGUGGAAAAAACAUAUUCUCCGGACACAGUCGGCUACGAUCUUGUCCGCGAUCUCAUCCUAGUUCUCCGCGCAAAGAAUUAUGUCGAAGCGACCAGCCGAUAUUAUCAUUUCAACUCCCGCGUCGAAGGUACGCCGACGUCUCAACUUCGACAGCCCCUAUGUUUCCCGUGCAGUUGUCCCCAUUGCCCGCGUCACAAAGGGAAAGGCCUGGACAAACAGGCCGAUGAACAGAAAACCAAAGAUGUACAGGAUGUAUAG SEQ ID. NO. 3: TCGACGGTATCGATAAGCTTAAATATCTTCAGGAGGTGG SEQ ID. NO. 4: TATCATCGATGAATTCGAGCTCTTGGTTTTCTGTTCATCG Example 1

[0037] This example relates to amplifying target gene fragments for preventing and treating SLCCNV, inducing corresponding dsRNA, compounding nanocarriers with dsRNA at a certain mass ratio to form nanodrugs, and applying the nanodrugs to plants, and evaluating the prevention and treatment effect of the nanodrugs by detecting the content of SLCCNV in the plants.

[0038] 1.1 Materials and methods (1) Plant materials The melon variety used in the present application is Guomin 2029-25. The seeds are placed at 28℃, and germinated for two days in an environment with sufficient water and oxygen, and then transplanted into a mixture of vermiculite-nutrient soil (1:1, v / v), and cultured to the four-leaf stage under the culture conditions of light intensity 50 μmol·m⁻²·s⁻¹, photoperiod 16 h light / 8 h darkness, and temperature 27±1℃.

[0039] (2) Strains and plasmids Strains: The Escherichia coli (E. coli) strains HT115 (DE3) and DH5α used in the present application are preserved in the laboratory and used for various experimental studies. Escherichia coli ) HT115 (DE3) and DH5α are preserved in the laboratory and used for various experimental studies.

[0040] The SLCCNV infectious clone Agrobacterium with His tag is preserved in the laboratory.

[0041] (3) Preparation of related solutions LB (Luria-Bertani) medium: Tryptone 10 g / L, yeast extract 5 g / L, sodium chloride (NaCl) 10 g / L, add ddH2O to 1 L. 120℃, 20 min high temperature sterilization, room temperature storage.

[0042] 50 mg / mL carbenicillin: 0.8 L of distilled water is placed in a suitable container, and 50 g of carbenicillin sodium is added to the solution. Add distilled water to a volume of 1 L. Filter sterilize using a 0.22 μm filter. Store at -20℃ for later use.

[0043] Zinc oxide (ZnO) nano solution is preserved in the laboratory.

[0044] 1.2 Amplification of target gene fragment and construction of RNA interference vector According to the sequence of SLCCNV-DNA-A-AV2 gene, a pair of specific primers is designed, and Hind III and Sac I restriction enzyme sites are introduced at both ends of the primers, and the target gene fragment is amplified by PCR. After detection by 1% agarose gel electrophoresis, the gel is cut and recovered, and the product is purified. The specific primer information is shown in Table 1.

[0045] Table 1 Specific primer information

[0046] Use Hind III and SacI Restriction enzyme digestion of L4440 vector, after 2h enzyme digestion, the product was recovered by 1% agarose gel electrophoresis, and the product was purified to obtain linearized L4440 vector. The enzyme digestion system is shown in Table 2.

[0047] Table 2 Double enzyme digestion system

[0048] The recovered sequence product and linearized vector were connected by C115 ligase to clone the gene sequence into the linearized vector. The ligation system is shown in Table 3. The reaction was carried out at 50°C for 20 min.

[0049] Table 3 Ligation system

[0050] The ligated vector was transformed into E. coli (Escherichia coli) DH5α. E. coli The DH5α competent cells were taken out from -80°C and quickly inserted into ice. After 5 min, the bacterial mass was melted, 10 μL of the ligation product was added, and the EP tube bottom was gently mixed by hand (avoiding using gun suction). The mixture was placed in ice for 25 min. The mixture was quickly placed in ice for 2 min after 42°C water bath heat shock for 45 s. About 700 μl of sterile LB medium without antibiotics was added to the EP tube, and the mixture was mixed and recovered at 37°C, 200 rpm for 1 h. The bacterial mass was collected by centrifugation at 5000 rpm for 1 min, most of the supernatant was discarded, and the remaining supernatant was used to resuspend the bacterial mass by gentle blowing and was plated on LB medium containing the corresponding antibiotic. After the culture plate was blown dry in a clean bench, it was inverted in a 37°C incubator and cultured for at least 15 h. After single colonies grew on the culture plate, 6-8 single colonies were picked for PCR positive single colony detection. The positive results were subjected to DNA sequencing, and the plasmid of the correct sequencing result was extracted and stored at -20°C for standby.

