Application of AcLAC1 gene in genetic transformation and disease resistance of nicotiana benthamiana

Abstract

The invention discloses an application of an AcLAC1 gene in genetic transformation and disease resistance of nicotiana benthamiana. The AcLAC1 gene is characterized in that a coding sequence of the AcLAC1 gene is obtained by amplifying a primer pair BG-AcLAC1: F: aGAATTCGAGCTCGGTACCCATGGATGCCTCAACAG and a primer pair BG-AcLAC1: R: GTCGACTCTAGGATCCCACATAGGGGGCAGATCTGA; when the overexpression vector is constructed, a BG-plant-express vector is adopted, the BG-plant-express vector is subjected to enzyme digestion for 30 min at 37 DEG C through restriction endonuclease Sma I for linearization, and then the BG-plant-express vector is recombined with a recovered AcLAC1 gene segment; the recombinant vector is mediated by agrobacterium tumefaciens to instantaneously transform Bensi tobacco leaves. According to the invention, nicotiana benthamiana is taken as an object, an AcLAC1 overexpression strain is constructed through an agrobacterium tumefaciens-mediated stable genetic transformation technology, and subcellular localization of AcLAC1, a regulation mechanism of lignin biosynthesis and a function of the AcLAC1 in disease resistance of nicotiana benthamiana are clarified; a theoretical basis is provided for understanding the biological function of the laccase gene, and candidate gene resources and technical support are provided for breeding of disease-resistant molecules.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological industry, especially the aspects of genetic engineering, plant disease prevention, breeding and seedling raising in bio-agriculture and related industries, and particularly relates to the application of AcLAC1 gene derived from the "Hongyang" kiwifruit variety in genetic transformation and disease resistance of Nicotiana benthamiana. BACKGROUND

[0002] Lignin, as a key component of plant secondary cell wall, not only provides mechanical support for the plant, but also forms a physical barrier to resist pathogen invasion by strengthening the cell wall structure, playing a core role in plant disease resistance defense. Laccase, as a key enzyme in lignin biosynthesis, catalyzes the oxidative polymerization of lignin monomers, and its functional research is of great significance to the analysis of plant disease resistance mechanism. Nicotiana benthamiana, as a model plant for plant pathology and gene function research, is an ideal material for studying the function of disease-resistant genes due to its high genetic transformation efficiency, sensitivity to various pathogenic bacteria (such as Pseudomonas syringae pv. tabaci), and clear genomic background, and is widely used in the analysis of plant disease resistance molecular mechanisms.

[0003] In recent years, the kiwifruit industry has been severely threatened by bacterial canker disease. Previous studies have shown that transient overexpression of kiwifruit laccase gene AcLAC1 can significantly enhance plant resistance to pathogenic bacteria, but its function in stable genetic transformation system has not been clearly defined. Nicotiana benthamiana, as a commonly used model plant, has been widely used for disease-resistant gene function verification, but lacks systematic research on AcLAC1, an exogenous laccase gene. In existing research, the subcellular localization of AcLAC1 in Nicotiana benthamiana, the regulation of lignin synthesis (such as the influence on S-type and G-type lignin monomers), and whether it can enhance the resistance of Nicotiana benthamiana to its common pathogenic bacteria (such as Pseudomonas syringae pv. tabaci) through stable transformation are key issues that have not been addressed.

[0004] Currently, in the study of disease-resistant gene function in Nicotiana benthamiana, the stable transformation system of exogenous genes is mature, but there are still deficiencies in the research on the correlation between laccase gene regulation of lignin synthesis and disease resistance: most studies focus on endogenous genes, and there is a lack of systematic analysis of the specific mechanisms of expression characteristics of heterologous laccase genes in Nicotiana benthamiana, the influence on plant growth phenotype (such as leaf thickness and stem structure), and the enhancement of disease resistance, which limits the application value of Nicotiana benthamiana as a model plant in the functional verification of heterologous disease-resistant genes.

[0005] Therefore, it is urgent to use *Nicotiana benthamiana* as the research object, construct AcLAC1 overexpression lines through Agrobacterium-mediated stable genetic transformation technology, clarify its subcellular localization, analyze its effects on lignin synthesis, plant morphology and disease resistance in *Nicotiana benthamiana*, fill the gap in the functional study of heterologous laccase genes in *Nicotiana benthamiana*, and provide theoretical and technical support for using this gene to improve the disease resistance of *Nicotiana benthamiana* and other crops. Summary of the Invention

[0006] The main objective of this invention is to provide the application of the AcLAC1 gene in the genetic transformation and disease resistance of Nicotiana benthamiana. Using Nicotiana benthamiana as the target, AcLAC1 overexpression lines were constructed through Agrobacterium-mediated stable genetic transformation technology. The subcellular localization of AcLAC1, its regulatory mechanism on lignin biosynthesis, and its function in the disease resistance of Nicotiana benthamiana were elucidated. This provides a theoretical basis for understanding the biological function of laccase genes and provides candidate gene resources and technical support for molecular breeding for disease resistance.

[0007] Based on the first major aspect of the present invention, an AcLAC1 gene is provided, which is derived from the red kiwifruit and its nucleotide sequence is shown in SEQ ID NO:1;

[0008] Furthermore, the coding sequence was obtained by amplification using primer pairs BG-AcLAC1-F: aGAATTCGAGCTCGGTACCCATGGATGCCCTCAACAG and BG-AcLAC1-R: GTCGACTCTAGAGGATCCCCACATAGGGGCAGATCTGA.

[0009] When constructing the subcellular localization vector, the pBI121-eGFP vector was used, which was linearized by restriction endonuclease SmaⅠ at 37℃ for 30 min, and then recombined with the recovered AcLAC1 gene fragment;

[0010] The recombinant vector transiently transforms tobacco leaves via Agrobacterium-mediated transformation.

[0011] As a further preferred embodiment, in the aforementioned gene, the amplified fragment obtained after amplification was recovered at a concentration of 91 ng / μL after gel electrophoresis; the linearized pBI12 vector fragment was recovered at a concentration of 15 ng / μL; during the Agrobacterium-mediated transient transformation, GV3101 competent cells were used, and the cells were treated with ice bath for 5 min, liquid nitrogen freezing for 5 min, thawing at 37°C for 5 min, and ice bath for 5 min, and then resuspended in 10 mM MgCl2 solution containing 120 μM AS to OD. 600 Approximately 0.6.

[0012] Based on the second main aspect of the present invention, an application of the AcLAC1 gene in regulating resistance to Nicotiana benthamiana is provided, comprising: constructing a BG-plant-express overexpression vector containing the AcLAC1 gene; and amplifying the target gene using primer pairs BG-AcLAC1-F: AGATTCGAGCTCGGTACCCATGGATGCCCTCAACAG and BG-AcLAC1-R: GTCGACTCTAGAGGATCCCCACATAGGGGCAGATCTGA.

[0013] Transgenic lines were obtained by transforming tobacco leaf explants with Agrobacterium GV3101, followed by co-culture and screening.

[0014] Lines with expected increases in AcLAC1 transcription levels and laccase activity were screened for disease resistance regulation.

[0015] As a further preferred embodiment, in the aforementioned application, the transgenic line was verified by PCR, and a specific band of 1362 bp could be amplified using AcLAC1-F and AcLAC1-R as primers; RT-qPCR was used for detection, with the NbEF1α gene as an internal reference, and the primers were NbEF1α-F: TACAACCCTGACAAGATCCCC and NbEF1α-R: CCAGTTTCCACACGACCAAC.

[0016] As a further preferred embodiment, in the aforementioned application, the co-culture medium contains MS 4.43 g / L, sucrose 30 g / L, 6-BA 1 mg / L, and NAA 0.1 mg / L, and is cultured in the dark at 20°C for 2 days; the screening medium is supplemented with 100 mg / L termethin and is changed every 12-15 days until resistant shoots differentiate.

[0017] As a further preferred option, in the aforementioned application, the pathogen inoculation in the disease resistance regulation uses OD... 600 Leaf injection of bacterial solution at a concentration of 0.6% was performed under the following culture conditions: 16 hours of light and 8 hours of darkness. Disease resistance was assessed by classifying the degree of leaf wilting into 0-4 disease grades.

[0018] Based on a third key aspect of the present invention, a method for genetic transformation of Nicotiana benthamiana is provided, comprising:

[0019] Seed sterilization: Tobacco Benzovia seeds were sterilized with 75% ethanol for 1 min, sterilized with 10% NaClO solution in the dark and shaken for 20 min, rinsed with sterile water 4-5 times and then sown on 1 / 2 MS medium.

[0020] Explant preparation: Leaves of 50-day-old seedlings were cut into 1×1cm explants and pre-cultured in the dark at 20℃ for 24h;

[0021] Agrobacterium infection: Agrobacterium containing the AcLAC1 recombinant vector was cultured in LB medium until OD. 600 =0.8-1.0, centrifuged at 5000 rpm for 5 min, then resuspended in MS buffer containing 100 μM acetylsyringone, and infected explants for 10 min.

[0022] As a further preferred embodiment, in the aforementioned method, the 1 / 2MS medium contains 2.3 g / L 1 / 2MS, 15 g / L sucrose, and 1.5 g / L plant gel, and the culture conditions are 16 h light / 8 h dark, with the temperature at 25°C under light conditions and 20°C under dark conditions.

[0023] Agrobacterium was initially cultured in LB liquid medium containing the corresponding antibiotics at 28°C with shaking at 230 rpm.

[0024] Furthermore, preferably, the process also includes a differentiation culture step: the infected explants are transferred to a selection medium containing 1.0 mg / L 6-BA, 0.1 mg / L NAA and 100 mg / L termethin, and cultured under light at 20°C, with the medium being changed every 12-15 days until differentiated shoots are formed.

[0025] Based on a fourth key aspect of the present invention, a method for obtaining resistance to Tobacco Benedict's disease using the AcLAC1 gene is provided, characterized in that it comprises:

[0026] Transgenic plants were obtained by using the method described in claim 7, and 2 cm high shoots were cut and transferred into rooting medium.

[0027] Rooting culture: The rooting medium contains MS 4.43 g / L, sucrose 30 g / L, NAA 0.1 mg / L, and termethin 100 mg / L. Roots will form after 15-25 days of culture.

[0028] Hardening off and transplanting: Open the cap of the culture bottle and harden off at room temperature for 1 day. After washing the roots of the culture medium, transplant them into the nutrient substrate, water them thoroughly and cover them with a transparent cover to keep them moist for 3 days.

[0029] Preferably, the rooting culture conditions are 16h light / 8h darkness, light intensity of 1000-1500 lux, and temperature of 25℃ under light conditions and 20℃ under darkness conditions; after transplanting the nutrient substrate, the culture conditions are the same photoperiod and the temperature is maintained at 25℃±2℃.

[0030] As a further preferred option, the aforementioned method also includes screening for disease-resistant strains: For transgenic plants inoculated with the pathogen, the disease index is investigated on days 10 and 15 after inoculation. The disease status of the plants is assessed and classified into disease grades based on the degree of leaf wilting. The corresponding grades are: Grade 0 = no wilting, Grade 1 = 1% - 25% leaf wilting, Grade 2 = 26% - 50% leaf wilting, Grade 3 = 51% - 75% leaf wilting, and Grade 4 = 76% - 100% leaf wilting. The disease index calculation formula is as follows:

[0031] .

[0032] Compared with existing technologies, this invention standardizes the experimental basis for gene function research by clarifying the specific amplification system of the AcLAC1 gene, the subcellular localization vector construction method (i.e., linearization and recombination of the pBI121-eGFP vector by SmaI restriction enzyme), and the Agrobacterium transient transformation conditions, thus ensuring the reliability of gene subcellular localization results.

[0033] This invention successfully obtained a transgenic line with high expression of AcLAC1 by constructing a BG-plant-express overexpression vector and combining it with Agrobacterium-mediated stable transformation technology in Nicotiana benthamiana. The effectiveness of the transformation was confirmed by PCR and RT-qPCR.

[0034] Moreover, this invention improves the efficiency of resistant bud differentiation by regularly changing the termethin screening medium; combined with pathogen inoculation and a 0-4 disease grade assessment system, it achieves precise screening of disease-resistant lines, providing repeatable technical support for the application of AcLAC1 to regulate the disease resistance of Tobacco Benzoinus, and ensuring the stability and operability of improving the disease resistance of transgenic plants.

[0035] Compared with some existing related technologies, such as Chinese patent CN110791505A, which focuses on protecting the kiwifruit canker resistance gene AcLac35, its core application is to improve the resistance of kiwifruit and tobacco to canker caused by Pseudomonas syringae pathogenic species (Psa) by overexpressing this gene. The vector used is pCAMBIA1300, and the specific amplification primers are AcLac35-F1 and AcLac35-R2. It does not clearly distinguish the regulation of lignin monomer types.

[0036] This invention utilizes the kiwifruit laccase gene AcLAC1, specifically targeting Nicotiana benthamiana. The gene is amplified using the pBI121-eGFP (subcellular localization) and BG-plant-express (overexpression) vectors with specific primer pairs eGFP-AcLAC1-F / R and BG-AcLAC1-F / R. The enzyme digestion and recombination methods for the subcellular localization vector are clearly defined. Transgenic lines are obtained through optimized transformation and screening conditions. Their disease resistance regulation targets Ralstonia solanacearum, and disease resistance is quantified through a precise disease severity assessment system. This invention differs from existing patents in gene sequence, target species, pathogen type, vector system, primer sequences, and transformation and screening technical details. Attached Figure Description

[0037] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, obtaining other drawings based on these drawings without creative effort still falls within the scope of the present invention.

[0038] Figure 1 A schematic diagram of the subcellular localization of AcLAC1 is shown in one embodiment of the present invention;

[0039] Figure 2 The diagram illustrates the construction and detection of the AcLAC1 overexpression vector in one embodiment of the present invention; in the diagram, M: 2000 bp DNA marker; A: AcLAC1 colony PCR electrophoresis image; B: plasmid map of the AcLAC1 overexpression vector.

[0040] Figure 3 This diagram illustrates PCR verification of transgenic plants in one embodiment of the present invention. In the diagram, M: 2000Maker; 7: positive plasmid control; 1-5, 8-12: transgenic plants (OE); 6: wild-type tobacco (WT).

[0041] Figure 4 The laccase activity and relative expression level of AcLAC1 in transgenic tobacco are shown in one embodiment of the present invention.

[0042] Figure 5 A schematic diagram of tobacco seed germination rate is shown in one embodiment of the present invention;

[0043] Figure 6 The figure shows the lignin content in the transgenic tobacco OE4 strain in one embodiment of the present invention. In the figure, A: total lignin content; B: lignin monomer content;

[0044] Figure 7This illustration shows the effect of Raman signals and distribution of lignin monomers in the transgenic tobacco OE4 line in one embodiment of the present invention. In the figure, A: Raman signal peak; B: Raman image.