[0051] 1.3 Transformation of E. coli (Escherichia coli) HT115 (DE3) competent cells E. coli The HT115 (DE3) competent cells were taken out from -80°C, and after the bacterial mass was dissolved, the plasmid was quickly added to the competent cells, and the mixture was placed in ice for 25 min. The mixture was immediately placed in ice for 2 min after 42°C heat shock for 45 s. About 700 μl of sterile LB medium was added to the EP tube, and the mixture was mixed and recovered at 37°C, 200 rpm for 1 h. The bacterial mass was collected by centrifugation at 5000 rpm for 1 min, most of the supernatant was discarded, and the remaining supernatant was used to resuspend the bacterial mass by gentle blowing and was plated on LB solid medium containing Amp antibiotic. After the culture plate was blown dry, the plate was sealed with a sealing film in a state of no liquid falling, and was cultured in a 37°C incubator for at least 15 h.

[0052] ​After the monoclonal colonies grow, pick the monoclonal bacteria for PCR positive detection, and the bacteria with positive detection results are subjected to DNA sequencing. The bacteria with correct sequencing results are preserved for bacteria preservation. The bacteria are stored at -80°C for standby.

[0053] 1.4 dsRNA induced expression Add 100 μL of RNAi interference vector into 5 ml of LB medium with Amp antibiotic, and place in a 37°C, 220 rpm shaker for overnight culture. Add 1-5 ml of bacteria liquid of overnight culture into 100 ml of LB medium with Amp antibiotic, and place in a 37°C, 220 rpm shaker for culture until OD ≈ 0.5. Add about 0.6 mmol / L IPTG, and place in a 25°C, 160 rpm shaker for about 8 h.

[0054] Trizol method is used to extract total RNA, and the specific steps are as follows: Collect the bacteria after 8 h induction into a 2 ml enzyme-free EP tube, centrifuge at 7500 rpm and 4°C for 2 min, discard the supernatant, add 1 ml of Trizol, vortex to mix, and stand at room temperature for 5 min. Then add 200 μL of chloroform, mix well, and stand at room temperature for 5 min. Centrifuge at 4°C and 12000 rpm for 15 min. At this time, the liquid in the EP tube is divided into three layers: the upper layer is colorless water phase, the middle layer mainly contains DNA, and the lower layer mainly contains protein. Absorb the colorless water phase in the upper layer into a new enzyme-free EP tube, add 250 μL of isopropanol, mix well, and stand at room temperature for 10 min. After centrifugation at 4°C and 12000 rpm for 10 min, discard the supernatant, wash the precipitate with 75% ethanol solution, centrifuge at 4°C and 7500 rpm for 5 min, discard the supernatant, open the EP tube cap, dry the RNA at room temperature, and then add 30 μL of enzyme-free water to dissolve the RNA.

[0055] Double enzyme digestion of RNA First, digest the RNA with DNase I, and the system is shown in Table 4. Then, digest with S1 Nuclease, and the system is shown in Table 5.

[0056] Table 4 DNase I digestion system

[0057] Table 5 S1 Nuclease purification system

[0058] 1.5 Screening of the optimal ratio of dsRNA combined with nanocarriers The target gene fragment DNA-A-AV2 of the SLCCNV genome is used to prepare dsRNA-ZnO nano-pesticide, and the migration of the prepared nano-pesticide is detected by 1% agarose gel electrophoresis, so as to judge the preparation quality of the nano-pesticide and the loading condition of the dsRNA. If the dsRNA is completely loaded by the nano-carrier, the free migration band will no longer appear in the process of gel electrophoresis. On the contrary, it indicates that the dsRNA is not completely loaded.

[0059] 1.6 Nano-pesticide effect screening After the dsRNA is loaded by ZnO at the optimal mass ratio, the nano-pesticide is applied to the leaves of the four-leaf stage melon, the SLCCNV infectious clone is injected after one day, and the system leaves are collected after 14 days, and the virus expression amount is detected by western-blot, so as to complete the stability and effectiveness screening of the nano-pesticide.

[0060] 2. Experimental results 2.1 SLCCNV high-efficiency target gene fragment amplification and RNAi interference vector construction The present application uses L4440 vector, which contains double T7 promoters, and the target gene fragment is inserted between the two T7 promoters through enzyme digestion sites. Under the induction of IPTG, the target gene fragment can be efficiently transcribed by RNA polymerase, and it is an excellent expression vector for in vitro induction and expression of dsRNA. The HT115 (DE3) strain contains tetracycline resistance and lacks RNase III enzyme activity, which helps the stability and large-scale induction of dsRNA expression.