[0045] Figure 8 This illustration shows a toluidine blue staining observation of AcLAC1 overexpression in *Nicotiana benthamiana* in one embodiment of the present invention. In the figure, B: xylem width; C: vessel cell wall thickness; Pi: pith; X: xylem; Co: cortex; P: phloem.

[0046] Figure 9 Electron microscopic observations of the stems of wild-type and transgenic tobacco plants are shown in one embodiment of the present invention;

[0047] Figure 10 The diagram illustrates the protective effect of transgenic *Ralstonia benthamiana* plants overexpressing AcLAC1 against *Ralstonia solanacearum* in one embodiment of the present invention. In the figure, A: phenotypic observation; B: disease index.

[0048] Figure 11 PCA analysis of transcriptome samples is shown in one embodiment of the present invention;

[0049] Figure 12 A differential gene statistics graph is shown in one embodiment of the present invention;

[0050] Figure 13 A schematic diagram of RT-qPCR verification in one embodiment of the present invention is shown;

[0051] Figure 14 This diagram illustrates a GO enrichment analysis of DEGs in one embodiment of the present invention.

[0052] Figure 15 This diagram illustrates a KEGG enrichment analysis of DEGs in one embodiment of the present invention.

[0053] Figure 16 A lignin metabolic pathway diagram is shown in one embodiment of the present invention. Detailed Implementation

[0054] The preferred embodiments of the present invention will be described in detail below to provide a clearer understanding of the purpose, features, and advantages of the present invention. It should be understood that the following embodiments are not intended to limit the scope of the present invention, but are merely illustrative of the essential spirit of the technical solution of the present invention.

[0055] In the following description, certain specific details are set forth for the purpose of illustrating various disclosed embodiments in order to provide a thorough understanding of the various disclosed embodiments. However, those skilled in the art will recognize that embodiments may be practiced without one or more of these specific details. In other instances, well-known techniques associated with the invention may not have been shown or described in detail to avoid unnecessarily obscuring the description of the embodiments.

[0056] Throughout this specification, references to "an embodiment" or "an embodiment" indicate that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment. Therefore, the appearance of "in an embodiment" or "an embodiment" in various places throughout the specification does not necessarily refer to the same embodiment. Furthermore, a particular feature, structure, or characteristic may be combined in any manner in one or more embodiments.

[0057] In this embodiment, Agrobacterium-mediated stable genetic transformation technology was used to construct an AcLAC1 overexpression line in the model plant Nicotiana benthamiana. Through histochemical staining, lignin content determination, and disease resistance analysis, the molecular mechanisms of AcLAC1 in cell wall structure regulation, lignin biosynthesis, and plant immune regulation were elucidated.

[0058] 1. Materials and Methods

[0059] 1.1 Test strains and vectors

[0060] The tested strain was *Ralstonia solanacearum*, which was kindly provided by the research group of Professor Peng Lijuan at the College of Tobacco Science, Guizhou University.

[0061] Test vectors: subcellular localization vector pBI121-eGFP and plant overexpression vector BG-plant-express were both purchased from Guanghegu Biotechnology Co., Ltd.

[0062] 1.2 Test reagents and culture media

[0063] Timentin, 6-benzylaminopurine (6-BA), and α-naphthaleneacetic acid (NAA) (Beijing Solarbio Science & Technology Co., Ltd.); glutaraldehyde (Sinopharm Chemical Reagent Co., Ltd.); osmium tetroxide (Beijing Zhongjing Scientific Instruments Technology Co., Ltd.); tannic acid (Shanghai Maclean Biochemical Technology Co., Ltd.), etc. The remaining reagents and kits are standard.

[0064] The culture medium and formulation required for this experiment are shown in Table 1.

[0065] Table 1. Culture media and formulations required for the experiment

[0066]

[0067] 1.3 Main Equipment and Instruments

[0068] Digital micrometer thickness gauge (Deqing Shengtongxin Electronic Technology Co., Ltd.); laser scanning confocal microscope (Leica TCS SP8); confocal Raman microscope (Alpha300R, WITec GmbH); Leica microtome (EM-UC 7); optical microscope (DM750, Leica, Germany); scanning electron microscope (SU8010, Hitachi); high performance liquid chromatography (Agilent 1200); multi-functional microplate reader (SuperMax 3100); centrifuge (Centrifuge 5430); electric thermostatic water bath (HWS-24); thermostatic incubator (DHG). Other instruments and equipment were standard.

[0069] 1.4 Subcellular localization of AcLAC1

[0070] (1) Vector construction: Primers were designed and plasmids were recombined using Snapgene software: pBI121-eGFP-AcLAC1. The templates were amplified using eGFP-AcLAC1-F: GGGGACTCTAGAGGATCCCCATGGATGCCCTCAACAGC and eGFP-AcLAC1-R: TTGCTCACCATGGTACCCCCACATAGGGGCAGATCTGAAG. The amplification system and reaction procedure are shown in Tables 2 and 3 below.

[0071] Table 2: PCR reaction system

[0072]

[0073] Table 3 PCR reaction procedure

[0074]

[0075] Take 50 μL of the amplification product and spot it onto a 1.2% agarose gel for electrophoretic separation.

[0076] After gel electrophoresis, the target band of approximately 1400 bp was excised and recovered using a gel extraction kit according to the manufacturer's instructions. The recovered concentration was 91 ng / μL. The pBI121 vector was linearized using the restriction endonuclease SmaⅠ, digested at 37℃ for 30 min, and then detected by gel electrophoresis. The linearized fragment of the vector was recovered using a gel extraction kit according to the manufacturer's instructions. The recovered concentration was 15 ng / μL.

[0077] The pBI121 vector was linearized using restriction endonucleases (XbaI and SmaI), and the linearized fragments were recovered after digestion at 37°C for 40 min. The components were added to PCR tubes according to Table 4, mixed thoroughly, and then incubated in a PCR instrument at 50°C for 30 min for recombination.

[0078] Table 4: Transient Expression Reaction System

[0079]

[0080] The product was introduced into Escherichia coli DH5α using heat shock transformation technology. After single-clone screening, the product was verified by bacterial PCR and sequencing analysis. Subsequently, the positive clones were purified using the Omega I plasmid extraction kit.

[0081] The successfully constructed recombinant plasmids were identified as pBI121-AcLAC1 and were subsequently transformed into Agrobacterium GV3101.

[0082] (2) Transformation and injection of Agrobacterium: The constructed vector plasmid (1 μL) was transformed into 100 μL of Agrobacterium GV3101 competent cells and treated in the following order: incubation on ice for 5 min, freezing in liquid nitrogen for 5 min, thawing in a water bath at 37℃ for 5 min, and incubation on ice again for 5 min. Then, 900 μL of antibiotic-free YEB liquid medium was added, and the mixture was thoroughly mixed and cultured at 28℃ with shaking for 3 h.

[0083] After cultivation, bacterial cells were collected by centrifugation at 6000 rpm for 1 min. 900 μL of supernatant was discarded, and only 100 μL of bacterial suspension was retained and resuspended. This resuspended suspension was then evenly spread onto YEB solid medium containing the appropriate antibiotic and incubated upside down at 28℃ for 2-3 days. Subsequently, Agrobacterium was scraped off with an inoculation loop and inoculated into 10 mL of YEB liquid medium containing the appropriate antibiotic, and cultured with shaking at 170 rpm for 1 h. Afterward, bacterial cells were collected by centrifugation at 4000 rpm for 4 min. The supernatant was discarded, and the bacterial cells were resuspended in 10 mM MgCl2 solution (containing 120 μMAS) to adjust the OD600 of the bacterial suspension to approximately 0.6.

[0084] Select healthy 4-week-old tobacco plants for injection and mark them accordingly. After injection, place the plants in a low-light environment for 2 days and then observe them.

[0085] (3) Positional observation: Labeled Agrobacterium was injected into tobacco leaves, and slides were prepared for observation and image capture under a laser confocal microscope. Confocal parameters: eGFP: excitation light 488 nm, emission light 507 nm; mcherry: excitation light 561 nm, emission light 610 nm; chloroplast: excitation light 488 nm, emission light 681 nm; peak width ±10 nm.

[0086] 1.5 Construction of overexpression vectors and transformation and screening of Nicotiana benthamiana

[0087] 1.5.1 Construction of AcLAC1 overexpression vector

[0088] Primers were designed and plasmids were recombined using Snapgene software to produce BG-plant-express-AcLAC1. The template was amplified using primers BG-AcLAC1-F: aGAATTCGAGCTCGGTACCCATGGATGCCCTCAACAG and BG-AcLAC1-R: GTCGACTCTAGAGGATCCCCACATAGGGGCAGATCTGA. The AcLAC1 overexpression vector was then constructed.

[0089] 1.5.2 Obtaining AcLAC1 gene-transgenic tobacco plants

[0090] (1) Seed sterilization and culture: Prepare sterile tissue culture glass bottles, 1 / 2 MS sowing medium, sterile water, 75% ethanol, and 10% NaClO solution in advance. Add an appropriate amount of seeds to the sterilized tissue culture bottle, inject a 75% ethanol solution, and sterilize rapidly for 1 min by gentle shaking. Discard the ethanol, rinse once with sterile distilled water, and then add 10% sodium hypochlorite solution. Sterilize continuously for 20 min at a shaking speed of 80-100 rpm under dark conditions. After the sterilization process, remove the sodium hypochlorite solution and rinse repeatedly with sterile water 4-5 times. The treated seeds are evenly distributed on the surface of the 1 / 2 MS medium and then transferred to a photoperiodic incubator with alternating 16 h light (25℃) and 8 h dark (20℃) conditions.

[0091] (2) Cutting explants and pre-culture: When the tobacco plants were cultured for about 50 days, well-grown leaves were selected and cut into 1×1 cm square explants with a scalpel blade, ensuring that the cut edges were smooth. The explant materials were then inoculated on the surface of the pre-cultured solid culture medium, with about 15 explants inoculated per culture dish, and cultured in a constant temperature and dark environment of 20°C for 24 h.

[0092] (3) Activation of Agrobacterium and explant infection: Single colonies were selected and inoculated into 1 mL of LB liquid medium containing the corresponding antibiotic and cultured overnight. Subsequently, the bacterial culture was transferred to 50 mL of LB medium containing the same antibiotic and amplified at 28℃ and 230 rpm until the OD600 reached 0.8-1.0. After the culture was completed, the bacterial cells were collected by centrifugation at 5000 rpm for 5 minutes, the supernatant was discarded, and the bacterial clumps were washed with buffer (4.4 g / L MS, 30 g sucrose, 100 μM acetylsylgenone). After centrifugation under the same conditions and removal of the supernatant, an appropriate amount of resuspension solution was added to resuspend the bacterial cells. Then, the infection solution was poured into a container to fully immerse the cut part of the explant, and after standing for 10 min, the excess infection solution was removed. Finally, the infected explants were cultured at 20℃ in the dark for 2 days.

[0093] (4) Explant differentiation culture: After 2 days of dark culture, the explants were transferred to the selection medium and the medium was changed every 12 to 15 days according to their differentiation. After the differentiated shoots formed on the explants, they were transferred to the shoot growth medium and the medium was changed every 12 to 15 days to promote the further growth of the shoots.

[0094] (5) Rooting culture of explants: After the explants grow into stem segments with independent main stems on the budding medium, they are cut off and inserted into the rooting medium. After 15 to 25 days of culture, roots are formed.

[0095] (6) Hardening and transplanting of transgenic seedlings: Open the caps of the culture bottles and harden the seedlings at room temperature for 1 day. Then wash the culture medium off the roots and transfer them to the nutrient substrate. Water them thoroughly and keep them moist with a transparent cap. After 3 days, culture them normally.

[0096] 1.5.3 Screening of T2 generation Nicotiana benthamiana plants overexpressing AcLAC1

[0097] Using T2 generation transgenic *Nicotiana benthamiana* overexpressing AcLAC1 as experimental material, genomic DNA was extracted from tobacco leaves using the CTAB method. Wild-type *Nicotiana benthamiana* served as a negative control, and gDNA was used as a template for PCR amplification and electrophoretic detection. Using the tobacco β-actin gene as a reference, quantitative PCR analysis was performed using primers NbEF1α-F: TACAACCCTGACAAGATCCCC, NbEF1α-R: CCAGTTTCCACACGACCAAC, and the quantitative PCR primers AcLAC1-qtF and AcLAC1-qtR designed in Chapter 2. Simultaneously, laccase activity was measured in leaves from transgenic tobacco lines and wild-type tobacco plants with similar growth positions and physiological states. Finally, overexpression lines with high AcLAC1 transcription levels and high laccase activity were selected and cultured to 5-8 leaf stages for subsequent studies.

[0098] 1.6 Determination of agronomic parameters of *Nicotiana Benedict* plants overexpressing AcLAC1

[0099] 1.6.1 Phenotypic observation of AcLAC1-overexpressing tobacco Benedict's tobacco

[0100] Tobacco seedlings were cultured in a light incubator, and phenotypic observations and photographs were conducted. At the same time, the thickness of the leaves of the tobacco plant was measured using a thickness gauge, and the root length, plant height, leaf length, leaf width, and stem diameter of the four-week-old tobacco plants were measured with a steel ruler.

[0101] 1.6.2 Seed germination rate determination

[0102] Seeds of Nicotiana benthamiana were placed in 1.5 mL centrifuge tubes and surface-sterilized with sterile water, 75% ethanol, and 10% NaClO solution, followed by washing three times with sterile water. The treated seeds were then mixed with sterile water to prepare a suspension, which was then evenly sown in 1 / 2 MS medium (containing 2.3 g 1 / 2 MS, 15 g sucrose, and 1.5 g plant gel per 500 mL) and incubated in a light incubator to observe seed germination.

[0103] 1.7 Observation of xylem in stems of Nicotiana benthamiana plants overexpressing AcLAC1

[0104] 1.7.1 Histological staining observation

[0105] The location for sampling from *Nicotiana benthamiana* stems was determined, and samples were collected quickly and accurately. The samples were washed with PBS to remove surface deposits and mucus, and 3% glutaraldehyde was added. All samples were microtomed using a Leica (EM-UC7) microtome. *Nicotiana benthamiana* stems were cut into 20 μm sections. After staining with 1% toluidine blue solution for approximately 2 minutes, the sections were washed with water and examined under a microscope. Lignified cells appeared blue-green, and cellulose cells appeared purplish-blue.