[0061] The RNAi interference vector is constructed by using the L4440 vector plasmid through homologous recombination. Hind III and Sac After the L4440 vector is digested by I, the SLCCNV target gene fragment with good homologous arms is connected to the linearized L4440 vector by homologous recombination to construct the RNAi interference vector. After the connection product is transferred into DH5α, a single colony is picked, and whether the construction is completed is verified by PCR. After successful DNA sequencing, the correct recombinant vector plasmid is transferred into HT115 (DE3), and after successful sequencing, the dsRNA expression is induced.

[0062] IPTG induced expression of dsRNA. 5 ml of activated HT115 (DE3) bacterial solution containing recombinant vector plasmid was expanded to 100 ml culture system. The results showed that when the culture was placed at 37°C, 220 rpm shaking bed to OD ≈ 0.5, about 0.6 mmol / L IPTG was added, and the expression of dsRNA was induced for about 8 hours. The highest number of bacteria was collected for total RNA extraction. The control group used HT115 (DE3) with L4440 empty vector, and the same experimental operation was performed. The bacteria were collected and total RNA was extracted. Figure 1 ).

[0063] 2.2 Optimum ratio screening of nano-pesticide The dsRNA of SLCCNV target gene fragment was combined with ZnO nano-carrier to screen the best ratio of dsRNA and ZnO nano-carrier complex.

[0064] In order to determine the best loading ratio of dsRNA-ZnO, the loading of dsRNA-ZnO under different mass ratios was set, including dsRNA:ZnO = 1:1; 1:5; 1:10; 1:15; 1:20; 1:25; 1:30; 1:35. Naked dsRNA and ZnO were used as controls. The results showed that when the mass ratio of dsRNA to ZnO was 1:30, ZnO completely loaded dsRNA. Figure 2 ).

[0065] 2.3 Analysis of SLCCNV virus amount in melon plants and RNAi interference effect after dsRNA treatment Total protein was extracted from melon leaves, and western-blot was used to detect the expression of SLCCNV virus. Figure 3 After spraying dsRNA, the expression of key genes of SLCCNV genome was significantly reduced compared with the control without dsRNA, indicating that dsRNA had a certain significant effect on virus control and to some extent inhibited the spread of virus. It showed that the application of dsRNA and nano-carrier complex into nano-pesticide to melon leaves had inhibitory effect on virus expression.

[0066] 2.4 Persistence analysis of nano-formulation After the complex of dsRNA-AV2-ZnO was applied to the leaves of four-leaf-stage melons, SLCCNV infectious clones were injected after one day. Total protein was extracted from system leaves after 14 days, and western-blot was used to detect the expression of key virus of SLCCNV. Figure 4). Compared with the control plants, the virus expression of the plants treated with nano-pesticides was significantly reduced, and the effect was more long-lasting than that of dsRNA. This indicates that the nano-carrier can be absorbed by plants into the cell, and work together with dsRNA to fight the virus, better protect dsRNA from enzyme degradation, and significantly enhance the stability of dsRNA.

[0067] In summary, the dsRNA of the target gene fragment designed based on the SLCCNV genome has a certain control effect on SLCCNV, the nano-pesticide based on dsRNA-AV2 testing has a certain effect on preventing and treating SLCCNV, enhancing the timeliness and stability of dsRNA, and dsRNA-AV2-ZnO has better prospects in preventing and treating SLCCNV.

Claims

1. A target gene segment for controlling Cucurbita moschata leaf curl virus, characterized in that, The target gene segment is selected from the DNA-A-AV2 gene of the genome of the Chinese pumpkin curly leaf virus, the nucleotide sequence of which is shown in SEQ ID. NO.

1.

2. A vector containing the target gene segment of claim 1.

3. The carrier of claim 2, wherein, The vector is an RNA interference vector, or the vector is a gene expression vector for transcribing the target gene segment into dsRNA.

4. The dsRNA transcribed from the target gene segment of the nucleotide sequence of SEQ ID NO. 1 according to claim 1, characterized in that, The dsRNA consists of the nucleotide sequence shown in SEQ ID NO. 2 and the nucleotide sequence reverse complementary to the nucleotide shown in SEQ ID NO.

2.

5. A dsRNA nanoformulation for controlling Cucurbita moschata leaf curl virus, characterized in that, The dsRNA of claim 4 consists of a nanocarrier; the nanocarrier is zinc oxide.

6. The dsRNA nanoformulation according to claim 5, wherein, The mass ratio of dsRNA: zinc oxide is 1:

30.

7. The target gene segment of claim 1, the dsRNA of claim 4, or the nanosized preparation of the dsRNA of any one of claims 5-6 for use in the prevention and treatment of the Chinese pumpkin curly leaf virus on melon.

Images