[0106] 1.7.2 Scanning electron microscopy observation

[0107] The tobacco stems were washed three times with ultrapure water, 10 min each time. After fixation with 1% osmium tetroxide for 1-2 h, they were washed three more times with ultrapure water, 10 min each time. Dehydration was performed using a stepwise alcohol concentration gradient of 30%, 50%, 70%, 90%, and 100% (with 100% concentration changed three times), 15 min each time. After dehydration and washing, the samples were placed in a freeze dryer. The dried stems were then attached to the sample stage with conductive adhesive and subjected to gold sputtering using an ion sputtering system. Scanning electron microscopy was used for observation and image acquisition of the samples.

[0108] 1.7.3 Determination of lignin monomer content in the stems of Nicotiana benthamiana plants overexpressing AcLAC1

[0109] Weigh 0.2 g of WT and OE4 stems, grind them into a 200-mesh fine powder, add 5 mL of methanol, and extract ultrasonically for 40 min. Centrifuge at 4000 r / min for 10 min, collect the supernatant, repeat the extraction once, combine the extracts, dilute 100 times with methanol, and filter through a 0.22 μm filter membrane for analysis. Chromatographic conditions: VWD detector, Agilent C18 column (250 × 4.6 mm, 5 μm), column temperature 30℃, detection wavelength 275 nm, mobile phase methanol / 0.1% formic acid water (60:40), flow rate 1 mL / min, injection volume 10 μL.

[0110] 1.7.4 Determination of lignin monomer distribution in stems of Nicotiana benthamiana plants overexpressing AcLAC1

[0111] The effects of AcLAC1 on lignin biosynthesis in *N. benthamiana* stems were further investigated by confocal Raman microscopy to detect changes in lignin composition in *N. benthamiana* stems overexpressing AcLAC1. Stem tissues from transgenic and wild-type *N. benthamiana* lines were excised using a sterile scalpel and sent to Wuhan Saiwell Biotechnology Co., Ltd. for cryosectioning. Cross sections were approximately 10 μm thick, with 6–8 sections per treatment.

[0112] An MPlan 100× oil immersion microscope objective (Olympus, NA = 1.40) and a linearly polarized laser (λ = 532 nm) were used. The diffraction-limited spot size was approximately 240 nm, the exposure time was 1 s, the laser intensity was 8 mW, the scanning step size was 0.8 μm, the single-point spectral acquisition time was 1 s, the spectral range was 3100–500 cm⁻¹, the slit width was 100 μm, and the spectral resolution was 2 cm⁻¹. The obtained spectral data were processed and analyzed using Labspec 6 (Horiba Scientific, Lille, France) software.

[0113] 1.8 Determination of disease resistance phenotype in Nicotiana benthamiana plants overexpressing AcLAC1

[0114] Bacterial wilt pathogens are the most common and important bacterial pathogens in tobacco production. R. solanacearum was cultured in LB broth at 28°C with shaking at 200 rpm until OD600 = 0.8. The bacterial cells were collected by centrifugation at 5000 rpm for 5 min at room temperature. The pathogen was diluted with 10 mM MgCl2 solution to OD600 = 0.6 and inoculated onto leaves of *Tobacco Benedict* stably overexpressing AcLAC1. The leaves were cultured alternately under light for 16 h and darkness for 6 h, and the changes in the severity of disease were recorded.

[0115] Disease index was investigated on days 10 and 15 after inoculation. The degree of leaf wilting was used to assess the disease severity and classify the plants into disease grades (0-4). The corresponding grades are: Grade 0 = no wilting, Grade 1 = 1% - 25% leaf wilting, Grade 2 = 26% - 50% leaf wilting, Grade 3 = 51% - 75% leaf wilting, and Grade 4 = 76% - 100% leaf wilting. The disease index calculation formula is as follows:

[0116]

[0117] 1.9 Transcriptome sequencing of Nicotiana benthamiana plants overexpressing AcLAC1

[0118] To investigate the effects of AcLAC1 overexpression on gene expression in the lignin synthesis pathway of tobacco stems, transcriptome sequencing was performed on tobacco stems overexpressing AcLAC1. Stems from 4-week-old wild-type (WT) and transgenic (AcLAC1-OE4) tobacco plants were collected and stored at -80°C for total RNA extraction. The concentration and purity of the extracted RNA were assessed using Nanodrop 2000, and RNA integrity was detected by agarose gel electrophoresis using an Agilent 5300 Bioanalyzer. RNA sequencing was performed on an Illumina NovaSeq 6000 platform at HiMeiJi Biomedical Technology Co., Ltd. RNA-seq data were aligned to the *Nicotiana benthamiana* reference genome using HISAT2 with default settings, followed by transcript discovery and quantification using StringTie. Differential gene expression analysis was performed using DESeq2 with default parameters. Furthermore, RT-qPCR was used to validate the RNA-seq results.

[0119] 2 Results and Analysis

[0120] 2.1 Subcellular localization of AcLAC1

[0121] To investigate the subcellular localization of the AcLAC1 protein, the Plant-mPLoc online analysis tool was previously used for prediction. The prediction results showed that the AcLAC1 protein has a high probability of localizing in the cell membrane. However, the prediction results are only theoretical and need further experimental verification. Therefore, an eGFP-AcLAC1 fusion expression vector was constructed, and Agrobacterium-mediated transient transformation was used to introduce eGFP-AcLAC1 into tobacco leaf cells for transient expression. Laser confocal microscopy was used to observe the transformed tobacco leaf cells. The results showed that the green fluorescence signal was mainly distributed in the cell membrane region, and the signal was clear and specifically localized. The experimental results were consistent with the prediction results, further confirming that the AcLAC1 protein is mainly localized in the cell membrane. Figure 1 As shown.

[0122] 2.2 Identification and Screening of Transgenic Nicotiana Benedictine Plants Overexpressing AcLAC1

[0123] 2.2.1 Identification of AcLAC1 overexpression vectors

[0124] The BG-plant-express vector was linearized using the restriction endonuclease SmaⅠ. After digestion at 37℃ for 30 min, the target gene AcLAC1 was ligated into the linearized vector and transformed into competent E. coli DH5α cells. Following antibiotic selection, positive clones with the correct bands were selected and sent to a sequencing company for sequence verification. Sequencing results showed that AcLAC1 was successfully constructed into the BG-plant-express vector. Figure 2 As shown.

[0125] 2.2.2 Tobacco genetic transformation of AcLAC1

[0126] Agrobacterium-mediated gene transfer was used to introduce the AcLAC1 recombinant plasmid into tobacco leaf tissue. After a 48-hour co-culture process, the treated explants were transferred to a selection medium to induce callus formation. In subsequent culture stages, the callus gradually differentiated into resistant shoots. When these resistant shoots grew to about 2 cm, they were cut off and placed in a rooting medium to promote root formation. After the transgenic plants reached a height of 5 cm, they underwent acclimatization training and were finally transplanted into a nutrient substrate for further culture.

[0127] 2.2.3 Screening to obtain transgenic Nicotiana benthamiana lines overexpressing AcLAC1.

[0128] To confirm the acquisition of transgenic plants, PCR amplification was performed using gDNA from wild-type (WT) and resistant (OE) plants as templates and AcLAC1-F and AcLAC1-R as specific primers.

[0129] Electrophoresis results showed that a specific band (1362 bp) was amplified in some resistant plants, while no amplification of the target band was observed in the wild-type control plants (WT). Figure 3 As shown. Further verification yielded 10 stable transgenic lines, providing a material basis for subsequent functional analysis.

[0130] The transcriptional expression level of AcLAC1 in transgenic plants was analyzed by RT-qPCR. The results showed that the relative expression level of the AcLAC1 gene was lowest in the transgenic line OE6 and highest in the line OE4. Figure 4As shown in Section A, the expression levels of AcLAC1 in lines OE9, OE1, OE2, and OE4 were significantly higher than those in OE6, representing the four lines with the highest AcLAC1 expression levels. These levels were 6.14 times, 9.63 times, 10.56 times, and 16.28 times higher than those in line OE6, respectively. Furthermore, the expression level in the transgenic line AcLAC1-OE4 was significantly higher than that of the other lines. Next, the laccase activity of the 10 transgenic lines was measured, with wild-type tobacco (WT) as a control. The results showed that the laccase activity of all transgenic lines was significantly higher than that of WT, such as... Figure 4 As shown in Section B, AcLAC1 overexpression effectively enhances the physiological function of laccase. Furthermore, the laccase activity in the AcLAC1-OE4 line was found to be significantly higher than that in other transgenic lines. Therefore, AcLAC1-OE4 was selected as the focus of subsequent research.

[0131] 2.3 Regulatory effect of AcLAC1 overexpression on the growth and development of Nicotiana benthamiana

[0132] In terms of morphological characteristics, the AcLAC1-OE4 line exhibited significant growth advantages. Specifically, its leaves were significantly thicker, with markedly increased leaf length and width, significantly thicker stems, more vigorous root development, and significantly increased root length, while plant height also increased to some extent. Compared with WT, OE4 showed increases of 22.75%, 18.60%, and 39.11% in leaf length, leaf width, and plant height, respectively. Simultaneously, the leaf thickness of OE4 reached 0.74 mm, while that of WT leaves was only 0.33 mm, a reduction of 54.80%. Furthermore, the root length of OE4 was also increased by 29.20% compared to WT. These phenotypic characteristics reflect the positive impact of AcLAC1 overexpression on plant structural growth.

[0133] However, in terms of seed germination rate, AcLAC1-OE4 performed worse than WT. Data showed that at day 12, the seed germination rate of the OE4 line was only 39%, while that of the WT plants reached 91%, a decrease of 57.30% compared to WT. Figure 5 As shown, this indicates that while AcLAC1 overexpression promotes vegetative growth in plants, it may have a certain inhibitory effect on early developmental stages such as seed germination.

[0134] 2.4 Effects of AcLAC1 overexpression on lignin synthesis in transgenic Nicotiana benthamiana plants

[0135] To further investigate the effect of AcLAC1 on lignin synthesis in *Nicotiana benthamiana*, the lignin content of AcLAC1-OE4 was measured in this study. The results showed that the total lignin content in the stems of the OE4 line was significantly higher than that of the wild-type WT. Subsequently, the effect of AcLAC1 overexpression on lignin structure was analyzed. The results revealed that the levels of S-lignin and G-lignin in the OE4 line significantly increased (p < 0.001), with S-type and G-type lignin contents increasing by 60.80% and 60.51%, respectively, while the content and proportion of H-lignin remained relatively stable. Figure 6 As shown, H-lignin will not be discussed in detail in this embodiment.

[0136] To clarify the specific deposition of lignin monomers, Raman spectroscopy was used to detect the lignin structure of tobacco stem cell walls. The spectra showed that the OE4 line exhibited significantly enhanced signal intensities at 1600 cm⁻¹ (total lignin aromatic ring framework vibration), 1270 cm⁻¹ (G lignin monomer aromatic ring ether bond vibration), and 1331 cm⁻¹ (S lignin monomer phenolic hydroxyl bending vibration). Figure 7 As shown in section A of the image, a brighter signal area and a stronger Raman signal indicate a higher concentration of lignin in the cell wall. This further demonstrates that the deposition of total lignin, S-lignin, and G-lignin in the cell wall of the OE4 strain is significantly higher than that of the wild-type WT, and the cell wall structure is also more complete and the outline is clearer, as shown in section A. Figure 7 As shown in Part B. These results indicate that AcLAC1 overexpression promotes the synthesis and accumulation of lignin monomers and significantly enhances the integrity of the cell wall structure.

[0137] Histological observation of the basal segment of the first rhizome of 4-week-old tobacco plants was performed to verify the effect of AcLAC1 overexpression on lignification. The results showed that, compared with wild-type WT, the AcLAC1-OE4 line exhibited a significantly increased number of vessel units in the vascular tissue and a wider xylem region. Figure 8 As shown in sections A and B. Statistical data analysis indicates that the secondary xylem thickness of the OE4 strain was significantly higher than that of the WT strain (p < 0.001), as shown in... Figure 8 As shown in section B. The thickness of the vascular cell wall also increased by 77.83% compared to the WT strain, as shown in section B. Figure 8 As shown in section CB.

[0138] Scanning electron microscopy analysis further confirmed the above phenomenon, showing that the cell walls around the xylem of the OE4 strain were significantly thickened, such as... Figure 9 As shown in the figure. Comprehensive analysis indicates that AcLAC1 overexpression significantly promotes lignin synthesis and deposition, and enhances stem mechanical strength and cell wall structural stability.

[0139] Disease resistance was tested by inoculating with *Ralstonia solanacearum*, and the disease responses of transgenic plants OE4 and wild-type plants WT were observed. Ten days after inoculation with *R. solanacearum*, the OE4 line showed only small areas of lesions on its leaves, and the leaves remained relatively green overall. In contrast, the WT line showed extensive wilting and yellowing of its leaves. Figure 10 As shown in Part A of the diagram. Disease index surveys revealed that on day 10 post-inoculation, the disease index of the control plant WT was 68.89, 3.16 times that of the transgenic line OE4. On day 15 post-inoculation, the disease index of wild-type tobacco WT was 85.56, while the disease index of the transgenic line OE4 was only 32.63, indicating that the disease incidence of the overexpression line OE4 was lower than that of the control. Figure 10 As shown in part B of the document.

[0140] DAB analysis was used to analyze the H2O2 accumulation in the two plants. In the OE4 strain, significant H2O2 accumulation was only detected around the injection wells, while in the WT strain, in addition to accumulation around the injection wells, there was extensive H2O2 accumulation throughout the entire leaf surface. Figure 10 As shown in section A of the diagram. These results indicate that overexpression of AcLAC1 effectively enhances the resistance of *Ralstonia benthamiana* to *Ralstonia solanacearum* and reduces ROS accumulation under pathogen stress.

[0141] 2.6.1 Transcriptome quality control analysis

[0142] To investigate the effect of AcLAC1 overexpression on the expression of genes related to lignin synthesis in tobacco stems, transcriptome sequencing analysis was performed on OE4 samples. After removing low-quality data, the Q20 and Q30 of the sequencing data were greater than 99.08% and 96.92%, respectively, indicating high-throughput and high-quality transcriptome data, as shown in Table 5. Clean reads from each sample were mapped to the high-reference genome of *Tobacco Bengal* to obtain the genome alignment rate for each sample. The alignment rate ranged from 95.57% to 97.64%, indicating high-quality sequencing results suitable for subsequent analysis.

[0143] Table 5. Transcriptome data sequencing statistics

[0144]

[0145] PCA analysis was used to analyze changes in the AcLAC1 overexpression transcriptome. The results showed that the first two principal components (PC1 and PC2) clearly distinguished the transgenic line OE4 from the wild-type WT. Figure 11 As shown.

[0146] Statistical analysis of differentially expressed genes between groups was performed using DESeq2 software, with the selection criteria being p < 0.05 and |log2FC| > 1. Figure 12As shown, in the OE4 vs. WT group, a total of 8972 DEGs were identified, of which 4144 genes were upregulated and 4828 genes were downregulated.

[0147] 2.6.2 RT-qPCR validation of transcriptome sequencing results

[0148] To verify the accuracy of the transcriptome data, 12 DEGs were selected for RT-qPCR analysis. For example... Figure 13 As shown, the expression trends of these genes are highly consistent with the transcriptome sequencing data. This further confirms the reliability of the RNA-seq data and the credibility of the research conclusions.

[0149] 2.6.3 Differential gene enrichment analysis

[0150] GO annotation and enrichment analysis were used to identify the biological processes (BP), cellular components (CC), and molecular functions (MF) involved in differentially expressed AcLAC1 genes in tobacco stems.

[0151] The GO pathway mainly involves the cell cycle, microtubule-related functions, and supramolecular skeletal structure. DEGs are primarily enriched in items such as the whole cell cycle (GO:0022402), mitosis (GO:1903047), microtubule binding (GO:0008017), tubulin binding (GO:0015631), microtubule structures (GO:0005874), cytoskeletal fibers (GO:0099513), supramolecular fibers (GO:0099512), and supramolecular polymers (GO:0099081). Figure 14 As shown, these GO pathways are associated with cytoskeleton and cell cycle regulation and may play important biological functions in microtubules, cell division, and supramolecular structure.

[0152] To further clarify the metabolic pathways involved by DEGs, KEGG analysis was then performed. The results showed that among the top 20 enriched pathways, such as... Figure 15As shown, DEGs related to motor protein metabolism accounted for the largest proportion, followed by DNA replication, phenylpropanoid biosynthesis, starch and sucrose metabolism, and the synthesis of various plant secondary metabolites. Phenylpropanoid biosynthesis was the top three pathways of interest. A total of 218 genes were annotated for this pathway, with several genes involved in phenylpropanoid biosynthesis significantly upregulated. The number of downregulated genes (118) was greater than the number of upregulated genes (100), indicating a significant change in the activity of this pathway after AcLAC1 overexpression.

[0153] 2.6.4 Effects of AcLAC1 on the phenylpropane synthesis pathway in tobacco stems

[0154] Based on previous experimental results and transcriptome analysis data, AcLAC1 overexpression mainly leads to the deposition of large amounts of lignin. To explore the mechanism by which AcLAC1 induces lignin synthesis in tobacco, an in-depth analysis of the phenylpropane metabolic pathway was conducted. A simplified molecular network was constructed based on the expression levels of key unique DEGs in this pathway, such as... Figure 16 As shown, 18 specific DEGs were found to encode five key protein classes, including C4H, C3H, HCT, CCoAOMT, and LAC. Among them, the gene encoding laccase LAC was the most numerous, with 9 genes downregulated and 4 genes significantly activated and upregulated. Notably, the expression differences of genes encoding PAL, 4CL, CCR, COMT, and CAD proteins in the transcriptional data were not significant, suggesting that AcLAC1 may enhance the lignin content and structural stability of tobacco cell walls by activating tobacco-specific laccase genes, promoting the synthesis and deposition of S-lignin and G-lignin.

[0155] 3. Conclusions and Discussion

[0156] In this embodiment, a stable, high-expression AcLAC1 overexpression line, AcLAC1-OE4, was successfully screened, and the biological functions of this gene in regulating lignin synthesis, plant morphogenesis, and disease resistance were systematically investigated. Subcellular localization results showed that AcLAC1 is located in the cell membrane. This finding is highly consistent with the localization characteristics of laccase genes related to lignin synthesis, such as peanut AhLAC63 (Xu et al., 2022) and citrus CsLAC18 (Yao et al., 2025), confirming its molecular basis in cell wall modification at the cell biological level.

[0157] In-depth functional analysis revealed that the AcLAC1-OE4 strain exhibited significantly enhanced laccase activity, which significantly increased cell wall lignin content by promoting the polymerization of S- and G-type lignin monomers. Combined with multidimensional structural analysis techniques such as optical microscopy, scanning electron microscopy, and Raman spectroscopy, the OE4 strain was found to have thicker cell walls, higher lignification, and more complete vascular tissue structure. These structural features directly led to increased plant mechanical strength, manifested as significant phenotypic changes such as thicker stems, thicker leaves, and more developed root systems.

[0158] However, it is noteworthy that excessive lignin deposition inhibits seed germination, which is consistent with the findings of Fang et al. (2020) in Paphiopedilum and Zhao et al. (2022) in maize. This suggests that high lignin accumulation strengthens the physical barrier of the seed coat, hindering water penetration and gas exchange, thereby inhibiting seed germination. This phenomenon indicates that lignin metabolism has a dual regulatory effect at different developmental stages of plants.

[0159] Regarding disease resistance mechanisms, this embodiment demonstrates that AcLAC1-mediated lignin deposition effectively enhances plant defense against pathogens. Inoculation experiments showed that, compared to the wild type, the lesion expansion of the OE4 strain was significantly limited, and ROS accumulation was mainly concentrated in local areas. This may be due to the enhanced cell wall barrier effectively hindering the invasion and spread of pathogens. Transcriptome analysis further revealed the molecular network regulated by AcLAC1. DEGs were significantly enriched in cytoskeleton-related pathways such as cell cycle and microtubule tissue. KEGG enrichment analysis confirmed that the phenylpropanoid metabolic pathway was significantly activated. Several key lignin synthesis genes involved in this pathway, especially members of the laccase family, were strongly regulated, enhancing lignin biosynthesis. These findings elucidate at the molecular level the mechanism by which AcLAC1 synergistically regulates plant disease resistance through multiple pathways.

[0160] In summary, these examples, by integrating methods from multiple disciplines including molecular biology, cell biology, and pathology, systematically elucidated the functional expression characteristics of the AcLAC1 gene in kiwifruit and its disease resistance mechanism in tobacco. The research results not only enrich the theoretical framework for plant laccase gene function research but also provide important genetic resources and practical guidance for the genetic improvement of crop disease resistance.

[0161] Based on this embodiment, the following possible extended applications of the AcLAC1 gene can be realized:

[0162] (1) The application of the AcLAC1 gene in regulating the disease resistance of Nicotiana benthamiana includes: constructing a BG-plant-express overexpression vector containing the AcLAC1 gene; amplifying the target gene using primer pairs BG-AcLAC1-F: aGAATTCGAGCTCGGTACCCATGGATGCCCTCAACAG and BG-AcLAC1-R: GTCGACTCTAGAGGATCCCCACATAGGGGCAGATCTGA; transforming Nicotiana benthamiana leaf explants through Agrobacterium GV3101, and obtaining transgenic lines through co-culture and screening; and screening lines with the expected increase in AcLAC1 transcription level and laccase activity for disease resistance regulation.

[0163] (2) Genetic transformation methods of Nicotiana benthamiana include: Seed sterilization: Nicotiana benthamiana seeds were sterilized with 75% ethanol for 1 min, sterilized with 10% NaClO solution in the dark and shaken for 20 min, rinsed with sterile water 4-5 times and sown on 1 / 2 MS medium; Explant preparation: Leaves of 50-day-old seedlings were cut into 1×1cm explants and pre-cultured in the dark at 20℃ for 24 h; Agrobacterium infection: Agrobacterium containing the AcLAC1 recombinant vector was cultured on LB medium to OD 600 =0.8-1.0, centrifuged at 5000 rpm for 5 min, then resuspended in MS buffer containing 100 μM acetylsyringone, and infected explants for 10 min.

[0164] (3) A method for obtaining disease-resistant tobacco using the AcLAC1 gene, comprising: obtaining transgenic resistant buds by means of the method described in claim 7, cutting off 2cm high buds and transferring them into rooting medium; rooting culture: the rooting medium contains MS 4.43g / L, sucrose 30g / L, NAA 0.1mg / L, and termethin 100mg / L, and cultured for 15-25 days to form roots; hardening and transplanting: opening the culture bottle cap and hardening the seedlings at room temperature for 1 day, washing the roots of the culture medium and transplanting them into the nutrient substrate, watering thoroughly and covering with a transparent cover to keep moist for 3 days.

[0165] The technical terms, principles, or means related to the technical solutions of the present invention mentioned in the above embodiments, which are not described in detail above, are all well-known technologies or common practices that are known to those skilled in the art.

[0166] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. An AcLACl gene, characterized in that, The gene is derived from kiwi fruit, and the nucleotide sequence is shown as SEQ ID NO: 1; And the coding sequence is obtained by amplification with primer pair BG-AcLAC1-F: AGAATTCGAGCTCGGTACCCATGGATGCCCTCAACAG and BG-AcLAC1-R: GTCGACTCTAGAGGATCCCCACATAGGGGCAGATCTGA; When constructing the overexpression vector, the BG-plant-express vector is used, linearized by restriction enzyme Sma I at 37℃ for 30 min, and then recombined with the recovered AcLAC1 gene fragment; The recombinant vector is used for transient transformation of N. benthamiana leaf blades mediated by Agrobacterium.

2. The AcLACl gene according to claim 1, characterized by, The concentration of the amplified fragment obtained after amplification is 91 ng / μL after gel electrophoresis; And the concentration of the linearized pBI121 vector fragment is 15 ng / μL; And, the Agrobacterium-mediated transient transformation time using GV3101 competent cells, ice bath 5 min, liquid nitrogen freezing 5 min, 37℃ recovery 5 min and ice bath 5 min, with 120 μM AS containing 10 mM MgCl2 solution resuspended to OD 600 about 0.

6.

3. Use of AcLAC1 gene in modulating disease resistance in N. benthamiana, characterized in that, It comprises the following steps: Constructing the BG-plant-express overexpression vector containing the AcLAC1 gene; amplifying the target gene with primer pair BG-AcLAC1-F: AGAATTCGAGCTCGGTACCCATGGATGCCCTCAACAG and BG-AcLAC1-R: GTCGACTCTAGAGGATCCCCACATAGGGGCAGATCTGA; And transforming the N. benthamiana leaf explants mediated by Agrobacterium GV3101, and obtaining the transgenic lines through co-culture and screening culture; Screening the lines whose transcription level of AcLAC1 and the increase range of laccase activity reach the expectation for disease resistance regulation.

4. Use of the AcLAC1 gene according to claim 3 for modulating disease resistance in N. benthamiana, characterized in that, The transgenic lines are verified by PCR, and a 1362 bp specific band can be amplified with AcLAC1-F and AcLAC1-R as primers; And the RT-qPCR detection is carried out with NbEF1α as the internal reference and primer pair NbEF1α-F: TACAACCCTGACAAGATCCCC and NbEF1α-R: CCAGTTTCCACACGACCAAC.

5. Use of the AcLAC1 gene according to claim 3 for modulating disease resistance in N. benthamiana, characterized in that, The co-culture uses the culture medium containing MS medium 4.43 g / L, sucrose 30 g / L, 6-BA 1 mg / L and NAA 0.1 mg / L, and is cultured in the dark at 20℃ for 2 days; And the screening culture medium is added with 100 mg / L timentin, and is replaced every 12-15 days until the resistant buds are differentiated.

6. Use of the AcLAC1 gene according to claim 3 for modulating disease resistance in N. benthamiana, characterized in that, The anti-disease regulation, the pathogenic bacteria inoculation adopts OD 600 =0.6 bacteria liquid leaf injection, the culture condition is 16h light / 8h dark alternation, through investigating leaf wilting degree, dividing 0-4 grade disease level, evaluates the disease resistance.

7. A method for genetic transformation of Nicotiana benthamiana, characterized by, It comprises the following steps: Seed sterilization: the N. benthamiana seeds are sterilized with 75% ethanol for 1 min, sterilized with 10% NaClO solution for 20 min in the dark, washed with sterile water for 4-5 times, and then sowed on 1 / 2MS medium; Explant preparation: the 50-day-old seedlings are cut into 1×1 cm explants, and are pre-cultured in the dark at 20℃ for 24 h; Agrobacterium infection: Agrobacterium containing AcLAC1 recombinant vector was grown in LB medium to OD 600 = 0.8-1.0, centrifuged at 5000 rpm for 5 min and resuspended in MS buffer containing 100 μM acetosyringone, and the explants were infected for 10 min.

8. The method of claim 7, wherein the Nicotiana benthamiana is genetically transformed with a nucleic acid sequence encoding a polypeptide having an amino acid sequence of SEQ ID NO:

2. 8 The 1 / 2MS medium contains 2.3 g / L 1 / 2MS, 15 g / L sucrose and 1.5 g / L plant gel, and the culture conditions are 16 h light / 8 h dark, and the temperature is 25℃ under light and 20℃ in the dark; The initial culture of Agrobacterium was carried out in LB liquid medium containing the corresponding antibiotics, and the culture was carried out at 28℃ with 230rpm shaking; Preferably, the method further comprises a differentiation culture step: the infected explants are transferred into a screening medium containing 6-BA 1.0mg / L, NAA 0.1mg / L and timentin 100mg / L, and cultured at 20℃ with light, and the medium is replaced every 12-15 days until differentiated buds are formed.

9. A method for obtaining disease-resistant N. benthamiana using AcLAC1 gene, characterized by, The method comprises: The transgenic resistant buds are obtained by the method of claim 7, and 2cm high bud bodies are cut and transferred into rooting medium; The rooting culture is carried out in rooting medium containing MS 4.43g / L, sucrose 30g / L, NAA 0.1mg / L and timentin 100mg / L, and the culture is carried out for 15-25 days to form root systems; The seedlings are acclimated at room temperature for 1 day after the culture bottle is opened, and then transplanted into nutrient medium after the root medium is washed, and the medium is watered and covered with a transparent cover for 3 days; Preferably, the rooting culture condition is 16h light / 8h darkness, the light intensity is 1000-1500lux, the temperature is 25℃ under light and 20℃ under darkness, and the culture condition of the nutrient medium after transplantation is the same light period and the temperature is maintained at 25℃±2℃.

10. The method for obtaining disease-resistant N. benthamiana using AcLACl gene according to claim 9, wherein, The method further comprises disease-resistant strain screening: the transgenic plants inoculated with the pathogen are investigated for disease index at the 10th day and the 15th day after inoculation, the plant disease condition is evaluated according to the wilting degree of the leaves and the disease level is divided, and the corresponding is: 0 level = no wilting, 1 level = 1%-25% of the leaves are wilted, 2 level = 26%-50% of the leaves are wilted, 3 level = 51%-75% of the leaves are wilted, 4 level = 76%-100% of the leaves are wilted, and the disease index calculation formula is as follows: 。

Images